Publications
| Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
|---|
| amv rna transcription in cell-free systems and properties of in vitro chromatin-directed rna synthesis. | in this report we have presented evidence that viral sequences in the genome of amv-infected myeloblasts can be transcribed in vitro. the rna products synthesized in either nuclei isolated from these cells or by eukaryotic rna polymerase b from the isolated chromatin contained approximately 1% virus-specific sequences. this result, which is in agreement with the fraction of viral rna in infected cells (garapin et al. 1971), is higher than expected from a random transcription of the genome, and t ... | 1975 | 169005 |
| polypeptides isolated from ribosome-like structures occluded in avian myeloblastosis virus (amv). | the protein composititon of ribosome-like particles isolated from amv was determined by acrylamide gel electrophoresis and by immunological methods. it was established that the protein spectrum of ribosome-like particles differed significantly form the total protein spectrum of amv. the most characteristic protein components of ribosome-like particles had a molecular weight in the range of 70 000--110 000. apart from these proteins, the viral ribosomal particles contained a small amount of prot ... | 1975 | 169489 |
| quantitative and qualitative differences in dna complementary to avian myeloblastosis virus between normal and leukemic chicken cells. | hybridization of avian myeloblastosis virus (amv) rna with dna immobilized on filters or in liquid with a vast dna excess was used to measure the viral specific dna sequences in chicken cells. newly synthesized viral dna (v-dna) appears within an hour after infection of chicken embryo fibroblasts (cef) with avian oncornaviruses. a fraction of newly synthesized v-dna becomes integrated into the cellular genome and the remainder gradually disappears. a covalent linkage between v-dna and cellular d ... | 1975 | 169823 |
| acquisition of viral dna sequences in target organs of chickens infected with avian myeloblastosis virus. | the distribution of oncornavirus dna sequences in various tissues of normal chickens and of chickens with leukemia or kidney tumors induced by avian myeloblastosis virus (amv) was analyzed by dna-rna hybridization using 35s amv rna as a probe. all the tissues from normal chickens which were tested contained the same average cellular concentration of endogenous oncornavirus dna. in contrast, different tissues from lekemic chickens and from chickens bearing kidney tumors contained different concen ... | 1975 | 170415 |
| electrophoretic mobilities of rna tumor viruses. studies by doppler-shifted light scattering spectroscopy. | we have used laser beat frequency light scattering spectroscopy to measure, at several ph values, the electrophoretic mobilities of purified avian myeloblastosis (amv), murine leukemia (mulv), murine mammary tumor (mumtv), and feline leukemia (felv) viruses. the mobilities of these viruses are similar at ph greater than or equal to7 (-2.7 to -3.2 x 10(-4) (cm/sec)/(v/cm). the isoelectric points of mulv and amv are apparently less than ph 3, whereas for felv the data could be interpreted to indic ... | 1975 | 170961 |
| homology between avian oncornavirus rnas and dna from several avian species. | 3h-labeled 35s rna from avian myeloblastosis virus (amv), rous associated virus (rav)-0, rav-60, rav-61, rav-2, or b-77(w) was hybridized with an excess of cellular dna from different avian species, i.e., normal or leukemic chickens, normal pheasants, turkeys, japanese quails, or ducks. approximately two to three copies of endogenous viral dna were estimated to be present per diploid of normal chicken cell genome. in leukemic chicken myeloblasts induced by amv, the number of viral sequences appe ... | 1975 | 172655 |
| ribonucleotide sequence homology among avian oncornaviruses. | rna sequence relatedness among avian rna tumor virus genomes was analyzed by inhibition of dna-rna hybrid formation between 3h-labeled 35s viral rna and an excess of leukemic or normal chicken cell dna with increasing concentrations of unlabeled 35s viral rna. the avian viruses tested were rous associated virus (rav)-3, avian myeloblastosis virus (amv), rav-60, rav-61, and b-77 sarcoma virus. hybridization of 3h-labeled 35s amv rna with dna from normal chicken cells was inhibited by unlabeled 35 ... | 1975 | 173876 |
| comparative ability of rna and dna to prime dna synthesis in vitro: role of sequence, sugar, and structure of template-primer. | the priming efficiency of oligo(rna) vs. oligo(dna) in a homopolymer template-homooligomer primer system was compared using four dna polymerases. the templates included (dt)n, (da)n, (dc)n, and (di)n. primers were the oligomers of the complementary dna or rna with chain lengths of 6 to 23. the dna polymerases used were from micrococcus luteus, avian myeloblastosis virus (amv), and escherichia coli (polymerase i and polymerase iii). the polymerases demonstrated a preference for the dna primers wi ... | 1975 | 1092334 |
| viral rna replication in extracts of alfalfa mosaic virus-infected vicia faba. | 1975 | 1111216 | |
| amino acid analysis of alfalfa mosaic virus coat proteins: an aid for viral strain identification. | 1975 | 1136143 | |
| studies on sequence homology between the rna's of alfalfa mosaic virus. | 1975 | 1146224 | |
| structural studies on the coat protein of alfalfa mosaic virus. isolation and characterization of the tryptic peptides and the alignment of the cyanogen-bromide fragments. | the reduced and carboxymethylated coat protein of alfalfa mosaic virus (amv 425) was fragmented by means of cyanogen-bromide cleavage. the tryptic peptides from the protein and its four cyanogen-bromide fragments were isolated on a preparative scale by combinations of column and paper separation techniques. the tryptic digest of the carboxymethylated protein contained 24 peptides and two free amino acids. all peptides have been characterized by amino acid analyses and end-group determinations. t ... | 1975 | 1175586 |
