Publications
Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
---|
[mutants of the plaque microbe defective in the dark repair system]. | the mutants of plague bacteria deficient in dark repair are described. they are sensitive to uv, mitomycin c, polymixin. mutants have lost the ability to host cell reactivation in phage t7. the data obtained have shown that the addition of caffeine to the plating medium used to assay post-irradiation viability of uv-sensitive mutants did not influence the survival. data are also given concerning virulence determinants, biochemical and other properties. the mutants formed p- colonies on hemine me ... | 1977 | 892436 |
[flea ceratophyllus fasciatus as the vector of the altai-mountain strain of plague microbe]. | the work was conducted with a typical strain of the plague agent, which is virulent to white mice and little virulent to guinea pigs (subcutaneous infection), and with c. fasciatus. the fleas of this species can be infected, form the block of proventriculus within 4 to 35 days, transmit the agent during bloodsucking to healthy animals and cause the death both white mice and guinea pigs. | 1977 | 896271 |
[sensitivity of repair-defective mutants of the plague microbe to the action of physical and chemical agents]. | by the character of the sensitivity of uv-irradiation, to n-methyl-n'-nitro-n-nitrosoguanidine, 5-bromuracil, mitomycin c, crystalviolet, and by the capacity to restore phage injuries the 1435-a and 1435-24 mutants were referred to the uvr-hcr-, 17 mutant--to the uvr-hcr+, and 35 mutant--to lon genotype. as a result of uv irradiation the experimental strains formed heteromorphic forms of bacteria, spindle-shaped, filamentous cells, were sensitive to the action of static electrical field of high ... | 1977 | 899436 |
evaluation of live attenuated plague vaccines in praomys (mastomys) natalensis. | a live attenuated yersinia pestis vaccine designated ev76-51f, which had previously been shown to be pathogenic in vervet monkeys but not in guinea pigs, was tested in the multimammate mouse praomys (mastomys) natalensis. doses of 10(6) viable organisms inoculated subcutaneously as either a lyophilized suspension or an agar-grown culture resulted in vaccination fatalities in praomys but not in white mice. hemagglutinating antibodies to the fraction 1 antigen were not stimulated by doses lower th ... | 1977 | 908624 |
epidemiologic and clinical features of an outbreak of bubonic plague in new mexico. | an outbreak of seven cases of bubonic plague in new mexico was investigated. clinical features were studied and correlated with field studies in an attmept to determine the source of infection in patients with indefinite histories of exposure. most patients presented with fever, malaise, and an acute painful lymphadenitis (bubo). one death occurred in a patient with bubonic-septicemic plague complicated by meningitis due to yersinia pestis. all patients lived in rural or semirural areas, and mos ... | 1977 | 908848 |
latex agglutination tests for measurement of antiplague antibodies. | a latex agglutination test was evaluated as a method for detection and titration of antiplague antibodies. slide and microtiter techniques using polystyrene latex particles coated with specific fraction-i-antigen of yersinia pestis were found to be comparable in specificity and sensitivity to serological tests commonly used in laboratory practice. the latex agglutination titers correlated well with those measured by the world health organization standard method of indirect hemagglutination, alth ... | 1977 | 914990 |
[survival of eb microbes in live plague vaccine and its immunogeneity in the process of prolonged storage]. | 1977 | 919933 | |
[lipopolysaccharides from a slightly virulent strain of yersinia pestis (author's transl)]. | 1977 | 923562 | |
[detection of the plague microbe in the body of fleas with the adi of a serological method]. | 1977 | 927363 | |
n-nitrosamines in the diet of experimental animals. | 1977 | 421197 | |
localized fibrous "mesothelioma" of pleura (submesothelial fibroma): a clinicopathologic study of 18 cases. | eighteen cases of solid fibrous tumors of the visceral pleura are studied. the series includes neoplasms of various sizes removed during the last 17 years at the mount sinai hospital. most tumors showed consistent gross and light microscopic features, such as encapsulation, preservation of pedicle, origin from visceral pleura, predominance of spindle cells with more or less hyalinized stroma, little or no pleomorphism or mitotic activity and no infiltration of the underlying lung. no sex predomi ... | 1977 | 421185 |
[dental intern; apprentice experience in ceyetano heredia general hospital]. | 1977 | 274769 | |
allergic reactions to benzalkonium chloride. | 1977 | 421467 | |
[improvement of health care by studies of guaranteed quality]. | 1977 | 2129730 | |
acid precipitation of clostridium botulinum type c and d toxins from whole culture by addition of ribonucleic acid as a precipitation aid. | the ratios of ribonucleic acid to protein contents of clostridium botulinum type c, d, and e cultures were lower than those of type a, b, and f cultures. addition of ribonucleic acid at 0.4 mg/ml to culture satisfactorily aided acid precipitation of type c and d toxins, but not that of type e toxin. | 1978 | 344224 |
