Publications
| Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
|---|
| herpesvirus infection in man. | herpesviruses which affect man are herpes simplex virus type 1 and type 2, varicella-zoster virus, cytomegalovirus and epstein-barr virus. the review deals with the more common clinical manifestations of human herpesvirus infections, which occur ubiquitously in all populations throughout the world. primary infections most commonly occur in childhood. it is a characteristic feature of herpesvirus that they generally remain in a latent form after clearance of the primary infection. the overall maj ... | 1985 | 3006233 |
| membrane markers, target cell specificity, and sensitivity to biological response modifiers distinguish human natural cytotoxic from human natural killer cells. | in the present report, we provide evidence for the distinct existence of a human natural cytotoxic (hnc) cell. this hnc cell can be identified by the monoclonal antibody hnc-1a3 and by the absence of the t10 antigen, other antigenic markers being shared, at least in part, with natural killer (nk) cells, t cells, or monocytes. in addition, the hnc cell preferentially kills the ma-160 target, the herpes simplex virus-1-infected ma-160 cell line, and the two human tumor cell lines hep-2 and hf-2. i ... | 1985 | 2932473 |
| binding site and subclass specificity of the herpes simplex virus type 1-induced fc receptor. | immunoglobulin fc-binding activity was detected by indirect immunofluorescence employing fluorochrome conjugated f(ab')2 antibody fragments on acetone-fixed cell cultures infected with herpes simplex virus type 1 (hsv-1). using this method the fc receptor-like activity seemed to be restricted to the igg class of human immunoglobulins. while igg1, igg2, and igg4 myeloma proteins bind to this putative fc gamma receptor at a concentration of 0.002 mg/ml, igg3 myeloma proteins were without activity ... | 1985 | 2982735 |
| herpes simplex virus type 1 infection of endothelial, epithelial, and fibroblast cells induces a receptor for c3b. | we recently demonstrated that herpes simplex virus type 1 (hsv 1) induces a receptor on human umbilical vein endothelial cells for complement component c3b (c3br). we assigned this receptor function to hsv 1 viral glycoprotein c (gc) based on several observations: tunicamycin, which prevents glycosylation and expression of n-linked glycoproteins on the surface of infected cells, markedly reduced expression of the c3br; monoclonal antibodies to hsv 1 gc blocked detection of the c3br, whereas mono ... | 1985 | 2982950 |
| herpes simplex virus vaccines--where are we? | 1985 | 2985314 | |
| an unusual spliced herpes simplex virus type 1 transcript with sequence homology to epstein-barr virus dna. | high-resolution transcription mapping localized a spliced 2.7-kilobase herpes simplex virus type 1 mrna. the 4-kilobase intron of this transcript encodes a nested set of transcripts on the opposite dna strand. the nucleotide sequence of the dna encoding the left-hand and right-hand exons of the spliced transcript was determined, and the salient features are presented here. of major interest is that both exons contained regions within several hundred bases of the splice donor and acceptor sites w ... | 1985 | 2985801 |
| purification of epstein-barr virus dna polymerase from p3hr-1 cells. | the epstein-barr virus dna polymerase was purified from extracts of p3hr-1 cells treated with n-butyrate for induction of the viral cycle. sequential chromatography on dna cellulose, phosphocellulose, and blue sepharose yielded an enzyme preparation purified more than 1,300-fold. the purified enzyme was distinct from cellular enzymes but resembled the viral dna polymerase in cells infected with herpes simplex virus type 1 or 2. the active enzyme had an apparent molecular weight of 185,000 as est ... | 1985 | 2985818 |
| fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus dna. | a strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (vzv) dna was found to be due to an insertion or deletion of dna sequences at a single site. dna sequence analysis showed that the nucleotide sequence ccgccgatggggagggggcgcggtacc is tandemly duplicated a variable number of times in different vzv strains and is responsible for the observed variation in mobilities of restriction fragments from this region of vzv dna. the variable ... | 1985 | 2985828 |
| vaccinia virus recombinant expressing herpes simplex virus type 1 glycoprotein d prevents latent herpes in mice. | in humans, herpes simplex virus causes a primary infection and then often a latent ganglionic infection that persists for life. because these latent infections can recur periodically, vaccines are needed that can protect against both primary and latent herpes simplex infections. infectious vaccinia virus recombinants that contain the herpes simplex virus type 1 (hsv-1) glycoprotein d gene under control of defined early or late vaccinia virus promoters were constructed. tissue culture cells infec ... | 1985 | 2986288 |
| [genetic transformation of somatic cells. iii. an analysis of the status of the plasmid nucleotide sequences in the extrachromosomal dna of transformant clone cells and the rescue of extrachromosomal molecules of the plasmid dna]. | extrachromosomal dnas from tk+ transformant clones of a238 chinese hamster cells isolated after the treatment with plasmid pst826 containing thymidine kinase gene (tk-gene) of herpes simplex virus (hsv1) and 1.8 kb insert of human satellite iii dna (hsiii) were studied by hybridization technique. in two tk+-clones (2t301 and 2t16) large quantities of rearranged plasmid dna molecules were found. electron microscopy show in clone 2t301 the presence of circular dnas with average length being 4.64 + ... | 1985 | 2990075 |
| cell-specific selection of mutants of a herpes simplex virus recombinant carrying deletions. | herpes simplex virus 1 (hsv-1) recombinant r316 was constructed so as to convert the thymidine kinase (tk), a beta gene, into an alpha-regulated gene by insertion of the bamhi n fragment in the proper transcriptional orientation into the bglii cleavage site of the tk gene (l. e. post, s. mackem, and b. roizman, cell 24, 555-565 (1981).) the bamhi n fragment contains the promoter and regulatory domains of the alpha 4 gene in addition to an origin of viral dna synthesis and the complete domain of ... | 1985 | 2990098 |
| herpes simplex virus 1 mutant deleted in the alpha 22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. | r325-beta tk+, a herpes simplex virus 1 mutant carrying a 500-base-pair deletion in the alpha 22 gene and the wild-type (beta) thymidine kinase (tk) gene, was previously shown to grow efficiently in hep-2 and vero cell lines. we report that in rodent cell lines exemplified by the rat-1 line, plating efficiency was reduced and growth was multiplicity dependent. a similar multiplicity dependence for growth and lack of virus spread at low multiplicity was seen in resting, confluent human embryonic ... | 1985 | 2991560 |
| inhibition of herpes simplex virus replication in vitro by human cytotoxic t cell clones and natural killer cell clones. | the abilities of human cytotoxic t cell (ctl) clones and natural killer (nk) cell clones to inhibit the replication of herpes simplex virus (hsv) in vitro were shown. the specificities of clones inhibiting hsv replication were the same as those of cytotoxicity in hsv type specificity and hla restriction, i.e. hsv type 1 (hsv-1) and hsv type 2 (hsv-2) common ctl clones inhibited the replication of both hsv-1 and hsv-2 in autologous cells, but not in allogeneic cells. hsv-1-specific ctl clones inh ... | 1985 | 2995557 |