| analysis of the pancreatic-ribonuclease-digestion products of alfalfa-mosaic-virus ribonucleic acid. sequence homologies between the different rnas. | alfalfa mosaic virus (amv) genome consists of three pieces of rna (24-s, 20-s and 17-s rna). for infectivity these three rnas and the coat protein are required. in the absence of coat protein, infectivity is obtained by adding the 12-s rna also normally present in the virus. this 12-s rna represents the message for coat protein. thus a redundancy of the gene for coat protein exists between 12-s rna and one of the other rnas. sequence analysis of the oligonucleotides resulting from pancreatic rib ... | 1975 | 1175651 |
| model for the capsid structure of alfalfa mosaic virus. | 1975 | 1185778 | |
| the 5'-end groups of alfalfa mosaic virus rnas are m7g5'ppp5'gp. | 1975 | 1225615 | |
| translation of alfalfa mosaic virus rna's in mammalian cell-free systems. | 1975 | 1239115 | |
| some natural weed hosts of alfalfa mosaic virus. | 1975 | 1243841 | |
| translation of alfalfa mosaic virus rna. effect of polyamines. | 1976 | 1245227 | |
| characterization of two morphologically distinct top component a particles from alfalfa mosaic virus. | 1976 | 1246831 | |
| temperature-resistant strains of alfalfa mosaic virus. | 1976 | 1266043 | |
| proceedings: temperature resistant strains of alfalfa mosaic virus. | 1976 | 1275392 | |
| blocked 5' termini in alfalfa mosaic virus rna. | 1976 | 1275393 | |
| host and virus specific rna polymerases in alfalfa mosaic virus infected tobacco. | the particulate fraction of a homogenate of alfalfa mosaic virus infected tobacco was found to contain the viral replicase, and one or more host-specific rna-polymerases. using an endogeneous template, the membrane-bound replicase incorporates 3h-ctp in virion-type rna. the synthesized rna is part of a replicative intermediate; after rn-ase-treatment the product comigrates with viral double-stranded rna in polyacrylamide gels. a preliminary characterization of this double-stranded rna was made b ... | 1976 | 1275394 |
| composition and biosynthetic activity of polyribosomes associated with alfalfa mosaic virus infections. | 1976 | 982842 | |
| synthesis of dna complementary to the mrnas for milk proteins by e. coli dna polymerase i. | e.coli dna polymerase i (klenow subfragment) was used for the synthesis of complementary dna with the mrnas for rabbit milk proteins as templates. the cdna formed, contained 200 nucleotides and represented about 20% of the mrna template. the cdna was hybridized specifically to the mrna templates. the klenow subfragment of the e.coli dna polymerase i was as efficient as the avian myeloblastosis virus reverse transcriptase in the synthesis of cdna. the mean size of the cdna fragments obtained with ... | 1976 | 775441 |
| identification of dna in the core component of avian myeloblastosis virus. | avian myeloblastosis virus (amv) was found to contain dna associated with the virion. the viral envelope was removed by treating the virus with a nonionic detergent and the dna was found in the core fraction. these experiments indicate that the dna associated with tumor virus is not contaminant associated with the viral envelope and suggest that the dna is part of the internal core component. the dna from avian myeloblastosis virus has a density of 1.70 g/cm3. | 1976 | 178377 |
| evidence for tandem integration of avian myeloblastosis virus dna with endogenous provirus in leukemic chicken cells. | the integration site of avian myeloblastosis virus (amv) proviral dna in dna from leukemia chicken myeloblasts has been studied by three sequential nucleic acid hybridizations that can localize the proviral dna according to the repetitiveness of the adjacent cellular dna regions. first, large denatured cellular dna fragments (2.1 x 10(6) daltons) were reassociated and fractionated according to sequence reiteration frequenct. next, dna remaining single-stranded in each fraction was immobilized on ... | 1976 | 179099 |
| separation of time-defined avian myeloblastosis virus (amv) using column cultivation of leukaemic myeblasts. | a new technique is described of column cultivation of cells immobilized on sial glass cullet. the technique ensures a controlled and continuous production of time-defined young virus. during the column cultivation the morphological characteristics of tho immobilized cells remain essentially unchanged. | 1976 | 179904 |
| stepwise transition of aggregate structure of high-molecular-weight avian myeloblastosis virus rna. mode of releasing of associated 4s rna. | mode of releasing of associated 4s rna species was studied during a controlled transition of aggregate structure of high-molecular-weight amv-rna. it has been found that associated 4s rna constitutes 2.5% of 60s amv-rna complex. approximately 60% of associated 4s rna is successively released during treatment of viral rna with increasing formamide concentration, concomitantly with the transition of 60s rna aggregate through 50--55s rna intermediate into the final 30--40s rna subunits. 40% of 4s r ... | 1976 | 180440 |
| expression of viral proteins in mammalian cells transformed by avian sarcoma viruses. | the expression of viral proteins in nine lines of hamster and rat cells transformed by avian sarcoma viruses (asv) was studied by indirect immunofluorescence with monospecific antisera to purified gp85 and p27 of amv-b and a polyvalent antiserum to all the p proteins of this same virus. the lines of asv-transformed cells were either low virus producers (vp) or inducible or non-inducible non producers (np). cytoplasmic expression of p proteins was observed in all the cell lines except the least i ... | 1976 | 186419 |
