Publications
Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
---|
the pseudouridine contents of the ribosomal ribonucleic acids of three vertebrate species. numerical correspondence between pseudouridine residues and 2'-o-methyl groups is not always conserved. | the pseudouridine contents of the rrna species of hela cells, mouse l-cells and xenopus laevis cultured kidney cells were examined. pseudouridine, like 2'-o-methylation, was found to occur relatively frequently in each of the high-molecular-weight rrna species. however, the numerical data do not support the idea that there is a general one-to-one relationship between pseudoridine residues and 2'-o-methyl groups in vertebrate rrna. | 1978 | 666737 |
the transcription map of mouse mitochondrial dna. | nine transcripts complementary to mouse l cell mitochondrial dna have been detected, sized and mapped to restriction fragments using the method of berk and sharp (1977). rna isolated from l cell mitochondria was hybridized to 32p-labeled, cloned l cell mitochondrial dna restriction fragments in 70% formamide under conditions 5 degrees c above the melting temperature of the dna-dna duplex, but approximately 15 degrees c below the melting temperature of the rna-dna duplex. the heteroduplexed mater ... | 1978 | 667930 |
characterization of globin mrna from xenopus laevis. | a 9s polyadenylated mrna was isolated from 'xenopus laevis reticulocytes and purified by sedimentation and oligo-dt-cellulose chromatography. the size of this rna estimated in denaturing agarose gels was 2.2 x 10(5) daltons. 9s polyadenylated mrna hydridized to total dna with a cot1/2 of 3.8 x 10(3). | 1978 | 667964 |
lack of effect of blood-volume expansion on short-circuit current across an isolated toad skin incorporated in the circulation of a rat. | 1. evidence for the existence of 'natriuretic hormone' resides, in part, in the demonstration that blood volume expansion in the dog is followed by a transient fall in short-circuit current (scc) across a frog skin incorporated within its circulation. 2. we have attempted to confirm this effect in the rat, with a toad skin (xenopus laevis) incorporated within the circulation. the skins, bathed in whole rat blood, displayed low scc; skins bathed in 'mammalian' ringer solution displayed equally lo ... | 1978 | 668266 |
the nucleotide sequences of 5.8-s ribosomal rna from xenopus laevis and xenopus borealis. | 1. the nucleotide sequence of 5.8-s rrna from xenopus laevis is given; it differs by a c in equilibrium u transition at position 140 from the 5.8-s rrna of xenopus borealis. 2. the sequence contains two completely modified and two partially modified residues. 3. three different 5' nucleotides are found: pu-c-g (0.4) pc-g (0.2) and pg (0.4). 4. the 3' terminus is c not u as in all other 5.8-s sequences so far determined. 5. the x. laevis sequence differs from the mammalian and turtle sequences by ... | 1978 | 668689 |
anatomical mapping of retino-tectal connections in developing and metamorphosed xenopus: evidence for changing connections. | neural connections between the eye and optic tectum in xenopus laevis were anatomically traced by observing the tectal location of wallerian degeneration after discrete retinal lesion. these retinotectal connections were mapped in postmetamorphic frogs and tadpoles at stage 51, the stage at which retinal axons have grown into about the rostral one-half of the tectum. the course of the experimental degeneration was the same in frogs and tadpoles, but degeneration proceeded faster in the younger a ... | 1978 | 670862 |
somite abnormalities caused by short heat shocks to pre-neurula stages of xenopus laevis. | this paper describes the small disturbances, in the regular pattern of the somites and the fissures between them, that are seen following short (around 300 s) heat shocks at 37.5 degrees c delivered to pre-neurula stages of xenopus laevis. affected groups of cells still finally differentiate as somite muscle, but the normally precise spatio-temporal sequence in which they move beforehand to give rise to the actual pattern of somite blocks, is disrupted. examination of the position and sizes of p ... | 1978 | 670864 |
mapping of mitochondrial 4 s rna genes in xenopus laevis by electron microscopy. | 1978 | 671539 | |
freeze-fracture of xenopus laevis kidney: rod-shaped particles in the canalicular membrane of the collecting tubule flask cell. | 1978 | 671575 | |