| effect of herpes simplex virus type 1 on cellular pools of oligosaccharide-lipid. | incorporation of [3h]mannose into cellular pools of mannosylphosphoryl dolichol (man-p-dol), oligosaccharide-lipid, and glycoprotein was measured and compared in herpes simplex virus type 1 (hsv-1)-infected cells and -uninfected cells. while mannose incorporation into the monosaccharide-dolichol fraction was similar in infected or uninfected vero cells, incorporation into the oligosaccharide-lipid fraction was markedly reduced in hsv-1-infected cells (64% of control levels). in contrast, mannose ... | 1985 | 2998058 |
| inhibition of herpes simplex virus type 1-induced interferon synthesis by monoclonal antibodies against viral glycoprotein d and by lysosomotropic drugs. | components of herpes simplex virus remained bound to the diploid cell membrane after nucleocapsid penetration into the cytosol. these components enabled the infected cells to induce interferon-alpha (ifn-alpha) in peripheral blood mononuclear cells even when the infected cells were fixed by glutaraldehyde. monoclonal antibodies directed against the major viral glycoprotein d could neutralize their ifn-alpha-inducing capacity. thus, the process of ifn induction does not require uptake and penetra ... | 1985 | 2999320 |
| recovery of herpesviruses from cerebrospinal fluid of immunodeficient homosexual men. | over a one-year period the cerebrospinal fluid (csf) obtained from a series of homosexual men immunocompromised with either hodgkin's disease or acquired immune deficiency syndrome (aids) was cultured to assess the frequency with which infectious viruses could be recovered. of 58 patients examined, 4 (6.9%) had csf cultures that showed a cytopathology consistent with a virus infection. all isolates proved to be herpesviruses. cytomegalovirus (cmv) and varicella-zoster virus were isolated from cs ... | 1985 | 3000285 |
| herpes simplex virus expressing epstein-barr virus nuclear antigen 1. | dna fragments containing an open reading frame known to encode most or all of the ebna1 protein of epstein-barr virus (ebv) were fused in the proper transcriptional orientation to the promoter regulatory domain, capping site, and a portion of the 5' transcribed noncoding sequences of the hsv-1 alpha 4 gene of herpes simplex virus 1 (hsv-1). in these constructs 20, 130, or 385 bp of ebv dna and 28 bp of hsv-1 dna separated the alpha 4 cap site from a putative initiator codon of the ebna1 gene. th ... | 1986 | 3002038 |
| evolutionary comparisons of the s segments in the genomes of herpes simplex virus type 1 and varicella-zoster virus. | the genomes of herpes simplex virus type 1 (hsv-1) and varicella-zoster virus (vzv) consist of two covalently joined segments, l and s. each segment comprises an unique sequence flanked by inverted repeats. we have reported previously the dna sequences of the s segments in these two genomes, and have identified protein-coding regions therein. in hsv-1, the unique sequence of s contains ten entire genes plus the major parts of two more, and each inverted repeat contains one entire gene; in vzv, t ... | 1986 | 3007657 |
| establishment of a rat cell line inducible for the expression of human cytomegalovirus immediate-early gene products by protein synthesis inhibition. | upon transfection of rat-2-tk- cells with plasmid pes, containing the cloned 7.0-kilobase (kb) ecori-sali fragment (0.063 to 0.089 map units) of the human cytomegalovirus genome, major immediate-early antigen expression was obtained in 1 to 2% of the nuclei of the transfected cells, as determined by immunofluorescence with the e3 monoclonal antibody. cotransfection of pes with the cloned herpes simplex virus type 1 thymidine kinase gene resulted in the establishment of a hypoxanthine-aminopterin ... | 1986 | 3009892 |
| studies on herpes simplex virus type 1 glycoproteins using monoclonal antibodies. | monoclonal antibodies against herpes simplex virus type 1 glycoproteins were isolated and utilized to study the synthesis and processing of glycoproteins b, c, and d (gb, gc, gd, respectively). monoclonal antibodies against both gb and gd had higher virus-neutralizing activity when compared to that of gc. differences among these glycoproteins were observed in their time of appearance in the virus-infected cells. the presence of gd was detected at a very early stage of infection when compared to ... | 1986 | 3010559 |
| herpes simplex virus immediate early infected-cell polypeptide 4 binds to dna and promotes transcription. | in herpes simplex virus (hsv)-infected cells, there is a sequential expression of viral genes. in vivo experiments have implicated the mr 175,000 immediate early protein icp4 (infected-cell polypeptide 4) in the regulation of viral rna synthesis, but the mechanism whereby icp4 regulates transcription of viral genes is at present unknown. in this report we describe experiments with an in vitro transcription system and a purified preparation of icp4 (estimated 5% of total protein). using dna from ... | 1986 | 3012542 |
| evaluation of five cell types for the isolation of herpes simplex virus. | five cells were evaluated in a comparative analysis for sensitivity, specificity, and rapidity in detecting the presence of herpes simplex virus hsv-1 and hsv-2. included in this study were human embryonic kidney (hek), rabbit kidney (rk), mrc-5, mink lung (ml), and microtus agrestis (umma). a total of 274 specimens from genital, throat, skin, or other sources that were submitted for hsv isolation were used in the study. the sensitivity of the different cells was assessed by the total number of ... | 1986 | 3013496 |
| detection of hsv1 dna by in situ hybridisation in human brain after immunosuppression. | human brain cells were examined for the presence of herpes simplex virus type 1 (hsv1) dna sequences by in situ hybridisation. viral genome was detected in immunosuppressed patients with virological evidence of past hsv infection but not in immunosuppressed patients with no such evidence. in patients who had not been immunosuppressed, no hsv dna sequences were detectable. | 1986 | 3016195 |
| the properties and sequence of glycoprotein h of herpes simplex virus type 1. | the map position of the coding sequence of glycoprotein h of herpes simplex virus type 1 was determined by marker transfer studies in which dna fragments cloned from a virus resistant to neutralisation by an anti-gh monoclonal antibody were used to transfer antibody resistance to wild type virus dna following cotransfection. the gh coding sequence was mapped to the bglii "m" fragment of hsv-1 dna (map coordinates 0.27-0.312), confirming the map position previously determined by intertypic recomb ... | 1986 | 3016991 |
| glycoprotein c of herpes simplex virus 1 is an inhibitor of the complement cascade. | mammalian cells in culture express membrane receptors for c3b when infected with hsv-1. c3b binding is mediated by glycoprotein c (gc), a virus-specified membrane glycoprotein. in view of the inhibitory functions of other c3b-binding proteins, we studied the capacity of gc to modulate complement activation. glycoprotein c was purified from hsv-1-infected cells by immunoaffinity chromatography. glycoprotein c, but not a control viral glycoprotein, demonstrated dose-dependent acceleration of decay ... | 1986 | 3018078 |
| antiherpetic effects of a human alpha interferon analog, ifn-alpha con1, in hamsters. | the efficacy of a novel consensus form of human alpha interferon designated ifn-alpha con1 was evaluated against herpesvirus infections in vitro and in vivo. at comparable antiviral concentrations, natural lymphoblastoid ifn, ifn-alpha con1, the molecular subtype ifn-alpha, and the hybrid ifn-alpha ad(bgl) obtained by recombinant dna methods conferred similar protection against herpes simplex virus type 1 and type 2 (hsv-2) infections of human cells in vitro. whereas 7 x 10(5) u of ifn-alpha ad( ... | 1986 | 3019238 |