eosinophil chemotactic factor (ecf). iii. generation in human peripheral leukocytes. | eosinophil chemotactic factor (ecf) can be released from human peripheral leukocytes by an ige-anti-ige reaction, by the calcium ionophore a 23187 and during phagocytosis. supernatants and sonicates of unstimulated cells contain little or no ecf. on stimulation, however, ecf activity increases in the cells and even more so in the supernatants. this holds for purified neutrophils (pmns) as well as for basophil-containing mononuclear cell preparations. these findings contrast with those in lung ho ... | 1978 | 344230 |
production and traffic of b lymphocytes in the extracortical central area of the guinea pig thymus. | lymphocytes in the stroma and lymphatics of the extra-cortical central area (ecca) of the guinea pig thymus have been studied with light microscopy, quantitative microscopy, colchicin-induced mitotic arrest, ea (igg) and ea (igm) c adherence, surface immunoglobulins (ig total, igm, igg), alkaline phosphatase activity and the effect of cyclophosphamide administration. the results suggest, that ap-positive, sig-positive eac-negative lymphocytes in the ecca proliferate and maturate into ap-negative ... | 1978 | 344232 |
[enzymatic inactivation of levomycetin and penicillin by cells of the plague and pseudotuberculosis microbes that contain r plasmid depending on cultivation conditions]. | the activity of enzymes, inactivating levomycetin and penicillin in the cells of plague and pseudotuberculosis microbes bearing extrachromosomal determinants resistant to a number of antibiotics was studied as dependent on some cultivation parameters: population age, aeration rate and temperature. it was shown that the highest capacity for levomycetin acetylation was characteristic of the cells in the late logarithmic and early stationary growth phages. accumulation of levomycetin o-acetothers i ... | 1978 | 350142 |
sequence analysis of operator constitutive mutants of the tryptophan operon of escherichia coli. | 1978 | 351194 | |
salmonellosis in red deer calves (cervus elaphus). | 1978 | 355957 | |
[allergic reactivity and the hypothalamus]. | 1978 | 355990 | |
cloning of chemically synthesized lactose operators. ii. ecori-linkered operators. | a 40 base, mainly duplex dna segment, with the following sequence paattccacatgtggaattgtgagcggataacaatttgtt (3') ggtgtacaccttaacactcgcctattgttaaacaccttaap (5') has been synthesized by combination of chemical and enzymatic methods. it consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the ecori restriction endonuclease. this segment has been ligated into the pmb9 plasmid and the resulting operator ... | 1978 | 357249 |
guinea pig homologues of tl and qa-2 antigens. | the h-2, thymus-leukemia (tl), and qa-2 antigens of mice are encoded by closely linked genes on murine chromosome 17, and have structural similiarity in that each antigen is borne on a approximately 44,000 dalton molecule associated with beta2 microglobulin (beta2mu). the extensive homology of major histocompatibility complex (mhc) products that exists for the mouse and guinea pig suggested that a similar homology might exist for products of genetic regions closely linked to the mhc. by taking a ... | 1978 | 357657 |
high-resolution 13c nuclear magnetic resonance studies of glucose metabolism in escherichia coli. | high-resolution 13c nuclear magnetic resonance spectra of suspensions of escherichia coli cells have been obtained at 90.5 mhz by using the fourier transform mode. anaerobic cells incubated with [i-13c]glucose show a time course of glycolysis in which the alpha and beta glucose anomers disappear at different rates, lactate, succinate, acetate, alanine, and valine accumulate as end products of glycolysis, and fructose bisphosphate appears as an intermediate. it is shown that fructose bisphosphate ... | 1978 | 358201 |
pesticin-dependent generation of somotically stable spheroplast-like structures. | homogenous pesticin, a bacteriocin produced by yersinia pestis, promoted rapid dose-dependent killing of escherichia coli phi but permitted residual generation of cell mass. both growing cells and those blocked in net synthesis of nucleic acids or protein were converted by pesticin to osmotically stable spheroplast-like forms. morphology and viability of cells starved for fermentable carbohydrate were not affected by pesticin. similar spheroplast-like structures were formed from sensitive cells ... | 1978 | 361722 |
[a new influenza subunit vaccine: hemagglutinating antibodies one year after vaccination (author's transl)]. | the antibody response to a new influenza subunit vaccine was compare d one year after vaccination with the responses induced by two other influenza vaccines. the subunit vaccine was given either in a high dose form containing 2100 iu, or in a low dose form containing 700 iu. as comparison a split vaccine was used containing 800 iu and ai(oh)3 as adjuvant and a whole virus vaccine containing 2100 iu. of the 399 vaccinated subjects which had taken part in this study 151 were available for hemagglu ... | 1978 | 365774 |