| nonspecific immunosuppression and expression of avian myeloblastosis virus (bai strain a). | chickens were treated with cyclophosphamide in order to induce nonspecific immunosuppression. treated and untreated animals were injected with avian myeloblastosis virus (amv) or myeloblasts at the age when a pronounced resistance to the disease is observed. chickens treated with cyclophosphamide and then challenged with amv developed acute myeloblastic leukemia in 70 percent. similarly treated chickens transplanted with fresh amv producing myeloblasts exhibited 30 percent incidence of myeloblas ... | 1976 | 187971 |
| analysis of alfalfa mosaic virus 17 s rna translational products. | 1976 | 945638 | |
| the primary structure of the coat protein of alfalfa mosaic virus (strain 425). | 1976 | 982817 | |
| primary structure of alfalfa mosaic virus coat protein (strain s). | 1976 | 982818 | |
| genetic analysis of alfalfa mosaic virus mutants. | 1976 | 982837 | |
| mechanism of interaction of avian myeloblastosis virus reverse transcriptase with avian myeloblastosis virus rna. | the synthesis of dna on avian myeloblastosis virus (amv) rna as the primer-template using amv reverse transcriptase in vitro has been examined as a function of the concentrations of these components, as well as a function of the ionic strenth of the assay medium. the results are consistent with the hypothesis that two types of sites exist on the amv rna: inactive "dead-end" sites that merely bind the enzyme, and active binding sites that lead to dna synthesis. velocity sedimentation studies of r ... | 1976 | 56463 |
| renal neoplastic response to leukosis virus strains bai a (avian myeloblastosis virus) and mc29. | previous reports described the induction of avian renal neoplasms by leukosis virus strains bai a [avian myeloblastosis virus (amv)] and mc29, and illustrated morphological characteristics of the tumors. continued studies in this work confirm evidence of the origin of the tumors from embryonal cells residual in the posthatched chick. the work further emphasizes differences in histopathology of the neoplasms caused by the two viruses and reveals differences in the histopathogenesis of the respect ... | 1976 | 177194 |
| a study of the states of aggregation of alfalfa mosaic virus protein. | the states of aggregation of alfalfa mosaic virus (amv) protein have been characterized by sedimentation velocity experiments and electron microscopy. the main association product is a spherical particle with an s value of about 30s. it is highly likely that the assembly of this particle starts with dimers of the 25000 molecular mass unit resulting in an icosahedral particle made of 30 dimers. no intermediate aggregation products have been detected. the clustering pattern of the protein in the c ... | 1976 | 13424 |
| restricted addition of proviral dna in target tissues of chickens infected with avian myeloblastosis virus. | proviral dna is synthesized within an hour after infection of chicken cells with an avian oncornavirus and is integrated into nuclear cellular dna within a short time. the viral dna appears to be synthesized as double-stranded molecules of approximately 6 x 10(6) daltons some of which are converted into supercoiled cricles perhaps as a requisite for integration. the endogenous v-dna in normal chicken cells and both the endogenous and amv v-dna in leukemic chicken myeloblasts are covalently linke ... | 1976 | 188728 |
| the oncornavirus maturation process: quantitative correlation between morphological changes and conversion of genomic virion rna. | avian myeloblastosis virus (amv) was harvested at different time intervals from chick leukemic myeloblasts, and the rate of the maturation process of amv was estimated on the basis of morphological changes in the virions and conversion of genomic viral rna. the change from immature virions characterized by the presence of an electronlucent center to the condensed mature form (with dense nucleoid) was accompanied by the conversion of 30-40s rna to 60s rna. both processes were quantitatively defin ... | 1976 | 188781 |
| use of cross-linking in studying the structure of rna tumour viruses. | treatment of intact avian myeloblastosis virus (amv) with dimethyl suberimidate dihydrochloride (dms), a cross-linking agent specific for amino groups, was found to result in progressive cross-linking among viral proteins, as revealed by polyacrylamide gel electrophoresis (page) in the presence of sodium dodecyl sulphate (sds). free viral proteins were not cross-linked. the cross-linked protein complex with an apparent molecular weight of 50,000 daltons was studied in detail. | 1976 | 9823 |
| rna-protein interactions in alfalfa mosaic virus. | particles of the bottom component of alfalfa mosaic virus have a compact bacilliform structure at neutral ph. when the ph is raised to 8.3 the structure unfolds. since the particle weight does not change it is concluded that the protein subunits remain attached to the rna. the particle weight of the spheroidal top component a of the virus is halved when the particles unfold at ph 8.3. this can be explained by the fact that these particles contain two rna molecules of identical size. free rna mol ... | 1976 | 5938 |
| mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus dna polymerase. | storage of the dimeric (alphabeta) form of avian myeloblastosis virus (amv) dna polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. this reduction appears to be the result of cleavages introduced by traces o ... | 1976 | 58080 |
| translation products of the alfalfa mosaic virus ribonuclei acids in wheat-germ cell-free system and in oocytes from xenopus laevis. | 1976 | 64215 | |
| [immunologic aspects of preparation of antiserum to the reverse transcriptase from avian myeloblastosis virus]. | after immunization of rabbits the antiserum was prepared against purified reverse transcriptase (revertase) from avian myeloblastosis virus (amv). the antiserum demonstrated enzymeneutralizing antibody activity that was associated with ummunoglobulin g fraction but not with igm. the high antigenicity of amv revertase for rabbits was shown. the active antiserum was obtained after 4 immunizations of rabbit with approximately 20 microgram of the enzyme. non-specific revertase inhibitors were found ... | 1976 | 88006 |