| identification of an epstein-barr virus-coded thymidine kinase. | we have demonstrated the presence of an epstein-barr virus (ebv)-coded thymidine kinase (tk) by producing biochemically transformed, tk-positive mammalian cell lines using either microinjection of whole ebv virions or calcium phosphate-mediated transfection of the sali-b restriction endonuclease fragment of ebv dna. analysis of these cell lines showed that: (i) ebv dna was present in the cell lines, (ii) sequences from the sali-b restriction endonuclease fragment of ebv were expressed, (iii) a t ... | 1986 | 3019675 |
| characterization and immunogenicity of hsv-1 antigens obtained following zwitterionic detergent treatment. | a preparation was obtained from herpesvirus hominis type 1 (hsv-1) infected cells using the zwitterionic detergent, empigen bb. the preparation was partially purified by ultracentrifugation over a cushion of 20% sucrose. serological characterization by elisa and immuno double diffusion, using both polyclonal and monoclonal antibodies shows this preparation to contain hsv glycoproteins, including gc, gd and ge. immunization of balb/c mice elicited serum antibody responses against both hsv-1 and h ... | 1986 | 3020821 |
| elisa for detection of igg and igm antibodies to hsv-1 and hsv-2 in human sera. | a rapid, enzyme-linked immunoassay (elisa) was applied to identify and measure specific igg and igm antibodies to herpes simplex viruses types 1 and 2 (hsv-1 and hsv-2). detergent solubilized infected cells and mock-infected cells were used as antigens in the assay. identification of type-specific antibodies was achieved by a competition assay in which clinical sera mixed with hsv-1 or hsv-2 antigens were assayed for reactivity to identical antigens coating wells of polystyrene microtiter plates ... | 1986 | 3021796 |
| selection and characterization of an interferon-responsive clonal cell line of hela cells. | hela cells generally do not respond well to interferon (ifn). we have used is-1, an ifn-sensitive mutant of mengovirus, to select a clone of ifn-responsive hela cells (f-h12). at moderate levels of human alpha/beta ifn, is-1 yields were fivefold lower in these cells than in similarly protected control cells. in contrast, wild-type mengovirus, vesicular stomatitis virus and a wild-type and thymidine kinase-negative strains of herpes simplex virus type 1 grew equally well in both cell lines. by a ... | 1986 | 3023528 |
| effects of mercury (ii) compounds on the activity of dutpases from various sources. | the deoxyuridine triphosphate nucleotidohydrolases (dutpases, ec 3.6.1.23) from escherichia coli k-12-,acholeplasma laidlawii b-pg9-, human kb cell-, and the herpes simplex virus (hsv) type 1- and 2-induced dutpases were purified and used to determine the effect of various mercury (ii) compounds on their activities. mercuric acetate, 5-mercuri-dutp (hgdutp), and 5-mercuri-dctp (hgdctp) acted as irreversible active site-directed inhibitors of the dutpases purified from eukaryotic organisms but no ... | 1986 | 3005836 |
| mode of action, toxicity, pharmacokinetics, and efficacy of some new antiherpesvirus guanosine analogs related to buciclovir. | 9-[4-hydroxy-3-(hydroxymethyl)butyl]guanine (3hm-hbg), (rs)-9-[4-hydroxy-2-(hydroxymethyl)butyl]guanine ([+/-]2hm-hbg), and cis-9-(4-hydroxy-2-butenyl)guanine (2en-hbg), new acyclic guanosine analogs structurally related to buciclovir (bcv [(r)-9-(3,4-dihydroxybutyl)guanine]), were evaluated in parallel with buciclovir as anti-herpes simplex virus (hsv) agents. in cell cultures, replication of different strains of hsv type 1 (hsv-1) and hsv-2 was inhibited at nontoxic drug concentrations. the co ... | 1986 | 3024562 |
| estimation of the b lymphocyte precursor frequencies to herpes simplex type 1 glycoproteins by a limiting dilution assay. | the precursor frequency of b lymphocytes from balb/c mice producing hsv-1 glycoprotein b (gb), glycoprotein c (gc), and glycoprotein d (gd) antibody was determined by limiting dilution analysis under conditions to detect antibody from the clonal progeny of a single b cell precursor. in spleens of naive mice the average gc frequency was 1/48,917 +/- 5,550, while gd was 1/73,330 +/- 15,898, and gb frequency was in excess of 1/100,000. immunization with live hsv-1 (kos) increased the b cell frequen ... | 1986 | 3025354 |
| minimal transcriptional enhancer of simian virus 40 is a 74-base-pair sequence that has interacting domains. | we have assayed the ability of segments of the simian virus 40 (sv40) 72-base-pair (bp) repeat enhancer region to activate gene expression under the control of the sv40 early promoter and to compete for trans-acting enhancer-binding factors of limited availability in vivo in monkey cv-1 or human hela cells. the bacterial chloramphenicol acetyltransferase and the herpes simplex virus type 1 thymidine kinase genes were used as reporters in these assays. a 94-bp sequence located between sv40 nucleo ... | 1986 | 3025607 |
| suppressive effect of monocytes in vitro in patients with carcinoma of the uterine cervix. | the adherent cell fraction (adc) of human peripheral blood mononuclear cells (pbm) contains two cell types of opposing function in vitro. dendritic cells (dc) act as antigen-presenting cells (apc) in vitro, while monocytes (mo) have a suppressive effect on antigen activation of t cells. in this report we show that patients with cervical carcinoma have a significantly increased number of suppressive mo compared with healthy controls. the t cell response to herpes simplex virus (hsv-1) and ppd was ... | 1986 | 3026137 |
| organization of cytoskeleton elements during herpes simplex virus type 1 infection of human fibroblasts: an immunofluorescence study. | cultured human fibroblasts showed a typical fibrillar organization of microtubules in immunofluorescence, including the vimentin type of intermediate filament as well as actin-containing microfilaments. during infection with herpes simplex virus type 1 (hsv-1), the vimentin organization was maintained whereas actin, myosin and tubulin showed a progressive association with the viral glycoproteins within juxtanuclear structures. these structures could also be revealed with fluorochrome-coupled whe ... | 1986 | 2868069 |
| induction of chromosomal aberrations in human cells by a temperature-sensitive mutant of herpes simplex virus type 2 and its revertants. | the induction of chromosomal aberrations by a temperature-sensitive (ts) mutant of herpes simplex virus type 2 (hsv-2) strain hg52 (ts 13), its revertants 4-8 and 5-8 and by etalon strains hsv-1 17 syn+ and hsv-2 hg52 was studied in human fibroblast and lymphocyte cultures. the effect on chromosomes of the revertants was tested at permissive (31 degrees c) and non-permissive (38 degrees c) temperatures. at 38 degrees c the revertants could not induce dnase activity. the present results contribut ... | 1986 | 2874732 |
| adenovirus replication as an in vitro probe for drug sensitivity in human tumors. | the feasibility of using adenovirus 5 as an in vitro probe for chemosensitivity in short-term cultures of human tumors was evaluated using human melanoma cell lines and primary cultures of melanoma biopsies. a convenient immunoperoxidase method was developed for quantitating viral replication 2 days after infection. two different approaches were explored: the host cell reactivation assay (hcr) using drug-treated virus; and the viral capacity assay using drug-treated cells. the hcr assay detected ... | 1986 | 3525182 |
| a novel selective broad-spectrum anti-dna virus agent. | a new compound has been found, (s)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine ((s)-hpmpa), that has potent and selective activity against a broad spectrum of dna viruses, including herpes simplex virus (types 1 and 2); varicella zoster virus; thymidine kinase-deficient (tk-) mutants of herpes simplex and varicella zoster virus; human cytomegalovirus; phocid, simian, suid, bovid and equid herpesviruses; african swine fever virus; vaccinia virus; and human adenoviruses. it is also active again ... | 1986 | 3762696 |