[e-antibodies in the sera of animals inoculated against plague and pseudotuberculosis]. | 1978 | 371269 | |
[phage typing of rough e. coli strains isolated from urine (author's transl)]. | a differentiation of e. coli rough strains is generally not well established in bacteriological urine diagnosis although these strains are relatively often isolated from urine samples of patients with urinary tract infections (see table 2). an exact characterization of rough strains seems to be necessary especially for the distinction between recurrent and reinfection during therapy and follow-up studies. the application of phage typing for characterization of e. coli rough strains isolated from ... | 1978 | 373321 |
pharmacological investigation on asclepin--a new cardenolide from asclepias curassavica. part ii. comparative studies on the inotropic and toxic effects of asclepin, g-strophantin, digoxin and digitoxin). | the cardiac effects of asclepin, a new glycoside from the plant asclepias curassavica, were studies in vitro (isolated atrium and heart of guineapig) and in vivo (anaesthetized cat) and were compared with g-strophanthin, digoxin, digitoxin, or digitoxigenin, resp. asclepin showed a marked positive inotropic effect as evidenced by the increase in the force of contraction, measured by (dp/dt)max and (formula: see text). it was found to be more active than the other glycosides. | 1978 | 380581 |
functional studies on crosslinked bovine cytochrome c oxidase. | 1978 | 202495 | |
how do axons control myelin formation? the model of 6-aminonicotinamide neuropathy. | injection of 6-aminonicotinamide into young rats produces a peculiar neuropathy characterized by selective swelling and disruption of the layer of schwann cell cytoplasm lining the inner surface of the myelin sheath. this layer increases greatly in volume, compressing the axon and distending the myelin sheath. morphometry of such swollen fibers discloses that the amount of myelin in the distended sheaths is considerably greater than would correspond to the size of the axons, even if axonal compr ... | 1978 | 204752 |
a mitochondrial lesion in experimental spinal cord trauma. | 1978 | 204754 | |
trypsin and bovine rotavirus replication. | 1978 | 205033 | |
influence of hyperglycemia on survival after hemorrhagic shock. | terms such as "insulin resistance" and "glucose intolerance" applied to shock-induced hyperglycemia suggest that this state may prejudice survival. however, our data indicate that posthemorrhage hyperglycemia improves short-term survival. rabbits, either fed until the experiment or fasted for 24 hours, were shocked by rapid removal of 25% of their blood volume (bv) measured by 131ihsa. during the next 60 minutes, blood pressure (bp) was recorded, and the following variables were measured every 1 ... | 1978 | 262089 |
effect of lisuride and lsd on monoamine synthesis after axotomy or reserpine treatment in rat brain. | 1978 | 305542 | |
the cloning of mouse globin and surrounding gene sequences in bacteriophage lambda. | 1978 | 277326 | |
basal and human chorionic gonadotropin-stimulated 17 alpha-hydroxyprogesterone and testosterone levels in klinefelter's syndrome. | in nine patients with klinefelter's syndrome, mean basal plasma levels of testosterone (302 +/- 145 ng/100 ml) and its major precursor, 17 alpha-hydroxyprogesterone (17-ohp; 86 +/- 46 ng/100 ml), were significantly lower (p less than 0.01 to less 0.05) than in eight eugonadal men (605 +/- 180 and 136 +/- 39 ng/100 ml, respectively). the ratio of 17-ohp to testosterone, however, was comparable in both groups (0.29 +/- 0.09 vs. 0.24 +/- 0.08; p less than 0.10). in the klinefelter patients, basal p ... | 1978 | 263344 |
studies of the human testis. xi. leydig cell clusters and levels of intratesticular testosterone and 20 alpha-dihydroprogesterone. | testosterone concentration in testes of 23 men, ages 51 to 90, was determined as 490 +/- 172 ng/g tissue (m +/- s.d.) and 20 alpha-dihydroprogesterone concentration as 10.0 +/- 2.3 ng/g tissue (m +/- s.d.) in 18 men of the same patient group. leydig cells were estimated by the number of leydig cell clusters per tubule. there was a high correlation (r = 0.88, p less than .001) of the leydig cell index with intratesticular testosterone. it is proposed that the leydig cell cluster index provides a ... | 1978 | 263345 |
development of a pulmonary technique to assess inhaled bronchoactive agents in the conscious rhesus monkey. | 1978 | 416200 | |
nature of collagens synthesized by monkey periodontal-ligament fibroblasts in vitro. | 1. first subcultures of fibroblast-like cells from adult monkey periodontal ligament were incubated in the presence of 14c-labelled amino acids and produced significant amounts of type-i and type-iii collagens. 2. the proportion of type-iii collagen produced was calculated on the basis of the recovery of procollagens from deae-cellulose chromatography to be approx. 20%, and at least 10% when analysed as collagens on cm-cellulose chromatography. 3. sodium dodecyl sulphate/polyacrylamide-gel elect ... | 1978 | 415740 |