| bovine leukemia virus: an exogenous rna oncogenic virus? | short term cultures of bovine leukemic lymphocytes release virus particles with biochemical properties of rna oncogenic viruses. these particles, tentatively called bovine leukemia virus (blv) have a high molecular weight-reverse transcriptase complex and a density averaging 1.155 g/ml in sucrose solutions. molecular hybridizations between blv-3h cdna and several viral rnas show that blv is not related to mason-pfizer monkey virus (mpmv) simian sarcoma associated virus (ssv-1) feline leukemia vi ... | 1976 | 64382 |
| detection by immunofluorescence of avian myeloblastosis virus reverse transcriptase. | peripheral blood cells of avian myeloblastosis virus (amv-(infected chickens were examined at various intervals post infection by immunofluorescence. amv revertase was identified in pro- and myeloblasts; it was localized mainly in the perinuclear zone or throughout the cytoplasm. no revertase was found in erythrocytes or granulocytes. blood cells from uninfected chickens of man contained no revertase. | 1976 | 61720 |
| influence of phosphate on activity and stability of reverse transcriptase from avian myeloblastosis virus. | activity of rna-dependent dna polymerase (rddp) from avian myeloblastosis virus (amv), either in purified form or in virus lysates, was increased by phosphorylation. stability of rddp in lysates buffered with phosphate was much greater (no loss of activity in 48 hours at 4 degrees) than that in lysates buffered with tris-cl (76% loss). activity lost in the tris-buffered extracts was completely restored by phosphorylation. the findings suggested that amv rddp activity is influenced by the degree ... | 1976 | 61581 |
| rna-dependent dna polymerase activity of rna tumor virus. vi. processive mode of action of avian myeloblastosis virus polymerase. | purified avian myeloblastosis virus (amv) polymerase consisting of alpha,beta subunits has been shown to act processively in catalyzing dna synthesis primed with 34s amv rna oligo(dt), poly(a)-poly(dt), and poly(i)-poly(dc). dna transcripts prepared with 34s amv rna-oligo(dt)14 and amv polymerase (alphabeta) have been shown to have a molecular weight of 1.05 x 10(6), or approximately one-third the size of the 34s rna genome. polymerase subunit alpha acts nonprocessively with the above templates. | 1976 | 61286 |
| poly 2'-o-ethylcytidylate, an inhibitor and poor template for amv reverse transcriptase. | poly(2'-o-ethylcytidylate) is a poor template-primer for purified avian myeloblastosis virus reverse transcriptase; the relative activities of the template-primers poly(c)-oligo(dg), poly(cm)-oligo(dg) and poly(ce)-oligo(dg) are 23:16:1. a mixture of poly(ce) and poly(di) is inactive as template-primer, in agreement with the observed inability of these to form a helical complex. by contrast the inactivity of poly(ce)-poly(i) is shown to be due to the influence of the 2'-o-ethyl residue. poly(ce) ... | 1976 | 60742 |
| on the association of reverse transcriptase with polynucleotide templates during catalysis. | the association of avian myeloblastosis virus (amv) dna polymerase with polynucleotide templates during catalysis has been studied. during the course of polymerization, different template-primer complexes were added and the ability of the enzyme to switch from one polynucleotide template to another was determined. at 37 degrees c as well as at 4 degrees c, the polymerase is able to switch from certain template-primer complexes to others. for example, the addition of poly(a)-oligo(dt) during the ... | 1976 | 60129 |
| stepwise dissociation of high molecular weight avian myeloblastosis virus rna: 30-40s rna subunits--the best natural template-primer for viral reverse transcriptase. | controlled disruption of 60s amv rna with formamide was used to prepare 50-55s and 30-40s rnas. when the activities of these rnas as templates for amv reverse transcriptase were compared it was found that 50-55s rna was 1-5 times and 30-40s rna 2 to 3 times more active than 60s rna. the 30-40s rna produced by heating, instead of formamide disruption, was inactive as a template but activity was restored by addition of oligo(dt). 40% of the 4s rna initially associated with the 60s rna remained ass ... | 1976 | 59791 |
| evidence for circularization of the avian oncornavirus rna genome during proviral dna synthesis from studies of reverse transcription in vitro. | the rna-directed dna polymerase (deoxynucleosidetriphosphate:dna deoxynucleotidyltransferase ec 2.7.7.7) of avian oncornavirus requires a tryptophan trna (trnatrp) primer molecule located close to the 5' end of the viral rna genome for the initiation of dna synthesis in vitro. in this communication we demonstrate that the dna product, transcribed from avian myeloblastosis virus (amv) 35s rna containing only trnatrp as primer, is located also at the 5' end of the rna genome. more importantly, we ... | 1976 | 57620 |
| immunological distinction between ribonuclease h activity of alpha and alph beta forms of avian myeloblastosis virus (amv) dna polymerase. | 1977 | 65831 | |
| alfalfa mosaic virus protein polymerization. | 1977 | 18611 | |
| transmission of alfalfa mosaic virus through nicandra physaloides seeds and its localization in embryo cotyledons. | alfalfa mosaic virus (amv) was found to be transmitted through seeds of nicandra physaloids l. the average seed transmission rate of the amv isolates t6, lmbg-4 and st amounted to 23, 4 and 0 per cent, repectively. in the cytoplasm of parenchyma cells of embryo cotyledons of seeds from plants infected with the t6 isolate, electron microscopy revealed amv aggregates of type 2a and aggregations of irregularly viral particles with a tendency to subparallel alignment, representing early stages of ty ... | 1977 | 20770 |