| improvement of the bioavailability of the anti-herpes virus agent bvdu by use of 5'-o-alkoxycarbonyl derivatives with increased metabolic stability. | (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) was found by hplc analysis to be rapidly metabolized in mice and in liver homogenates from mouse and man to the antivirally inactive (e)-5-(2-bromovinyl) uracil (bvu) but was comparatively stable in blood from both species. of a series of 5'-o-alkoxycarbonyl derivatives of bvdu, the 5'-o-tert.-butoxycarbonyl derivative (brl 37000) was the most stable in mouse and human blood and liver homogenates, neither its ester bond nor its n-glycosidic linkage bei ... | 1986 | 3793660 |
| herpes simplex virus, cytomegalovirus and epstein-barr virus antibody titres in sera from schizophrenic patients. | serum antibody titres to herpes-simplex (hsv-1, 2), cytomegalovirus (cmv), and epstein-barr virus capsid antigen (ebv-vca) were determined in 38 unrelated chronic schizophrenic patients, 11 nuclear families with at least 2 schizophrenic members, and 2 control groups. the distributions of antibody titres to herpes simplex and cytomegalovirus were similar among all groups. patients had higher anti-ebv-vca titres than non-hospitalized controls; however, hospital staff members in contact with the pa ... | 1986 | 3029788 |
| induction of neutralizing antibody against varicella-zoster virus (vzv) by vzv gp3 and cross-reactivity between vzv gp3 and herpes simplex viruses gb. | glycoprotein gp3 (64k) is one of the major proteins specified by varicella-zoster virus (vzv). this glycoprotein was purified on an immunoadsorbent consisting of monoclonal antibody (clone 8) against gp3 linked to protein a-sepharose. rabbits were then immunized with the purified antigen to obtain monospecific antisera against gp3. the monospecific antisera and monoclonal antibody immunoprecipitated polypeptides with the same molecular weights of approximately 64,000 (64k), 106k, and 116k from a ... | 1986 | 2418583 |
| human antibody response to herpes simplex virus-specific polypeptides after primary and recurrent infection. | human antibody responses to specific polypeptides of herpes simplex virus types 1 and 2 (hsv-1 and hsv-2, respectively) were assessed in serial serum specimens from 18 infected patients by immunoblot technology. nine patients had hsv-1 infections (six genital and three oral) and nine had hsv-2 genital infections. antibodies to homologous and heterologous hsv antigens were studied and correlated with total microneutralization and enzyme-linked immunosorbent assay antibodies as well as correlated ... | 1986 | 2422204 |
| 1h-nmr assignment and secondary structure of a herpes simplex virus glycoprotein d-1 antigenic domain. | the peptide alpha ahx-met-ala-asp-pro-asn-arg-phe-arg-gly-lys-asp-leu-pro-val-leu- asp-gln-leu-thr-asp-pro-pro-alpha ahx (epsilon ahx = 6-aminohexanoyl), the antigenic sequence 11-32 from herpes simplex virus glycoprotein d-1, has been synthesised. its 1h-nmr spectrum has been assigned by a combination of two-dimensional techniques in h2o and 2h2o. its secondary structure has been defined by nuclear overhauser effects and amide proton exchange rates, and also to some extent chemical shifts, coup ... | 1986 | 2426110 |
| trans-activation of the human immunodeficiency virus long terminal repeat sequence by dna viruses. | to investigate whether dna viruses can augment gene expression of the human immunodeficiency virus (hiv), cotransfection experiments were carried out in which a recombinant plasmid containing the hiv long terminal repeat (ltr) linked to the chloramphenicol acetyltransferase (cat) gene was transfected into cultured cells along with plasmids containing dna from various distinct classes of dna viruses. molecular clones containing jc virus, bk virus, lymphotropic papovavirus, bovine papilloma virus, ... | 1986 | 2432602 |
| herpes simplex virus-induced changes of the keratin type intermediate filament in rat epithelial cells. | herpes simplex virus type 1 (hsv-1) infection of human fibroblast cells grown in culture induces reorganization of the cytoskeleton fibrillar structures. normal transport and insertion of hsv glycoproteins into the plasma membrane of the cells depend on the integrity of the microtubules. the natural host cells for hsv are epithelial cells, and an epithelial cell line established from rat palate was used in the present study. the effect of virus on the structure of the intermediate filaments and ... | 1987 | 2434610 |
| nucleotide sequence of the most abundantly transcribed early gene of human cytomegalovirus strain ad169. | cytoplasmic poly(a+)rna was isolated from human embryo fibroblast cells during the early phase of an infection with human cytomegalovirus strain ad169. these preparations contained a single abundant transcript of 2.7 kb which was derived from each of the repeat sequences flanking the long unique region of the virus genome. the gene was unspliced and poly(a+)rna derived from it continued to accumulate in the cytoplasm of cells during the later stages of infection. this gene and the surrounding re ... | 1987 | 2436392 |
| hybridization between a repeated region of herpes simplex virus type 1 dna containing the sequence [ggc]n and heterodisperse cellular dna and rna. | a small dna fragment containing the simple sequence [ggc]10 from the long repeat of herpes simplex virus type 1 (hsv-1) dna hybridized to cellular dna and polyadenylated rna from different mammalian species. the number and intensity of blot hybridization signals were increased in human compared with rodent and simian nucleic acids. the hybridization was blocked specifically by human 28s ribosomal dna, which shares only the ggc repeats with the herpes simplex virus dna. these data indicate that g ... | 1987 | 2436393 |
| a cultured human oligodendroglioma cell line and herpes simplex virus-infected cells share antigenic determinants. | cell cultures derived from 60 different human brain tumors were screened for the presence of hsv infected cell antigens by indirect immunofluorescence using a polyclonal rabbit antiserum reacting with herpes simplex virus (hsv), 3 monoclonal antibodies recognising different hsv-specified proteins, and one monoclonal antibody t181 reacting with a dna binding protein present in hsv-infected cells. only one tumor (in/157), derived from an oligodendroglioma, stained with the polyclonal antiserum. t1 ... | 1987 | 2437255 |
| neutralizing monoclonal antibodies specific for herpes simplex virus glycoprotein d inhibit virus penetration. | nine monoclonal antibodies specific for glycoprotein d (gd) of herpes simplex virus type 1 were selected for their ability to neutralize virus in the presence of complement. four of these antibodies exhibited significant neutralization titers in the absence of complement, suggesting that their epitope specificities are localized to site(s) which contribute to the role of gd in virus infectivity. each of these antibodies was shown to effectively neutralize virus after virion adsorption to cell su ... | 1987 | 2444713 |
| dna sequences which regulate the expression of the pseudorabies virus major immediate early gene. | it has been shown previously that the transcription of herpes simplex virus (hsv) immediate early (ie) genes is transactivated by a component of the virus particle. the trans-inducing factor (tif) is known to be polypeptide vmw65. infection with pseudorabies virus (prv), a related herpesvirus, does not increase expression from hsv ie regulatory sequences (w. batterson and b. roizman, 1983, j. virol. 46, 371-377). to examine the control of the prv ie gene and possible sequence specificity of a ti ... | 1987 | 3029974 |