bacteriophage specificity in the identification of yersinia pestis as compared with other enterobacteria. | bacteriophage typing of yersinia pestis and the specificity of the phage among enterobacteriaceae were investigated. the bacteriophage used for rapid identification of y. pestis reacted with representative strains of all recognized species of shigella as well as with salmonella cholerae-suis. reactive shigella serotypes were sh. dysenteriae 1 and 9, sh. flexneri 2a, sh. boydii 1 and 6, and sh. sonnei. patterns consisting of isolated plaques (two cases) or absence of plaques were observed when th ... | 1978 | 375327 |
the cerebellar arteries in the cat and areas supplied by them. | 1978 | 308899 | |
expression of human t lymphocyte antigens by killer cells. | k cells, the effectors of antibody-dependent cell-mediated cytotoxicity, were found to express human t but not b lymphocyte antigens detected by rabbit anti-htla and anti-hbla. pretreatment of effector cells with anti-htla+c inhibited adcc by specifically lysing k cells: no inhibition of adcc by anti-htla occurred when deltac was substituted for c. by contrast, pretreatment of effector cells with anti-hbla nonspecifically inhibited adcc, probably for forming antigen-antibody complexes with hbla+ ... | 1978 | 308964 |
biological assay of potential trichomonacides in vitro using a counter apparatus. | utilising the accuracy and speed of a coulter counter for cell counting and sizing, a new method of antimicrobial assay has been developed in which the potency of inhibitors is calculated on a mol/cell basis. a total of 72 potential trichomonacides were screened against trichomonas vaginalis and the ed50 value estimated for 27 of the most interesting and potent compounds. the ed50 value for metronidazole was a mean of 5.12 fmol/cell and only 6 compounds were more potent. after the nitroimidazole ... | 1978 | 314804 |
[epizootiological importance of frontopsylla hetera (siphonaptera) fleas in the gorno-altai natural plague focus]. | experiments conducted during all seasons have established that f. hetera, one of the mass species of fleas in mountain altai, can be infected both by the strain of selective virulence typical to this nidus and by the non-typical non-virulent mountain-altai strain of plague agent. the non-virulent strain does not form in fleas the block of proventriculus and within 1.5-2 months they become free from the microbe. at the infection with the typical strain of the altai subspecies rare transmissions o ... | 1978 | 622294 |
atypical plague bacilli isolated from rodents, fleas, and man. | 1978 | 637172 | |
[problem of preservation of the causative agent of plague in nature as a methodological task in epidemiology of anthropozoonoses]. | 1978 | 651804 | |
[increased invasiveness as one of the manifestations of phenotype variability of the plague microbe in fleas]. | experimental studies conducted on genetically connected virulent subcultures of y. pestis showed that the death of albino mice infected by flea bite occurred earlier than in the animals infected by a syringe subcutaneously. a high invasiveness of y. pestis subcultures isolated from fleas (in comparison with the initial strains and subcultures from the animals) persisted for 2--3 passages in their cultivation on artificial nutrient media. | 1978 | 665025 |
biological species in praomys (mastomys) natalensis (smith), a rodent carrier of lassa virus and bubonic plague in africa. | plague has been known from countries surrounding rhodesia from as early as 1935, but was first reported from rhodesia in 1974. part of our investigation of the complex ecosystem involving yersinia pestis is critical assessment of the evolutionary status of natural populations belonging to formal, taxonomic species of implicated rodents. we present data on chromosomal and hemoglobin variation in sympatric populations and laboratory produced hybrids that give unequivocal evidence for at least two ... | 1978 | 677375 |
mechanisms of long and short term immunity to plague. | long and short term immunity to plague was produced in normal mice by using, respectively, an antibiotic resistant yersinia pestis and yersinia pseudotuberculosis. both immunogens were used live. passive serum transfer experiments, together with assays for the bactericidal activity of macrophages and delayed hypersensitivity tests, showed that the short term immunity was of a humoral nature and the long term immunity was cell mediated. the plague virulence markers of the two immunogens were: y. ... | 1978 | 680791 |
serological surveillance of plague in endemic areas of south india. | 1978 | 700838 | |
[characteristics of the polysaccharide-containing somatic antigens isolated from the k-1 strain of the plague microbe and its antibiotic-resistant variants]. | immunochemical analysis of 2 polysaccharide-containing structures of the lypopolysaccharide of the plague causative agent (main somatic antigen and lipopolysaccharide) isolated from k-1 strain and a number of its antibiotic resistant mutants was carried out. it was shown that development of resistance to streptomycin alone or its combination with monomycin did not cause detectable changes in the monosaccharide composition and serological properties of the cultures tested. more significant change ... | 1978 | 708003 |