preparation and isolation of covalently closed circular rdna molecules from dna of xenopus laevis. | we describe a method leading to the formation of closed circles of rdna starting from total dna of xenopus laevis. linear dna molecules were digested with exonuclease 3 and self-annealed. open circles were enriched and covalently closed by the simultaneous use of polynucleotide kinase, dna polymerase and polynucleotide ligase. closed circles of rdna1 were shown to be alkali-resistant, to have higher density than linear molecules in cesium chloride density gradients containing ethydium bromide, a ... | 1978 | 673851 |
the induction of triploidy by pressure in xenopus laevis. | 1978 | 675141 | |
stimulated dna synthesis in frog nuclei by cytoplasmic extracts of temperature-sensitive mammalian cells. | cytoplasmic extracts of proliferating cells stimulate dna synthesis in isolated nuclei of xenopus laevis liver. when tested by the same assay, cytoplasmic extracts of resting cells are completely inactive. when cytoplasmic extracts are prepared from cell cycle-specific temperature-sensitive mutants arrestd in the g1 phase of the cell cycle by the nonpermissive temperature, they also fail to stimulate dna synthesis in frog nuclei. the results indicate that, to stimulate dna synthesis in isolated ... | 1978 | 675253 |
studies on the liver of xenopus laevis. iii. the ultrastructure and the glycogen content of the developing liver. | 1978 | 677479 | |
effects of 5-bromodeoxyuridine on development of mauthner's neuron and neural retina of xenopus laevis embryos. | bromodeoxyuridine (brudr) injected into xenopus embryos at stages before, during or after the last period of dna synthesis in mauthner's neurons had no serious effect on differentiation of mauthner's neurons. however, the brudr caused widespread cell degeneration in the central nervous system. the action of brudr on retinal neuronal differentiation depended on dose and stage of infection. at all doses (0.005-0.9 microgram per injection), and all stages (22-29), the main effect was retinal cell d ... | 1978 | 678990 |
rna metabolism in primary cultures of xenopus laevis kidney cells. iii. processing of rrna precursor in growing and resting cells. | 1978 | 679983 | |
scanning electron microscopy of aggregates of cells from normal embryos and lithium-induced exogastrulae of xenopus laevis. | 1978 | 685629 | |
"delayed metamorphosis" (dm), a recessive subvital mutation affecting development and metamorphosis of xenopus laevis tadpoles. | 1978 | 685631 | |
sequence organization of a cloned tdna met fragment from xenopus laevis. | 3.18 kb fragments of x. laevis dna coding for trna 1 met have been inserted into a lambda vector via hind iii termini and cloned in e. coli. the organization of one cloned fragment has been analyzed by restriction endonuclease digestion and rna-dna hybridization. from the distribution of sites for three enzymes, this fragment appears to be typical of the majority of x. laevis tandem tdna 1 met repeat units. evidence is presented to suggest that it contains two genes coding for trna 1 met and at ... | 1978 | 688390 |
nucleosomes are assembled by an acidic protein which binds histones and transfers them to dna. | the nucleosome subunits of chromatin are assembled from histones and dna by an acidic protein which binds histones. the nucleosome assembly protein has been identified and purified from eggs of xenopus laevis. | 1978 | 692721 |
effects of estradiol on early messenger rna in male xenopus laevis liver. | cytoplasmic rna isolated from male xenopus liver between 1 and 6 h of hormone treatment was separated into distinct classes by sepharose 4b chromatography. assay of the mrna activity of these rna species in the wheat germ cell-free system demonstrated 2 populations of mrna activity (peak 2 and peak 3). the activity of 1 population of mrna (peak 2) was inducible by estradiol while the other (peak 3) remained unaltered for at least 6 h. mrnas obtained by sepharose 4b chromatography were also trans ... | 1978 | 699054 |
electron microscopic studies on the structure of motile primordial germ cells of xenopus laevis in vitro. | primordial germ cells (pgcs) of xenopus laevis have been isolated from early embryos and kept alive in vitro, in order to study the structural basis of their motility, using the transmission and scanning electron microscope. the culture conditions used mimicked as closely as possible the in vivo environment of migrating pgcs, in that isolated pgcs were seeded onto monolayers of amphibian mesentery cells. in these conditions we have demonstrated that: (a) no significant differences were found bet ... | 1978 | 702027 |