| hsv-1 thymidine kinase negative vaccine: pathogenicity, protection, and perils. | primary inoculation of mice and rabbits with an avirulent hsv-1 thymidine kinase negative (tk-) mutant reduced keratitis, mortality, and superinfection of the trigeminal ganglion (tg) as measured by cocultivation and iontophoresis-induced ocular shedding following ocular challenge with hsv-1 mckrae and w strains. however species differences were demonstrated; with complete protection in rabbits, and incomplete protection in mice. in mice, budr/autoradiography and restriction enzyme analysis iden ... | 1987 | 3030639 |
| the mechanisms of antiviral immunity induced by a vaccinia virus recombinant expressing herpes simplex virus type 1 glycoprotein d: clearance of local infection. | we have shown that immunization of mice with a vaccinia virus recombinant expressing glycoprotein d of herpes simplex virus (hsv)-1 will induce a variety of l3t4+ t cell responses. these included a hsv-specific delayed-type hypersensitivity response, t cell help for the induction of antiviral antibodies, and the ability to eliminate a challenge dose of hsv from the pinna. this protection against a subcutaneous virus challenge was not mediated by the delayed-type hypersensitivity response because ... | 1987 | 3033075 |
| anti-glycoprotein d antibodies that permit adsorption but block infection by herpes simplex virus 1 prevent virion-cell fusion at the cell surface. | certain monoclonal antibodies specific for glycoprotein d of herpes simplex virus have potent neutralizing activity but fail to block attachment of virus to cells. here we have investigated the fate of neutralized and infectious virus after attachment to primate cells. infectious virions fused with the cell surface such that naked nucleocapsids were detectable in the cytoplasm near or just under the plasma membrane. neutralized virions did not fuse with the cell. they remained attached to the ce ... | 1987 | 3037552 |
| the role of epithelial cell differentiation in the expression of herpes simplex virus type 1 in normal human oral mucosa in culture. | we have examined by immunofluorescent antibody staining technique the expression of herpes simplex virus type 1 (hsv-1) in organ cultures of the normal human oral mucosa. the expression of hsv-1 antigen was found selectively in the epithelial cell layers in relatively undifferentiated states such as basal layer and lower prickle cell layer in addition to the basement membrane. when the epithelial cells dissociated from the oral mucosa were infected with hsv-1 and association of the hsv-1 express ... | 1987 | 3026290 |
| restricted replication of herpes simplex virus type 1 in murine embryonal carcinoma cells. | herpes simplex virus type 1 (hsv-1) has a broad host range but the kos strain of hsv-1 did not replicate efficiently in murine embryonal carcinoma (ec) cells. the yield of infectious hsv-1 from ec cells was 100- to 1000-fold lower than that from fibroblast cell lines of mouse, monkey or human origin. the thymidine kinase (tk) gene of hsv-1 is expressed early during the infectious cycle. the levels of tk mrna and of tk activity in infected ec cells were only two- to threefold lower than levels fr ... | 1987 | 3029290 |
| herpes simplex virus type 1 latency in rabbit corneal cells in vitro: reactivation and recombination following intratypic superinfection of long term cultures. | herpes simplex virus type 1 (hsv-1) has been isolated from explanted human corneas after cultivation in vitro. to determine whether hsv-1 is persistent or latent in corneal cells, a system to study hsv-1 infection of rabbit corneal cells in vitro was developed. by elevation of the incubation temperature to 42 degrees c before and during hsv-1 infection it was shown that both keratocytes and epithelial cells support a nonproductive rather than a productive infection. on subsequent temperature red ... | 1987 | 3029308 |
| genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus dna polymerase gene. | the human cytomegalovirus (hcmv)-induced dna polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. to identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (hsv-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced dna polymerases to the hcmv dna polymerase. a cosmid and plasmid library of the entire hcmv genome was screened with the bamhi q fragment ... | 1987 | 3023689 |
| comparison of upstream sequence requirements for positive and negative regulation of a herpes simplex virus immediate-early gene by three virus-encoded trans-acting factors. | using a short-term cotransfection system with recombinant chloramphenicol acetyltransferase (cat) target genes and intact genes for regulatory proteins, we previously demonstrated that expression from the promoter-regulatory region of the gene for the immediate-early 175,000-molecular-weight (ie175k) protein of herpes simplex virus type 1 was subject to trans-acting effects by three different virus-encoded components. in the present work we have attempted to delineate the upstream cis-acting req ... | 1987 | 3023697 |
| effects of herpesvirus infections on the chemiluminescence induced by zymosan phagocytosis in mouse peritoneal macrophages. | the chemiluminescence (cl) induced by zymosan phagocytosis was tested in mouse peritoneal macrophages infected with three different types of herpes viruses: herpes simplex type-1 (hsv-1), human cytomegalovirus (hcmv) and murine cytomegalovirus (mcmv). the intensity of cl was tested in various intervals of virus infections. in the first eight hours zymosan induced chemiluminescence decreased in all the three systems. by the 24th hour, the macrophages infected with hcmv had almost completely recov ... | 1987 | 2830762 |
| reconstitution of cytotoxic t lymphocyte activity following allogeneic bone marrow transplantation in man. | longitudinal studies over an eight-month period have been performed to follow the t killer response restoration after allogeneic bone marrow transplantation (bmt). the capacity of the patient's peripheral blood mononuclear cells (pbm) to develop cytotoxic effector cells directed either against allogeneic cells or against epstein-barr virus (ebv) or herpes-simplex virus-1 (hsv-1)-infected syngeneic cells was tested monthly. the data suggest that in most cases the cytotoxic t lymphocyte (ctl) acti ... | 1987 | 2820090 |
| protection against herpes simplex virus infection in mice by recombinant murine interferon-beta in combination with antibody. | a recombinant murine interferon -beta (rmuifn-beta) was used to suppress the development of skin lesions and death of mice after challenge with herpes simplex virus (hsv) type 1 (hsv-1). depilated female balb/c mice were inoculated intradermally with hsv-1, hayashida strain, and were administered various concentrations of interferon (ifn) intraperitoneally 3 h later. the treatment with ifn was given once a day for 10 successive days. under the conditions in which almost all control mice died aft ... | 1987 | 2821897 |
| [(e)-5-(2-bromovinyl)-2'-desoxyuridine--a new nucleoside analog with selective inhibitory action against herpesviruses. studies in cell culture and animal experiments]. | (e)-5-(2-bromovinyl)-2'-deoxyuridine (1; brvudr) inhibits the replication of herpes simplex virus type 1 (hsv-1) and of varicella-zoster virus (vzv) in vitro at concentrations of 0.01 to 0.23 mumol/l, whereas herpes simplex virus type 2 (hsv-2) is influenced only at 5.5 to 27 mumol/l. in comparison to some classical and newly developed antiherpetics, i. e. 5-iodo-2'-desoxyuridine (2; idoxuridine, idu), 9-beta-d-arabinofuranosyladenine (4; vidarabine ara-a), 9-(2-hydroxyethoxymethyl) guanine (5; ... | 1987 | 2823299 |