| avian myeloblastosis virus rna is terminally redundant: implications for the mechanism of retrovirus replication. | we have determined the terminal heteropolymeric sequences of amv rna by the following procedures: first, rna sequence determination on the 5' terminal and the poly(a)-linked 3' terminal t1 oligonucleotides, and second, analysis by the maxam and gilbert (1977) method of amv strong stop dna and of dna complementary to the poly(a)-linked t1 oligonucleotide, synthesized with reverse transcriptase and (pdt)13 as primer. the structure deduced for the 5' terminal region is (5')7mgpppgmccauucuaccucucacc ... | 1977 | 198142 |
| reverse transcriptase of foamy virus. purification of the enzymes and immunological identification. | reverse transcriptase from foamy virus, strain h4188 was estimated and purified. the enzyme has the following characteristics: 1. the reaction utilized preferentially oligo (dt) poly (ra) as a primer-template; however, the synthetic primer-template oligo (dt) poly (da) could also be used to some extent. 2. the reaction utilized oligo (dg) poly (rc) as a primer-template with very low efficiency. 3. the crude virus preparation had a detectable endogenous reaction using the four deoxyribonucleotide ... | 1977 | 74244 |
| the effect of magnesium and manganese ions on the structure and template activity for reverse transcriptase of polyribocytidylate and its 2'-0-methyl derivative. | the secondary structure of the hydrogen bonded hybrids polycytidylate-oligodeoxguanylate (poly(rc)-(dg)12-18 and poly (2'-ome) cytidylate-oligodeoxyguanylate (poly (rcm)-(dg)12-18 was studied at several magnesium and manganese ion concentrations. these hybrids are effective template-primer complexes for the synthesis of poly(dg) by avian myeloblastosis virus (amv) dna polymerase under disparate ionic conditions. circular dichroism spectra and thermal melting data were obtained as a function of i ... | 1977 | 73165 |
| [presence in immunostimulated cells of an rna molecule utilizable as template for reverse transcriptase of avian myeloblastosis virus (amv)]. | cytoplasmic rna extracted from antigen stimulated immunocompetant cells is transcribed in vitro into dna by the rna directed dna polymerase from avian myeloblastosis virus, in the absence of any added primer. cytoplasmic rna from other organs of the same animal, from non-stimulated immunocompetent cells, or from cells in tissue culture is not transcribed in the absence of exogenous primer. | 1977 | 65233 |
| cyclophosphamide induced sensitivity against avian rna myeloblastosis virus in age-resistant hosts. | the effect of cyclophosphamide administration on survival of 4- to 7-week-old chickens as well as on induction of leukemia after avian myeloblastosis virus (amv) injection was studied. the drug treatment alone did not cause any neoplastic effect in the birds during 4 months of observation. immediate application of amv to cyclophosphamide-pretreated age-resistant chickens induced acute myeloblastic leukemia in about 80 per cent of test animals. the sensitivity of chickens against amv, induced by ... | 1977 | 201874 |
| inactivation of avian myeloblastosis virus dna polymerase by specific binding of pyridoxal 5'-phosphate to deoxynucleoside triphosphate binding site. | avian myeloblastosis virus (amv) dna polymerase is inactivated by preincubation with pyridoxal 5'-phosphate. this inactivation is relatively specific since various pyridoxal-5'-p analogs cause no inactivation. this effect is reversible but can be made irreversible by reduction with sodium borohydride; the reduced pyridoxal-5'-p adduct exhibits a new absorbance maximum at 325 nm and a fluorescence emission at 392 nm when excited at 325 nm. the evidence presented suggests the formation of a schiff ... | 1977 | 190232 |
| characterization of tumour virus proteins. i. radioimmunoassay of the p27 protein of avian viruses. | the major structural protein of avian oncornaviruses, a core component of about 27000 daltons, has been measured by radioimmunoassay. the purified protein was labelled with 125iodine by chloramine-t method. the immune serum titer was defined as the highest serum dilution able to precipitate 50% of the labelled antigen present in the system. standard competition curve was constructed in order to determine the equivalents of protein, in a system with limiting antibody concentration. in the experim ... | 1977 | 190652 |
| homogeneity and complexity of avian oncornavirus proviral dna determined by molecular hybridization. | the homogeneity of dna complementary to the 35s rna subunit of avian myeloblastosis virus (amv) has been demonstrated by single or multistep hybridization. for multistep hybridizations, 35s amv rna was preselected for its ability to hybridize either to unfractionated leukemic dna or to leukemic dna enriched for unique or for reiterated sequences. these experiments indicate that the viral genome is complementary to dna sequences with a low reiteration frequency. competition experiments confirm th ... | 1977 | 191654 |
| monocistronic translation of alfalfa mosaic virus rnas. | the four alfalfa mosaic virus rnas (respectively 24 s, 20 s, 17 s and 12 s) have been used separately as messengers in two in vitro protein synthesizing systems: wheat germ and rabbit reticulocyte lysate. in both systems a polypeptide corresponding to the translation of the entire length of the rna can be found for rnas 24 s, 20 s and 12 s, but not for 17 s rna, the translation product of which is only 35,000 daltons. the number of initiation sites has been determined for each rna by analyzing t ... | 1977 | 866193 |
| preparation of antisera to group-specific antigens of avian leukosis-sarcoma viruses: an alternate approach. | immunization of rabbits with a pooled preparation of chromato-graphically purified avian myeloblastosis virus (amv) group-specific (gs) antigens produced relatively large volumes of antiserum that was as broadly reactive in complement-fixation (cf) tests as antiserum produced in hamsters with tumors induced by rous sarcoma virus. this alternate procedure should be of value for routine preparation of leukosis virus gs antiserum. other antisera prepared against disrupted amv had spurious reactivit ... | 1977 | 194573 |