biochemical changes in developmentally retarded xenopus laevis larvae. i. the lens crystallin transition. | premetamorphic tadpoles of xenopus laevis reared in water containing 0.01% propylthiouracil are developmentally retarded and metamorphosis is prevented. when uncrowded, they continue to grow to a giant size. moderate crowding leads to a slower rate of growth. thus morphologically premetamorphic tadpoles were produced with lens diameters appropriate to either normal premetamorphic, climactic or post-metamorphic animals. the lens crystallins of such tadpoles have been separated by immunoelectropho ... | 1978 | 702033 |
oestrogen-induced cholesterol and fatty acid biosynthesis in xenopus laevis liver during vitellogenic response. | 1. oestradiol-17beta induces livers of xenopus laevis (south african clawed toad) to synthesize and secrete into the serum large quantities of the egg-yolk-protein precursor, vitellogenin. the peak of this response occurs 9-16 days after hormone treatment [dolphin, ansari, lazier, munday & akhtar (1971) biochem. j.124, 751-758]. it is now shown that 6 days after hormone treatment a 120-160-fold stimulation of the synthesis of cholesterol and fatty acid compared with control values occurred. 2. a ... | 1978 | 708388 |
thymocyte stem cell inflow in xenopus laevis, after grafting diploid thymic rudiments into triploid tadpoles. | 1978 | 710665 | |
rod-shaped particles in the plasma membrane of the mitochondria-rich cell of amphibian epidermis. | a freeze-fracture study has revealed rod-shaped intramembranous particles on the plasma membrane p-face (cytoplasmic leaflet) of the mitochondria-rich cell (or flask cell) of xenopus laevis and rana ridibunda epidermis. such particles have previously been found in all other mitochondria rich cells examined by this technique, namely, the mr-cell of toad bladder epithelium, the dark cell of rat kidney collecting tubule, and the flask cell of xenopus kidney collecting tubule. these particles are as ... | 1978 | 717800 |
poly(adenosine diphosphate ribose) synthesis by isolated nuclei of xenopus laevis embryos: in vitro elongation of in vivo synthesized chains. | 1978 | 718695 | |
nucleosome structure of xenopus oocyte amplified ribosomal genes. | the chromatin subunit or nucleosome structure of the amplified, extrachromosomal, ribosomal genes of oocytes of the amphibian xenopus laevis has been investigated during stages of growth when these genes are markedly changing their rates of transcriptional activity. nucleic acid hybridization studies involving micrococcal nuclease derived monomer nucleosome dna fragments and purified ribosomal rnas indicate that the apparent degree of accessibility of the ribosomal genes to short-term nuclease h ... | 1978 | 718864 |
an estrogen receptor from xenopus laevis liver possibly connected with vitellogenin synthesis. | this paper describes an estrogen receptor which is found in both the nucleus and cytoplasm of liver cells from male xenopus laevis, and which seems to be involved in the induction of vitellogenin synthesis. it has a high affinity for estradiol (kd = 0.5 x 10(-9) m), and the affinities of various steroids for the receptor correlate well with their ability to induce vitellogenin synthesis. it sediments at 3.5s at 0 degrees c in 0.5 m kci. the rate of sedimentation is unaffected by incubation at 20 ... | 1978 | 719747 |
amino acid and thyroid hormone transport systems in xenopus laevis. | 1978 | 720757 | |
latency-relaxation in single muscle fibres. | 1. latency relaxation and twitch tension were recorded simultaneously in single isolated muscle fibres of xenopus laevis. 2. during low frequency (0.6 or 1 pulse/sec) repetitive stimulation, three successive phases of twitch tension were observed: negative staricase (a slight drop in tension), positive staircase (about 15% increase in tension) and fatigue. at the same time the amplitude of latency relaxation decreased monotonically, and near the peak of positive staircase, the amplitude decrease ... | 1978 | 722520 |
the force-velocity relation of isolated twitch and slow muscle fibres of xenopus laevis. | 1. a study has been made of the relation between force and speed of shortening, or lengthening, in isolated twitch and slow muscle fibres, dissected from the iliofibularis muscle of xenopus laevis. both after-loaded and quick-release contractions were studied. twitch fibres were stimulated electrically to give tetanic contractions (5-20 degrees c); slow fibres were activated by a rapid change to solutions with high k concentration (30-75 mm; experiments at 21-24 degrees c).2. the velocity of slo ... | 1978 | 722588 |