consequences of aspartase deficiency in yersinia pestis. | growing cells of yersinia pseudotuberculosis, but not those of closely related yersinia pestis, rapidly destroyed exogenous l-aspartic and l-glutamic acids, thus prompting a comparative study of dicarboxylic amino acid catabolism. rates of amino acid metabolism by resting cells of both species were determined at ph 5.5, 7.0, and 8.5. regardless of ph, y. pseudotuberculosis destroyed l-glutamic acid, l-glutamine, l-aspartic acid, and l-asparagine at rates greater than those observed for y. pestis ... | 1978 | 711677 |
[resistance to plague of mice experimentally infected with "yersinia enterocolitica" (author's transl)]. | 1978 | 718023 | |
[production of l forms of the plague microbe]. | experiments were conducted in vitro. the process of formation of unstable l-form cultures of pasteurella pestis under the effect of penicillin was studied. a comparatively high frequency of this phenomenon in various strains was demonstrated. a possible role of the l-transformation process in the persistence of the causative agent in the organism of wild animals in endemic foci of infection is put forward. | 1978 | 747008 |
kinetic studies on the reactions catalyzed by chorismate mutase-prephenate dehydrogenase from aerobacter aerogenes. | steady-state kinetic techniques have been used to investigate each of the reactions catalyzed by the bifunctional enzyme, chorismate mutase-prephenate dehydrogenase, from aerobacter aerogenes. the results of steady-state velocity studies in the absence of products, as well as product and dead-end inhibition studies, suggest that the prephenate dehydrogenase reaction conforms to a rapid equilibrium random mechanism which involes the formation of two dead-end complexes, viz, enzyme-nadh-prephenate ... | 1978 | 206281 |
kinetics of lipid--protein interactions: interaction of apolipoprotein a-i from human plasma high density lipoproteins with phosphatidylcholines. | 1978 | 207309 | |
differential effects of isolated lipoproteins from normal and hypercholesterolemic rhesus monkeys on cholesterol esterification and accumulation in arterial smooth muscle cells in culture. | whole serum obtained from hypercholesterolemic rhesus monkeys was found to stimulate cholesterol esterification and cholesteryl ester accumulation in rhesus monkey arterial smooth muscle cells in culture to a significantly greater extent than normocholesterolemic serum. this was true even when the cholesterol concentration of the culture medium was equalized. isolation and characterzation of the low density lipoproteins (ldl) from rhesus monkeys indicated that the ldl from hypercholesterolemic a ... | 1978 | 208631 |
estimating adrenal cortical function in dogs with acth. | the peripheral blood response to intramuscular injection of 10 units acth in dogs was investigated because no experimental evidence for the standardization of this procedure for clinical use was available. following the injection of acth in sodium chloride solution, neutrophilia, monocytosis, eosinopenia, and lymphopenia occurred. with the exception of eosinopenia, the greatest change in the concentration of each cell type in peripheral blood occurred between 2 and 4 hours post injection. the ma ... | 1978 | 208814 |
detection of coronavirus-like particles in a spontaneous case of feline infectious peritonitis. | 1978 | 209236 | |
[etiology of chronic recurring aphthous stomatitis]. | 46 patients with chronic recurrent aphthae of the oral mucosa were subjected to clinical, virological and serologic examinations to evidence the assumed virus aetiology of this clinical picture. a cytopathogenic organism (classified as herpes virus hominis) could be cultivated from the aphtha sample from only one patient. | 1978 | 209580 |
characterization of a calcium-activated cytidine triphosphate phosphohydrolase present in dorsal spinal nerve roots. | 1978 | 210260 | |
effect of irradiation on enzyme activities of cyclic amp system in the neuro- and adenohypophyses. | the enzyme activities of cyclic amp system in the neuro- and adenohypophyses were studied, immediately after an irradiation by a single whole body exposure of 1600 r, in an attempt to find whether this intervention causes the changes in the responsiveness of the cyclic amp regulatory system. in the irradiated rats the neurohypophyses revealed a reduced activity of adenylate cyclase, moderately increased activity of phosphodiesterase and slightly decreased activity of protein kinase, including th ... | 1978 | 210409 |
comparison of interferon action in interferon resistant and sensitive l1210 cells. | translation inhibition, leu-trna aminoacylation and double-stranded rna and atp dependent phosphorylation were examined in interferon-treated and control cell-free lysates of leukaemic mouse l 1210 r and l 1210 s cells. no differences were observed between the respective interferon-treated and control cell-free extracts, except for the presence of an enhanced 67k dalton phosphoprotein fraction in interferon-treated l 1210 s cell-free extracts. in non-responding cell-free lysates, the lack of sti ... | 1978 | 212514 |