| search for virus specific dna sequences and viral particles in mitochondria of avian leukemic myeloblasts. | the intracellular localization of the avian myeloblastosis virus (amv) genome was studied. nuclear and mitochondrial dnas from myeloblasts were examined by hybridization with 32p labeled amv-rna of high molecular weight for the presence of virus specific dna sequences. nuclear dna (ndna) from myeloblasts specifically hybridized with viral rna, whereas purified closed circular mitochondrial dna (mtdna) did not hybridize with viral rna. it was therefore concluded that viral genome was present in n ... | 1977 | 197796 |
| single-stranded dna from oncornavirus-infected cells enriched in virus-specific dna sequences. | we previously found that a minor fraction of single-stranded dna (ss-dna) isolated from native nuclear dna of normal chicken embryonic cells and cells of other species hybridized with bulk nuclear dna or cellular rna in great excess. at least one-third of ss-dna belonging to the nonrepetitious part of the cell genome could be hybridized to homologous rnas. in the present work, similar results were obtained with ss-dna from cells of chickens infected by avian myeloblastosis virus (amv). to invest ... | 1977 | 198800 |
| structural studies on the coat protein of alfalfa mosaic virus. the complete primary structure. | the complete amino acid sequence of the coat protein of alfalfa mosaic virus (strain 425) is reported. sequence determinations were mainly performed on peptides obtained from fragmentation by cyanogen bromide and trypsin. both manual and automatic sequence methods were used. some refinements of the solid-phase edman degradation were introduced. the final alignment of the peptides was established by means of alternative cleavage methods, such as limited tryptic digestion of intact virus particles ... | 1977 | 836394 |
| [spontaneous hosts of broad bean wilt virus. communication]. | of 110 plant species, grown from seeds in the vicinity of sources of broad bean wilt virus (bbwv) in 1974, exactly 50% proved to be infected by the mentioned virus within one vegetation period. obviously 54 of the species are previously unknown hosts of bbwv. they belong to the following 21 families: amaranthaceae, boraginaceae, campanulaceae, caryophyllaceae, chenopodiaceae, commelinaceae, compositae, cruciferae, euphorbiaceae, hydrophyllaceae, labiatae, leguminosae, loasaceae, papaveraceae, po ... | 1977 | 878706 |
| virus diseases of berry crops in the soviet far east i. identification of some mechanically transmitted viruses, detected in primorye territory. | in primorye territory, ussr, cucumber mosaic virus (cmv-i), arabis mosaic virus (amv), raspberry, ringspot virus (rrsv), and tomato ringspot virus (trsv) were identified on berry crops (currant, raspberry, honeysuckel). with respect to indicator plants and physico-chemical and serological properties, the isolates obtained do not differ from other isolates of these viruses, reported on berry crops in europe and north america. | 1977 | 610231 |
| purification and characterization of the dna polymerase of human breast cancer particles. | previous studies have identified human breast tumor particles possessing many of the features characteristic of rna tumor viruses. in addition to the expected size (600 s) and density (1.16 g/ml) these include possession of an outer membrane and an inner one surrounding a "core" containing a dna polymerase and a large-molecular-weight (70s) rna possessing detectable homology to the rnas of the mouse mammary tumor virus (mmtv) and of the mason-pfizer monkey virus (mpmv). we report here the purifi ... | 1977 | 265540 |
| nucleotide sequence of 5' terminus of alfalfa mosaic virus rna 4 leading into coat protein cistron. | the sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus rna 4, the mrna for the viral coat protein, has been deduced by using various new techniques for labeling the rna at the 5' end with 32p and for sequencing the 5'-32p-labeled rna. the sequence is npppguuuuuauuuuuaauuuucuuucaaauacuuccaucaugaguucuucacaaaagaaagcuggugggaaagcugg. the aug initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat p ... | 1977 | 271973 |
| cell surface labelling of mononuclear cells with antisera associated to turnip yellow mosaic virus of alphalpha mosaic virus particles. a freeze-etch study. | turnip yellow mosaic virus (tymv) and alphalpha mosaic virus (amv) were used as immuno-electron microscopical markers to detect cell surface receptors on mononuclear cells in freeze-etch replicas. tymv particles were conjugated with vacuum-distilled glutaraldehyde to rabbit igg anti-mouse immunoglobulins (tymv-ramig conjugate) or to rabbit igg anti-mouse theta antigen (tymv-ramth conjugate). b-lymphocytes incubated with tymv-ramig conjugate showed either randomly distributed particles or patches ... | 1977 | 301135 |
| initiation of polypeptide synthesis with various nh2-blocked aminoacyl-trnas under the direction of alfalfa mosaic virus rna 4. | initiation of polypeptide synthesis in a cell-free system of escherichia coli directed by alfalfa mosaic virus rna 4 was studied by using either fmet-trna or ac-phe-trna as initiator trna. initiation with fmet-trna yielded a product that was identical to the authentic viral coat protein except that the nh2-terminal serine was preceded by fmet instead of being acetylated. when ac-phe-trna was used as initiator, the biosynthetic product was 10-12 amino acid residues longer, the extra amino acids b ... | 1977 | 341161 |
| [determination of the primary structure of alfalfa mosaic virus (strain s) coat protein. ii. complete sequence of the protein (author's transl)]. | the alfalfa mosaic virus protein was submitted to the action of cyanogen bromide. four peptides were isolated. study of these peptides allowed us to determine the order. then protein was submitted, after s-carboxymethylation or s-aminoethylation, to the action of different proteolytic enzymes: trypsin, chymotrypsin, thermolysin and papain. the peptides issued from these different hydrolysis were separated on dowex 50 x4 and dowex 1 x2, and their amino acid composition was determined. the use of ... | 1977 | 884129 |