| latent herpes simplex virus in human trigeminal ganglia. detection of an immediate early gene "anti-sense" transcript by in situ hybridization. | we used in situ hybridization to study the expression of herpes simplex virus type 1 genes during latent infections of human sensory ganglia. trigeminal ganglia were recovered at autopsy from 24 subjects with no evidence of an active herpetic infection. these ganglia were hybridized to 35s-labeled single-stranded rna probes spanning 72 percent of the herpes simplex genome. in the ganglia of 16 subjects, 0.2 to 4.3 percent of the neuronal cells contained abundant nuclear signals for viral rna. ga ... | 1987 | 2825014 |
| ribonucleotide reductase induced by varicella zoster virus. characterization, and potentiation of acyclovir by its inhibition. | an enzyme that catalyzes the conversion of cdp to 2'-dcdp in the presence of dithiothreitol (dtt) was detected in ammonium sulfate fractionated-extracts of varicella zoster virus (vzv)-infected cells. this ribonucleotide reductase was antigenically distinguishable from the isofunctional eucaryotic enzyme as well as the ribonucleotide reductases induced by herpes simplex virus types 1 and 2 (hsv-1 and hsv-2). the vzv-induced enzyme was purified to the extent that most of the contaminating enzymes ... | 1987 | 2825724 |
| severity of experimentally reactivated herpetic eye disease is related to the neurovirulence of the latent virus. | the authors examined the eye diseases produced during acute and experimentally reactivated infections of rabbits intranasally inoculated with high and low neurovirulent strains of herpes simplex virus, type-1 (hsv-1). experimental reactivation of latent trigeminal ganglionic infection was accomplished by an injection of cyclophosphamide followed by one injection of dexamethasone the next day. neither drug, when given as a single injection, reactivated latent hsv-1 infection. during acute and rea ... | 1987 | 8591901 |
| antibodies against synthetic peptides of herpes simplex virus type 1 glycoprotein d and their capability to neutralize viral infectivity in vitro. | peptides corresponding to residues 1-13, 9-21, 18-30, 82-93, 137-150, 181-197, 232-243, 235-243, 267-281, 271-281 and 302-315 of glycoprotein d of herpes simplex virus type 1 (hsv-1) were chemically synthesized. these peptides were coupled to carrier proteins, and the resulting conjugates were used to immunize rabbits. an enzyme-linked immunosorbent assay was used to determine antipeptide antibody titers in serum collected after immunization. all peptides appeared to be immunogenic in rabbits. w ... | 1988 | 2826811 |
| synthesis and biological activities of 4-o-(difluoromethyl)-5-substituted-uracil nucleoside analogues. | various 4-o-difluoromethyl analogues of 5-substituted uridine (urd), 2'-deoxyuridine (durd), and arabinofuranosyluracil (arau) nucleosides were prepared via a cf2-insertion reaction into 4-o-silylated nucleosides and evaluated for activity against herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) and cytotoxicity in human embryonic lung fibroblast (helf) cell cultures. the introduction of the 4-substituent led to a strong reduction of antiviral activity for durd but not for arau analogues. ... | 1988 | 2828623 |
| photodynamic therapy of viral contaminants with potential for blood banking applications. | a photodynamic method has been evaluated as a means of eradicating viral contaminants with the potential for rendering blood safe for transfusion. herpes simplex virus type 1 (hsv-1) was tested under flowing conditions in culture media or in blood supplemented with the virus. hematoporphyrin derivative was used as the sensitizer and was photoactivated with visible light at 630 nm and 5 j/cm2. hsv-1 in suspension both in culture medium as well as in blood was shown to be killed. the human immunod ... | 1988 | 2829396 |
| regulated expression of stably transfected herpes simplex virus thymidine kinase genes in continuous cell lines expressing a temperature-sensitive mutant form of the immediate-early protein icp4. | we stably transfected the herpes simplex virus type 1 thymidine kinase gene into a continuous cell line expressing a temperature-sensitive form of the viral immediate-early protein icp4. in these cells, expression of the thymidine kinase gene was regulated in a temperature-sensitive manner, partially reproducing the controls that operate during a viral infection. | 1988 | 2829431 |
| comparative study on o-linked oligosaccharides of glycoprotein d of herpes simplex virus types 1 and 2. | glycoproteins d1 (gd1) and d2 (gd2) of herpes simplex virus type 1 and type 2, respectively, were purified from infected hep-2 cells labelled with [3h]glucosamine for 14 h followed by a 3 h chase using hd1 monoclonal antibody linked to sepharose. o-linked oligosaccharides were found to be present in both glycoproteins. the identification of n-acetyl [3h]galactosaminitol as the major labelled component in the oligosaccharides generated by mild alkaline borohydride treatment demonstrated that thes ... | 1988 | 2833570 |
| the human mhc-restricted cellular response to herpes simplex virus type 1 is mediated by cd4+, cd8- t cells and is restricted to the dr region of the mhc complex. | the nature of the in vitro human cytotoxic t-cell responder population to hsv type 1 (hsv-1) was studied. in 5-day hsv-1-stimulated cultures that contained mhc-restricted activity, two phenotypically distinct populations of cells were present that were capable of lysing hsv-1-infected b cell lines in a 5-h 51cr-release assay. the first was cd4+, cd8-, cd16- cell typical of class ii-restricted t cells, whereas the other population bore a cd4-, cd8-, cd16+ nk-cell phenotype. elimination of the nk ... | 1988 | 2834445 |
| methyl gallate, methyl-3,4,5-trihydoxybenzoate, is a potent and highly specific inhibitor of herpes simplex virus in vitro. ii. antiviral activity of methyl gallate and its derivatives. | methyl gallate (mg), methyl-3,4,5-trihydroxybenzoate, was highly active against herpes viruses as determined by plaque reduction assay. herpes simplex virus type 2, ms strain, was sensitive to mg at a mean 50% inhibitory concentration (ic50) of 0.224 micrograms/ml in monkey kidney cells. mg was specific for herpes viruses with the relative sensitivity hsv-2 greater than hsv-1 greater than cmv. two rna viruses tested were significantly less sensitive to mg. the structural components of mg which m ... | 1988 | 2840133 |
| synthesis and antiviral activity of certain 4-substituted and 2,4-disubstituted 7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidines. | treatment of the sodium salt of 4-chloro-2-(methylthio)pyrrolo[2,3-d]pyrimidine (2) with (2-acetoxyethoxy)methyl bromide (3) has provided 4-chloro-2-(methylthio)-7[(2-acetoxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (4). ammonolysis of 4 at room temperature gave 4-chloro-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (5). however, ammonolysis of 5 at 130 degrees c furnished 4-amino-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]-pyrrolo[2,3- d]pyrimidine (6), which on desulfurizati ... | 1988 | 2840500 |
| antigenic analysis of a major neutralization site of herpes simplex virus glycoprotein d, using deletion mutants and monoclonal antibody-resistant mutants. | herpes simplex virus glycoprotein d is a component of the virion envelope and appears to be involved in attachment, penetration, and cell fusion. monoclonal antibodies against this protein can be arranged in groups on the basis of a number of biological and biochemical properties. group i antibodies are type common, have high complement-independent neutralization titers, and recognize discontinuous (conformational) epitopes; they are currently being used in several laboratories to study the func ... | 1988 | 2841479 |
| mutational dissection of the hsv-1 immediate-early protein vmw175 involved in transcriptional transactivation and repression. | vmw175 is one of five immediate-early (ie) proteins encoded by herpes simplex virus type-1 (hsv-1). it is required for the transcription of later classes of genes and for the accompanying repression of ie expression. vmw175 has been shown to be a transactivator of transcription and also to autoregulate its own synthesis. we have made a large number of small, in-frame, insertion and deletion mutants of a plasmid-borne copy of the gene encoding vmw175. study of the activity of the resultant mutant ... | 1988 | 2842944 |