fluorescent probe studies of normal, persistently infected, rous sarcoma virus-transformed, and trypsinized rat cells. | 1978 | 213301 | |
woodrige memorial lecture. the veterinary profession and an intensive poultry industry. | 1978 | 213871 | |
relative importance of high and low density lipoproteins in the regulation of cholesterol synthesis in the adrenal gland, ovary, and testis of the rat. | 1978 | 214438 | |
[rotavirus gastroenteritides in infants and toddlers]. | 1978 | 216499 | |
the role of testicular adenylate cyclase in the hypogonadism of renal insufficiency. | 1978 | 216992 | |
alterations in the expression of the cytomegalovirus-induced cytopathogenic effect in fibroblasts by aflatoxin b1. | aflatoxin b1 has been shown both to promote and to alter the expression of the cytopathogenic effect observed when human fibroblasts are challenged with human cytomegalovirus (cmv). although the cells become round, as is the characteristic effect of this virus on fibroblasts, multinucleate cells are seen to arise from cell fusion within 48 h after virus addition. | 1978 | 218602 |
[biodegradable implants in orthopedic surgery]. | 1978 | 154723 | |
[phosphofructokinase activity of the plague bacterium]. | synthesis of phosphofructokinase was decreased in pestilential microbe if cultivation temperature was increased from 28 degrees to 37 degrees. aeration of cultural fluid effected slightly on the enzyme production. glucose, added to cultural fluid, decreased synthesis of phosphofructokinase in virulent strain and increased it in avirulent one. phosphofructokinase activity from pestilential microbe was inhibited by atp, citrate, 3-phosphoglycerate, by ca2+ and mn2+. amp and lesser adp reduced the ... | 1978 | 149424 |
[exploration of natural foci of tularemia and plague in armenia using the serological examination of bird droppings and excrements of predatory mammals]. | forty strains of tularemia and 619 of plague microbes were isolated in 1974 in bacteriological examination of natural plague and tularemia foci from a great number of small mammals and their ectoparasites. at the same time in serological examination (in the antibody neutralization test) of bird pellets, 52 mummified cadavers, and 34 excretion samples of mammalian beasts of prey collected in armenia (its central and north-western part) in 1973 the antigen of tularemia microbe was revealed in 73, ... | 1978 | 149478 |
the multicomposite structure of tendon. | a revised morphological model for the crimp structure of tendon is presented. the 300-500 mu diameter tendons of the mature rat tail are comprised of from one to more than ten substructures, called fascicles, of 80-320 mu diameter. fascicles each possess a "crimp structure" demonstrable in the polarizing microscope and neighboring fascicles within a tendon usually exhibit crimp registry. the fascicle itself is shown to be a cylindrical array of planar-zig-zag crimped 500-5000 a diameter collagen ... | 1978 | 149646 |
the dicyclohexylcarbodiimide-binding protein of rat liver mitochondria as a product of the mitochondrial protein synthesis. | a product of mitochondrial protein synthesis in rat liver mitochondria, characterized by a low molecular weight (mr is less than 10000) and an unusually high hydrophobicity, has been identified as the dicyclohexylcarbodiimide-binding protein and as a peptide of the hydrophobic sector of the mitochondrial atpase complex. the purified protein still possesses the ability of bind dicyclohexylcarbodiimide. | 1978 | 149662 |
siroheme: methods of isolation and characterization. | 1978 | 149890 | |
effect of human immunoglobulin preparations on fc rosette formation between anti-d-coated erythrocytes and lymphocytes. | human immunoglobulin (ig) preparations were tested for their inhibitory effect on fc rosette formation between anti-d-coated human erythrocytes and lymphocytes, as compared to their complement activating capacity. both of the two biological activities ascribed to the sites in the fc portion of the igg molecules were found to be reduced in the pepsin-treated, as well as in the s-sulfonated ig preparations, as compared to the activities of the normal human ig preparation. in the plasmin-treated ig ... | 1978 | 150144 |
[raised prostaglandin e-2 level in focal inflammatory lesions of the human skin with particular reference to rosacea]. | 1978 | 151301 | |
electrocardiographic signs of chronic cor pulmonale in 40 376 patients with silicosis. | the records of all patients who were examined for silicosis at the fund of occupational diseases between 1972 and 1976 are reviewed. in 3627 cases the mechanographical record was incomplete leaving 40 376 patients in the study. electrocardiographic signs of chronic cor pulmonale (c.c.p.) were detected in 5.58 per cent. the severity of c.c.p. was evaluated and the prevalence of the different electrocardiographic signs was examined. the presence and severity of c.c.p. was compared to the radiologi ... | 1978 | 152045 |