| calorimetric studies on the interaction of rna and coat protein of alfalfa mosaic virus. | 1977 | 891980 | |
| molecular weights of particles and rnas of alfalfa mosaic virus. number of subunits in protein capsids. | 1977 | 911783 | |
| rna-dependent rna polymerases in uninfected and in alfalfa mosaic virus-infected tobacco plants. | 1977 | 898679 | |
| [determination of the primary structure of alfalfa mosaic virus (strain s) coat protein. i. determination of the molecular weight of the protein, its amino acid composition and studies on its n- and c-terminals (author's transl)]. | 1977 | 884128 | |
| in vitro transformation with avian myelocytomatosis virus strain cmii: characterization of the virus and its target cells. | avian myelocytomatosis virus strain cmii induced an in vitro transformation in cells from various hematopoietic tissues and could be quantitated by focus and soft agar colony assay techniques. the cmii-transformed bone marrow cells had a high proliferative capacity in comparison to uninfected controls. the cells closely resembled hematopoietic cells transformed by strain mc29 myelocytomatosis virus, but differed from avian myeloblastosis virus (amv)-transformed cells. they were phagocytic, becam ... | 1977 | 18625478 |
| coat protein binds to the 3'-terminal part of rna 4 of alfalfa mosaic virus. | all four rnas of alfalfa mosaic virus contain a limited number of sites with a high affinity for coat protein [van boxsel, j. a. m. (1976), ph.d. thesis, university of leiden]. in order to localize these sites in the viral rnas, rna 4 tthe subgenomic messenger for coat protein) was subjected to a very mild digestion with ribonucleast t1. the ten major fragments, apparently resulting from five preferential hits, were separated and tested for messenger activity in a wheat germ cell-free system, as ... | 1978 | 99164 |
| sedimentation of multicomponent viruses: evaluation of sedimentation coefficient ratios. | ratios of the sedimentation coefficients for alfalfa mosaic virus components are shown to be independent of the virus concentration and the density of the solvent. different numbers of components are observed in solvents of different density. this implies that in sedimentation velocity experiments an estimate of the number of components of a multicomponent virus should involve centrifugation in solvents of different density. for some viruses, estimates of the sedimentation coefficients of indivi ... | 1978 | 621136 |
| characterization of alfalfa-mosaic-virus protein polymerization in the presence of nucleic acid. | the polymerization of alfalfa mosaic virus (amv) protein in the presence of homologous nucleic acids and a number of other natural and synthetic nucleic acids was studied. the conditions for optimal assembly were found to be ph 6.0 and low ionic strength (i = 0.1 m) at room temperature, irrespective of the type of nucleic acid. the resulting nucleoprotein particles exhibited the same structural characteristics as the virus. this information emerged from optical diffraction and computer filtering ... | 1978 | 624280 |
| isolation of viral double-stranded rnas using a licl fractionation procedure. | a general procedure for the isolation of virus-specific double-stranded rna (ds-rna) is discribed. the procedure is based on the differential solubility of different types of nucleic acids in licl. principal advantages over conventional methods are simplicity, avoidance of enzymatic treatment, and relatively good yields of undegraded ds-rna while permitting separation of several main groups of cellular and viral nucleic acids from the same batch of tissue. the method has been successfully applie ... | 1978 | 643823 |
| influence of a few coat protein subunits on the base-paired structure of the rna species of alfalfa mosaic virus. | differentiated thermal melting profiles were made of all the three rna species (rnas 1, 2 and 3), constituting the genome of alfalfa mosaic virus and of the subgenomic coat protein messenger rna (rna 4) of this virus. whereas all profiles showed multiphasicity the profile of rna 4 was most clearly subdivided showing three clear transitions with tm values of 25.5, 35.5 and 53 degrees c. the first transition disappeared upon addition of 6 coat protein molecules per molecule of rna 4. the effect of ... | 1978 | 698231 |
| alfalfa mosaic virus rna. determination of the sequence homology between the four rna species and a comparison with the four rna species of cucumber mosaic virus. | the method of taylor et al. [taylor, j. m., illmensee, r & summers, j. (1976) biochim. biophys. acta, 442, 324--330 and gould and symons (1977) nucleic acids res. 4, 3787--3802] has been used to transcribe complementary dna probes from the four major rnas of alfalfa mosaic virus (amv). analysis of the kinetics of hybridization of these probes in homologous and heterologous complementary dna . rna hybridization reactions has shown that the sequence of the smallest rna (rna 4), which contains the ... | 1978 | 720343 |
| size and secondary structure of avian myeloblastosis virus associated ribosomal rna: comparison with cellular and precursor ribosomal rna. | ribosomal rna isolated from ribosomes present inside avian myeloblastosis virus (amv) was characterized by electron microscopy using the formamide-urea spreading technique. the molecular weight and the secondary structures were compared with those of r-rna and precursor r-na isolated from host cells, the leukemic myeloblasts. the molecular weight of viral r-rna (1.62 +/- 0.18 x 10(6) and 0.69 +/- 0.10 x 10(6)) and the molecular weight of cellular r-rna (1.63 +/- 0.18 x 10(6) and 0.67 +/- 0.09 x ... | 1978 | 205195 |