| genomic location of bovid herpesvirus type 2 nucleotide sequences homologous to five herpes simplex virus type 1 genes. | the location of nucleotide sequences within the bovid herpesvirus 1 (bhv-2) genome homologous to herpes simplex virus 1 (hsv-1) dna were investigated. bhv-2 dna was digested with restriction endonucleases and blotted to nitrocellulose paper. the blots were then probed with plasmids containing hsv-1 genes for thymidine kinase (tk), the major dna binding protein (icp8), the major capsid protein (vp5) and genes for hsv-1 glycoproteins gb, gd, and gc. except for hsv-1 gc, each hsv-1 gene tested hybr ... | 1988 | 2842979 |
| absence of induction of enhanced reactivation of herpes simplex virus in cells from xeroderma pigmentosum patients without skin cancer. | the time course of appearance of enhanced reactivation (er) and enhanced mutagenesis (em) of herpes simplex virus type 1 were studied in uv-irradiated stationary cultures of xeroderma pigmentosum (xp) fibroblasts. in some of the xp cells em followed similar kinetics of appearance as er. maximal activities occurred when infection was delayed 1 or 2 days after cell treatment. however, in certain xp cells only induction of the em response was observed, whereas er was absent. interestingly, the latt ... | 1988 | 2844398 |
| detection of herpes simplex virus type 1 in herpetic ocular diseases by dna-dna hybridization using a biotinylated dna probe. | a diagnostic hybridization assay for detecting herpes simplex virus type 1 (hsv-1) in ocular specimens was developed using cloned viral dna as a probe. this hybridization assay is based on visualizing a biotinylated probe that is hybridized to the target dna by a streptavidin/alkaline phosphatase system. the time required for performing this assay system is only two days. this assay system could detect a probe which had been hybridized to as little as 1 pg of homologous dna and did not cross-rea ... | 1988 | 2844977 |
| activation of the human immunodeficiency virus long terminal repeat by herpes simplex virus type 1 is associated with induction of a nuclear factor that binds to the nf-kappa b/core enhancer sequence. | it has been previously shown that herpes simplex virus type 1 (hsv-1) infection of hela cells results in augmentation of gene expression directed by the human immunodeficiency virus (hiv) long terminal repeat (ltr). this effect is presumably mediated by protein interactions with the ltr. we have used two different assays of dna-protein interactions to study the hsv-induced activation of the hiv ltr. activation of the hiv ltr is associated with increased protein binding to ltr sequences in a regi ... | 1988 | 2845125 |
| enhanced thrombin generation and platelet binding on herpes simplex virus-infected endothelium. | atherosclerotic lesions have been reported to contain herpes simplex virus 1 (hsv-1) genomic material. this, and other previous evidence, suggests that latent viral infection may be an atherogenic trigger. moreover, active hsv-1 lesions manifest marked fibrin deposition in microvessels. in this report we show that very early infection of human endothelial cells with hsv-1 appears to alter surface conformation as detected by merocyanine 540 staining. concomitantly, the efficiency of prothrombinas ... | 1988 | 2847155 |
| antiviral activities of guanosine analogs in guinea pig embryonic fibroblasts. | previous research has shown that certain antiherpes substances which are activated by thymidine kinase are substantially more active in human fibroblasts than in green monkey kidney cells. the difference has been attributed to the presence of large amounts of intracellular thymidine in the latter cell type. antiviral guanosine analogs but not thymidine analogs show decreased antiviral activity when used in herpes simplex virus type 1-infected guinea pig fibroblasts. we report the intracellular p ... | 1988 | 2847633 |
| interferon inhibits herpes simplex virus-specific translation: a reinvestigation. | reports on the arrest of herpes simplex virus type 1 (hsv-1) replication by interferon (ifn) are inconsistent. by the use of immunofluorescence and immunoblot assays with monoclonal and polyclonal antibodies, effective arrest of viral translation by human ifn-alpha in human fibroblasts was detected for the hsv-1 strains kos and mcintyre. in hela cells which are less sensitive to ifn inhibition and in 444 cells, a hela-fibroblast hybrid cell line, the inhibition was less pronounced. these results ... | 1988 | 2848929 |
| interaction of herpes simplex virus type 2 with a rat glioma cell line. | the interaction between herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) and two neural cell lines, mouse neuroblastoma (n1e-115) and rat glioma (c6-bu-1), was investigated. n1e-115 cells were permissive to both types of hsv. in c6-bu-1 cells, on the other hand, all the hsv-1 strains tested so far showed persistent infection, and the infectious virus of hsv-2 strains disappeared spontaneously. the hsv-2-infected c6-bu-1 cells were positive for hsv-2-specific dna sequences, virus-specific r ... | 1988 | 2850449 |
| differences in the mechanism of induction of interferon-alpha by herpes simplex virus and herpes simplex virus-infected cells. | the cellular source of ifn alpha after induction with herpes simplex virus type-1 (hsv) and hsv-infected fibroblasts was investigated by using human peripheral blood mononuclear cell (pbmc) populations, purified according to conventional procedures, and which included t- and b-lymphocytes as well as monocytes. it appears that the cells responding to hsv virions are monocytes, whereas the pbmc population induced by hsv-infected cells is represented by b-lymphocytes. furthermore, by using monoclon ... | 1988 | 2850784 |
| antibody to cloned hsv glycoproteins b and d plus adult human leukocytes protect neonatal mice from lethal hsv infection. | antisera produced by hsv infection or following vaccination of guinea pigs with the cloned herpes simplex virus (hsv) glycoproteins gb and gd were compared for in vitro antibody-dependent cellular cytotoxicity (adcc) activity and for in vivo protection. antibody from guinea pigs was able to participate in adcc with human mononuclear cells in vitro, anti-gbgd serum being equivalent to hsv convalescent sera. in vivo, each of the guinea pig sera was able to protect neonatal mice from a fatal hsv-1 ... | 1988 | 2854958 |
| antiherpesvirus activity and mechanism of action of indolo-(2,3-b)quinoxaline and analogs. | the antiherpesvirus activity of 14 derivatives of indoloquinoxaline was tested. the most active was 2,3-dimethyl(dimethylaminoethyl)5h-indolo-(2,3-b)quinoxaline, also called b-220. the antiherpesvirus mechanism of b-220 was sought. the compound inhibited replication of herpes simplex virus type 1, cytomegalovirus, and varicella-zoster virus in tissue culture at concentrations of 1 to 5 microm, depending on the cell type used for assay and the amount of virus. cellular toxicity was seen at a conc ... | 1988 | 2855298 |
| molecular analysis of mutations induced in human cells by n-ethyl-n-nitrosourea. | mutational activation of cellular proto-oncogenes is an important event in the pathogenesis of chemically induced tumors. we have used the ori p-tk shuttle vector, phet, to analyze the types of dna sequence changes induced after treating mammalian cells with the carcinogen n-ethyl-n-nitrosourea (enu). this shuttle vector contains the putative replication origin of the epstein-barr virus (ebv) and is stably maintained as a plasmid in ebv-transformed human lymphoblastoid cells. populations of plas ... | 1988 | 2855602 |