[biochemistry of myocardium taken at autopsy. preliminary report]. | the findings after biochemical analysis of heart muscle taken at autopsy are given in this preliminary communication. human myosin is made up of two heavy sub-units and two light sub-units: it is similar to cardiac myosin found in other mammals, but is different in certain characteristics, particularly immunological ones. tropomyosin is made up of two different sub-units. the normal human heart contains 1 mg of collagen and 130 microgram of desoxyribonucleic acid (dna) per 100 mg of fresh tissue ... | 1978 | 152617 |
inhibition of four human serine proteases by substituted benzamidines. | a series of substituted benzamidines has been examined for their inhibitory activity against the human serine proteases--trypsin, thrombin, plasmin, and c1s, a subunit of the first component of complement. the inhibition constants obtained for each enzyme were correlated with physical-chemical properties of the substituent group using the quantitative structure-activity relationship approach. this analysis indicated that plasmin and c1s are very similar in their interactions with substituted ben ... | 1978 | 152812 |
effect of human serum thymic factor on immature t lymphocytes in acute leukemia and other hematologic malignancies. | in 37 patients with acute leukemia and in 13 patients with other hematologic malignancies, e-rosette formation of peripheral blood mononuclear cells, before and after incubation with human serum thymic factor, was studied. this assay showed that incubation with thymic factor caused a clear-cut increase of e-rosette-forming cells in 8 of the 37 acute leukemia patients. among the 13 patients with other hematologic malignancies, a similar effect was observed in two with pediatric hodgkin's disease ... | 1978 | 107146 |
dietary lactose and the aetiology of human small-intestinal hypolactasia. | 1978 | 103781 | |
on the interactions of yersinia strains and cell cultures. | comparative investigations were carried out on the dynamics of invasion of cell cultures by strains yersinia pestis ev and yersinia pseudotuberculosis treated vitally with petroleum ether. it was established that the invasiveness of the strains studied was related to the presence of chemical structures of the bacterial surface sensitive to the action of either and whose synthesis was temperature dependent. the penetration and initial stages of intracellular multiplication of the yersinia were ac ... | 1978 | 104477 |
[accelerated diagnostic cultivation of pathogenic environmental microbes. ii. accelerated diagnostic cultivation of the causative agents of anthropozoonotic plague, glamders, melioidosis, brucellosis and tularemia]. | 1978 | 106632 | |
[preparation of extracellular ribonuclease from bacillus subtilis]. | the paper describes a method for isolating alkaline ribonuclease from the culture liquid bacillus subtilis kp 349 which involved: submerged cultivation of the producer on complex and synthetic nutrient media with optimized rnase activity, acid treatment of the total culture liquid, and filtration through perlite. further treatment may include either spray drying of the culture liquid filtrate or its concentration in a vacuum evaporator, dialysis of the concentrate against distilled water, and d ... | 1978 | 107517 |
purification and some properties of ovine placental lactogen. | a method has been described for the purification of ovine placental lactogen (opl) involving the use of freshly obtained sheep foetal cotyledons. tissue was extracted with 0.1 m-ammonium bicarbonate and the supernatant fraction, adjusted to ph 7, was brought to 60% saturation with ammonium sulphate. the resulting precipitate was then subjected to a sequence of chromatographic steps using columns of sephadex g-100 and carboxymethylecellulose. during each stage of the purification, the lactogenic ... | 1978 | 98606 |
the effects of sodium nitroprusside and trimethaphan camsylate on cerebral blood flow in rhesus monkeys. | hemispheric cerebral blood flow was measured in the rhesus monkey before and after infusion of the hypotensive agents sodium nitroprusside and trimethaphan camsylate. the intracarotid injections of 133xe was utilized, and flow was calculated by the "flow initial" technique. cerebral blood flow did not change significantly with the administration of trimethaphan camsylate. however, with a small reduction in blood pressure (10.6%) during the administration of sodium nitroprusside, the cerebral blo ... | 1978 | 98729 |
location of the genes for human heavy chain immunoglobulin to chromosome 6. | immunoglobulin synthesis was examined in 31 man-mouse hybrid clones produced by fusing rag mouse cells with human lymphoid cells. cells were grown in serum-free medium containing [(14)c]leucine and a (14)c-labeled amino acid mixture. spent medium was dialyzed, concentrated, and subjected to radioimmunoelectrophoresis. eighteen clones were found to produce material that gave a radiolabeled precipitin line with anti-human igg (gamma-chain specific). production of material which was indistinguishab ... | 1978 | 98768 |
frequency and epidemiology of primary drug-resistance in tuberculosis in the federal republic of germany including berlin (west). partial result of a study of the w.a.t.l. | 1978 | 98839 | |