| complete sequences of the ribosome recognition sites in vesicular stomatitis virus mrnas: recognition by the 40s and 80s complexes. | nucleotide sequences of the ribosome-protected translation initiation sites from the vesicular stomatitis virus (vsv) m and l protein mrnas have been determined, completing the sequences of the sites from all the vsv mrnas. a low level of protection at two internal aug-containing sites in the n mrna is also described. small homologies are evident among some of the sites, but there are no obvious features common to all the sites other than a single aug codon. in contrast, a large homology between ... | 1978 | 208778 |
| specific effect of zinc ions on dna polymerase activity of avian myeloblastosis virus. | the effect of selected cations on dna synthesis by dna-polymerase of avian myeloblastosis virus (amv) was studied. zinc ions at low concentration (0.2mm) in the assay system enhanced the activity about 2 x fold and at higher concentration (2.0 mm) inhibited the activity completely. in contrast, addition of lithium and potassium salts produced inhibitory effects in this ionic concentration range. replacement of k+ ion had an inhibitory effect on the activity. | 1978 | 214695 |
| coat protein polymerization of alfalfa mosaic virus strain vru. | 1978 | 712854 | |
| properties of solubilized rna-dependent rna polymerase from alfalfa mosaic virus-infected and healthy tobacco plants. | 1978 | 33485 | |
| biochemical and immunological characterization of a reverse transcriptase from human melanoma tissue. | an rna-direct dna polymerase was purified from human melanoma tissue by successive column chromatography on deae-cellulose (de-23 and de-52) and phosphocellulose. the purified reverse transcriptase has a mol. wt. of 68,000, a ph optimum of 8.0, a mn2+ optimum of 0.6 mm, and a kcl optimum of 60 mm. the purified enzyme transcribes (ra)n - (dt)12, (rc)n - (dg)18, (ome-rc)n - (dg)18 and a 70s rna from rauscher leukemia virus (rlv), but failed to transcribe (da)n - (dt)12. this enzyme has no terminal ... | 1978 | 83188 |
| effects of benzo(a)pyrene adducts of dna synthesis in vitro. | two diol epoxides of benzo(a)pyrene (bp), and benzo(a)pyrene 4,5-oxide, have been used to make adducts in the homopolymers polyribocytidylic acid, (rc); polyriboadenylic acid (ra), polydeoxycytidylic acid (dc) and polydeoxyadenylic acid (da). with appropriate oligomers as primers these modified and unmodified polynucleotides were used as templates for dna synthesis with avian myeloblastosis virus dna polymerase (amv) or e. coli pol i dna polymerase. we have found that: (1) the size of the dna pr ... | 1978 | 82490 |
| virus-coded origin of a 32,000-dalton protein from avian retrovirus cores: structural relatedness of p32 and the beta polypeptide of the avian retrovirus dna polymerase. | a 32,000-dalton protein (p32) located in avian retrovirus cores was immunoprecipitated from [35s]methionine-labeled avian myeloblastosis virus (amv) propagated in cultured chicken embryo fibroblast cells by an antiserum preparation (sarc iii) derived from tumor-bearing hamsters injected with cloned and passaged cells from an avian sarcoma virus-induced primary hamster tumor. since sarc iii serum apparently contained antibodies only to virus-coded proteins and not to chicken cellular proteins, th ... | 1978 | 81316 |
| phosphonoformate inhibits reverse transcriptase. | the new antiviral substance phosphonoformate (pfa) has been tested in a cell-free system for its effect on reverse transcriptases from an avian retrovirus (avian myeloblastosis virus, amv) and from mammalian retroviruses (rauscher leukaemia virus, rmulv; bovine leukaemia virus; baboon endogenous virus; simian sarcoma virus; visna virus). the observed inhibitory effect of pfa has been compared with that of a structurally related substance, phosphonoacetate (paa). phosphonoformate, at a concentrat ... | 1979 | 94344 |
| endonuclease activity of purified rna-directed dna polymerase from avian myeloblastosis virus. | highly purified preparations of rna-directed dna polymerase from avian myeloblastosis virus (amv) contain a mn2+-activated endonuclease activity capable of nicking supercoiled dna. this endonuclease activity co-sediments in glycerol gradients with the alphabeta form of amv dna polymerase, and co-chromatographs with dna polymerase activity on deae-cellulose, phosphocellulose, and heparin-sepharose. it is also present in amv alphabeta-dna polymerase purified by electrophoresis through nondenaturin ... | 1979 | 83998 |
| 3'-terminal nucleotide sequence of alfalfa mosaic virus rna 4. | the sequence of the 3'-terminal 91 nucleotides of alfalfa mosaic virus rna 4, the messenger for the viral coat protein, has been elucidated. a fragment containing the 3' terminus of the rna was obtained by mild digestion with rnase t1. the primary structure of the fragment was deduced by labeling it in vitro at its 5' terminus and application of rna sequencing techniques. the sequence is completely extracistronic and is believed to contain the binding sites for the viral coat protein and replica ... | 1979 | 108677 |
| a new method for the size estimation of the rna genome segments of influenza virus. | previous estimates of the size of the rna genome segments of influenza virus have been unreliable because of a lack of suitable rna species as size markers. we have attempted to overcome this problem by utilising the ability of amv reverse transcriptase to synthesise full length dna copies of rna molecules in the presence of a suitable primer. by comparing such dna copies of the rna segments of the influenza virus genome with sequenced restriction fragments from the e. coli plasmid pbr322, we ha ... | 1979 | 88039 |
| problems with particle-associated dna polymerase assays in the diagnosis of plasma-suspended viruses. | the in vitro reaction results of virus-associated dna polymerases for the demonstration of plasma-suspended particles of avian leukemia virus (amv) and of hepatitis type b virus (hbv) were compared. amv particles could be identified by the transcription of the templates poly mc(dg)12-18, poly rat10, and poly d(at) using standardized reaction mixtures. with comparable test conditions, no dna polymerase activity was found in human plasma containing hbv. these findings and the results of a systemat ... | 1979 | 92114 |