| sequence analyses of herpesviral enzymes suggest an ancient origin for human sexual behavior. | comparison of the amino acid sequences of the deoxythymidine kinases of herpes simplex (hsv) and of marmoset herpes viruses (mhv) suggests a divergence time of 8 to 10 million years ago for hsv-1 and -2. like mhv, hsv-1 and -2 cause local infections in their natural hosts, and direct contact between two individuals during the brief period of infectivity is needed for transmission. because b virus, a nearer relative of hsv, depends on both oral and genital routes of transmission, we postulate tha ... | 1988 | 3128793 |
| expression of herpes simplex virus glycoprotein d on antigen presenting cells infected with vaccinia recombinants and protective immunity. | we studied the effect of the temporal regulation of herpes simplex virus (hsv) type 1 glycoprotein d (gd-1) expression in ia+ epidermal cells (ec) and macrophages on virus specific immunity and protection from hsv-2 challenge. gd-1 was expressed on the surface of cells infected with a vaccinia recombinant containing gd-1 under the control of an early vaccinia virus promoter (vp176). it was not expressed in cells infected with a recombinant (vp254) in which gd-1 is controlled by a late vaccinia v ... | 1988 | 3263886 |
| rna complementary to herpes simplex virus type 1 icp0 gene demonstrated in neurons of human trigeminal ganglia. | recent studies with mice have demonstrated abundant rna transcripts which are complementary (antisense) to the herpes alpha gene icp0 in latently infected ganglia. we investigated the situation in unselected human trigeminal ganglia. strand-specific 2.7-kilobase herpes simplex virus type 1 (hsv-1) icp0 rna probes were prepared, and their sense was determined in productively infected cells. although in situ hybridization demonstrated icp0 antisense rna transcripts in the nuclei of neurons in 46% ... | 1988 | 2451758 |
| helper activity in antigen-specific antibody production mediated by cd4+ human cytotoxic t cell clones directed against herpes simplex virus. | three hsv type 1 (hsv-1) and hsv type 2 (hsv-2) common ("hsv-type common") and three hsv-1 specific ctl clones, which were cd3+, cd4+, cd8-, 4b4+, and 2h4-, were established. these clones proliferated in response to stimulation with hsv in the presence of autologous apc. the hsv type specificity of the proliferative response was identical with that of the cytotoxic activity of the clones. the cytotoxic activity and the proliferative response were both inhibited by addition of anti-hla-dr mab to ... | 1988 | 2452188 |
| expression of herpes simplex virus type 1 glycoprotein d deletion mutants in mammalian cells. | glycoprotein d (gd) is a viron envelope component of herpes simplex virus types 1 and 2. we have previously defined seven monoclonal antibody (mab) groups which recognize distinct epitopes on the mature gd-1 protein of 369 amino acids. mab groups vii, ii, and v recognize continuous epitopes at residues 11-19, 272-279, and 340-356, respectively. mab groups i, iii, iv, and vi recognize discontinuous epitopes. recent studies have focused on epitopes i, iii, and vi. using truncated forms of gd gener ... | 1988 | 2452897 |
| inhibition of transcription of herpes simplex virus immediate early genes in interferon-treated human cells. | the effect of interferon (ifn) treatment on the early stages of herpes simplex virus type 1 (hsv-1) replication in three types of human cells was investigated. interferon pretreatment was shown to reduce the steady state levels of both total and polysomebound hsv-1 immediate early alpha mrnas. using the nuclear run-off transcription assay, we showed that ifn selectively inhibited transcription of the hsv-1 genes, with no effect on transcription of total cellular rna or that of the beta-tubulin r ... | 1988 | 2455018 |
| topological distribution of virus-specific and cross-reactive antigenic determinants on the gb glycoprotein of the herpes simplex viruses. | the antigenic properties and relations between the herpes simplex virus type 1 and 2 (hsv1, hsv2) gb glycoproteins were investigated. using several assay systems to analyze the virus-specific reactivity of polyclonal monospecific rabbit anti-gb sera, it was demonstrated that most of the antigenic determinants of the gb glycoproteins exposed at the surface of both virions and infected cells are virus-specific rather than cross-reactive. comparative examination of the reactivity of human immune se ... | 1989 | 2470853 |
| transcriptional activity of the herpes simplex virus genome during establishment, maintenance, and reactivation of in vitro virus latency. | we previously have described a model of in vitro herpes simplex virus (hsv) latency in which latent infection was (i) established with human leukocyte interferon (ifn-alpha) in combination with (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) or 9-[(2-hydroxyethoxy)methyl]guanine (acyclovir); (ii) maintained after termination of combined inhibitor treatment by incubation at 40.5 degrees, and (iii) reactivated by either reducing the incubation temperature to 37 degrees or by superinfecting at the elev ... | 1989 | 2473963 |
| simultaneous triple-immunogold staining of virus and host cell antigens with monoclonal antibodies of virus and host cell antigens in ultrathin cryosections. | the mechanism of intracellular maturation and sorting of herpes simplex virus type i glycoproteins is not known in details. to elucidate the intracellular sorting of viral glycoproteins and their possible interaction with the cytoskeleton, a method for simultaneous immunogold staining of three antigens in ultrathin cryosections is described. each antigen is stained by an indirect technique using mouse monoclonal igg as first layer, rabbit anti-mouse igg as second and gold-conjugated goat anti-ra ... | 1989 | 2475475 |
| relatedness of glycoproteins expressed on the surface of simian herpes-virus virions and infected cells to specific hsv glycoproteins. | the antigenic relatedness of the surface glycoprotein antigens of six herpesviruses indigenous to human and nonhuman primates was examined. binding of anti-viral sera to viral antigens expressed on the surface of infected cells demonstrated that the surface antigens of herpes simplex virus type 1 (hsv 1), hsv 2, simian agent 8 (sa8), and herpesvirus simiae (b virus) exhibit extensive cross-reactivity. surface antigens of two viruses isolated from south american primates, h. saimiri 1 (hvs 1) and ... | 1989 | 2482016 |
| herpes simplex virus type 1 icp27 deletion mutants exhibit altered patterns of transcription and are dna deficient. | infected cell polypeptide 27 (icp27, alpha 27, ie63) is the 63-kilodalton product of an immediate-early gene of herpes simplex virus. functional analysis of temperature-sensitive mutants in herpes simplex virus type 1 icp27 demonstrated that this protein plays an essential role in virus replication (w. r. sacks, c. c. greene, d. p. aschman, and p. a. schaffer, j. virol. 55:796-805, 1985). because the temperature-sensitive forms of icp27 induced by the mutants affected gene expression to differin ... | 1989 | 2535723 |
| establishment of latent ganglionic infection with herpes simplex virus via maxillary gingiva and viral re-activation in vivo after trauma. | herpes simplex virus can remain latent for months or years in sensory and automatic ganglia of animals and man, and can be re-activated in vivo by several procedures such as neurectomy, irritation of epithelial surfaces, and administration of immunosuppressive agents. the objective of this study was to determine whether dental stimuli can cause re-activation of the latent herpes simplex virus. homogenization and explanation of ganglia from mice showed that herpes simplex virus (type 1) traveled ... | 1989 | 2537858 |