vascular dynamics of an experimental cerebral arteriovenous shunt in the primate. | an arteriovenous fistula which shunted arterial blood from the circle of willis to the internal jugular vein was created in ten monkeys. continued patency of the shunt was confirmed angiographically. cerebral blood flow measurements were then obtained with the shunt both open and occluded. flow was also determined in response to elevations of systemic arterial pressure and raised arterial carbon dioxide tensions (paco2), again with the shunt both patent and occluded. in addition, flow through th ... | 1978 | 98854 |
[some aspects relating to the aflatoxin generation during the self-heating of cereals]. | in a stored batch of grain which was already affected by mould-formation tests were carried out with the known aflatoxin producer aspergillus flavus. a significantly lower aflatoxin production ensued if the mould growth was not connected with self-heating of the stored product. however, in conformity with increasing mould formation the germinating power was adversely affected and the significant signs (fatty acid number, reductive and none-reductive sugars) were influenced in the grain, irreleve ... | 1978 | 98933 |
jaundice and breast-feeding among alaskan eskimo newborns. | the course, incidence, and severity of neonatal jaundice was studied in 95 alaskan eskimo infants. breast-fed infants had higher bilirubin concentrations than bottle-fed babies. both groups experienced high bilirubin levels, similar to those previously reported in navajo and oriental infants but greater than those observed in whites and blacks. a marked capacity to inhibit hepatic glucuronyl transferase was observed in breast-milk specimens but only partly accounted for the bilirubin differences ... | 1978 | 99026 |
pars plana vitrectomy as a primary treatment for acute bacterial endophthalmitis. | we successfully treated six patients with culture-proven acute bacterial endophthalmitis by a combination of emergency pars plana vitrectomy and the instillation of intravitreal antibiotics. all six patients regained satisfactory vision. | 1978 | 99040 |
interferon inducing activity of polyinosinic acid. | although poly(i) is generally considered to be inactive as an interferon inducer, we have found several authentic poly(i) preparations to be effective inducers. their interferon inducing ability varied considerably from one cell system to another. in human diploid fibroblasts, primed with interferon and superinduced by cycloheximide and actinomycin d, all active poly(i) samples proved nearly as effective in inducing interferon as poly(i).poly(c). in primary rabbit kidney cell cultures, the activ ... | 1978 | 99486 |
lumbar spondylectomy in the subhuman primate. | removal of the 2nd or 3rd lumbar vertebrae (or both) has been accomplished in the subhuman primate (macaca mulatta). variations between this animal and the dog in posture, vertebral column anatomy, and spinal cord blood supply made no apparent difference in the results when compared with those in previous experiments. all macaques were able to clinb and to use their hind legs in a normal manner within 3 days after surgical operation. once hair had regrown over the surgical incision, persons not ... | 1978 | 100028 |
rosette formation by human lymphoid cells with monkey red blood cells. | the present paper describes a study on rosette formation by human lymphoid cells with monkey erythrocytes (mrbc) obtained from two species: african green monkey (cercopithecus aethiops) and rhesus monkey (macaca mulata). all the lymphocyte preparations obtained from peripheral blood, tonsils, thymocytes, bone-marrow and spleen biopsies formed rosettes in variable proportions with erythrocytes obtained from these two monkey species tested. cells of established lymphoblastoid cell lines characteri ... | 1978 | 100044 |
[method of determining the antimicrobial activity of alcohol extracts of propolis]. | it is proposed to determine the antimicrobial activity of propolys alcohol extracts by the method of subsequent dilutions in solid nutrient media. dilution of the extracts immediately in hot agar eliminated the inhibiting effect of the extragent on the microbial growth. opalesence appearing in the agar did not prevent estimation of the results in contrast to the method of subsequent dilutions in liquid nutrient media. | 1978 | 100047 |
the distribution of hydrolytic enzyme activities in human fibroblast cultures and their intercellular transfer. | 1978 | 100108 | |
[origin of a mitogrenic factor for cultivated macrophages (imf: inflammatory mitogenic factor) found in exudates of non-specific acute inflammation]. | the mitogenic activity of inflammatory exudate obtained from irradiated rats is reduced. after transfer of bone marrow syngeneic cells into irradiated rats this mitogenic activity is further decreased, while after transfer of thymic cells it is increased. it is postulated that the mitogenic activity of inflammatory exudate could be related to thymic cells and that t lymphocytes may be involved in non specific-inflammatory reactions. | 1978 | 100246 |