action potentials of embryonic dorsal root ganglion neurones in xenopus tadpoles. | 1. several classes of action potentials can be distinguished in dorsal root ganglion cells, studied by intracellular recording techniques in xenopus laevis tadpoles 4.5--51 days old. the ionic basis of the action potential was investigated by changing the ionic environment of the cells and applying various blocking agents. 2. the ca2+-dependent action potential is a plateau of relatively long duration (mean 8.7 msec). it is unaffected by removal of na+ but blocked by mm quantities of co2+. it is ... | 1978 | 722591 |
isolation of discrete repetitive sequence classes from xenopus dna by high temperature reassociation. | sequences that did or did not reassociate at 75 dagrees c (stable and unstable, respectively) were isolated from total repetitive xenopus laevis dna. sequence complexities or frequencies were determined by self (minicot) or dna excess (slave minicot) reassociations at 60 degrees c. stable sequences were five times shorter and four times more frequent than unstable sequences. reassociations at 75 degrees c or at 50 degrees c were used to establish apparent sequence frequencies at these criteria. ... | 1978 | 724515 |
induction of vitellogenin synthesis in xenopus laevis tadpoles. | oestradiol induces vitellogenin synthesis in vitro in liver taken from xenopus laevis tadpoles that are in late metamorphosis. inducibility first appears at the end of prometamorphosis, and the response to oestradiol increases during the completion of metamorphosis. oestradiol continuously present during development does not influence the stage at which tadpole liver becomes inducible. it seems that the acquisition of inducibility is part of the normal development of the liver, and independent o ... | 1978 | 729959 |
[sem analysis of mass isolated germinal vesicles of xenopus laevis oocytes]. | 1978 | 734349 | |
patterns of synthesis and accumulation of heterogeneous rna in lampbrush stage oocytes of xenopus laevis (daudin). | 1978 | 738528 | |
the chemical receptive mechanism in the lateral-line organ. | stimulating effects of various mono- and divalent cations on the lateral-line organ were theoretically analysed by use of the site binding chemical adsorption model with the principle of "hard and soft acids and bases." a linear relation between the softness parameter and the logarithmic value of the intrinsic association constant was obtained for the cations of na, k, tl, ag, ca, mg, and cd. the order of effectiveness of these cations agreed with that of the intrinsic association constant. usin ... | 1978 | 739683 |
three different molecular weight forms of the vitellogenin peptide from xenopus laevis. | 1978 | 743270 | |
a novel recombinant of phage lambda and a conserved 3000-base-pair fragment of xenopus laevis ribosomal deoxyribonucleic acid produced by restriction with endonucleases hind iii/bami [proceedings]. | 1978 | 744396 | |
[the influence of the eye on the regeneration of the lens in xenopus laevis larvae]. | 1978 | 747082 | |
the effect of exposure to black background and to alpha-msh on black-white background preference in the amphibian xenopus laevis (daudin). | 1978 | 750347 | |
an investigation of de novo protein synthesis in the south african clawed frog, xenopus laevis. | 1978 | 751832 | |
extensive homologies between the methylated nucleotide sequences in several vertebrate ribosomal ribonucleic acids. | the methylated nucleotide sequences in the rrna molecules of the following vertebrate cultured cells were compared: human (hela); hamster (bhk/c13); mouse (l); chick-embryo fibroblast; xenopus laevis kidney. in each species the combined 18s, 28s and 5.8s molecules possess approx. 110-115 methyl groups, and the methylated oligonucleotides released after complete digestion of the rrna by t1 ribonuclease encompass several hundred nucleotides. "fingerprints" of the three mammalian methyl-labelled 18 ... | 1978 | 417718 |
[immunohistochemical localization by electron microscopy of gnrh in the median eminence of xenopus laevis daud]. | using antibodies against mammalian lhrh with the unlabeled antibody enzyme method immunoreactive nerve fibres were localized in the median eminence of xenopus laevis at the electron microscopic level. these fibres contain irregularly shaped neurosecretory granules with an average diameter of 890 a. | 1978 | 418908 |
dna synthesis in a multi-enzyme system from xenopus laevis eggs. | cytoplasm from unfertilized eggs of the frog xenopus laevis was separated by deae-cellulose column chromatography into nine fractions. supercoiled pxir 11 dna molecules (pxir 11 is a col el-based recombinant plasmid containing part of the xenopus laevis 18s and 28s ribosomal genes and transcribed spacer region) were incubated with each fraction singly and in various combinations. after incubation for 4 hr at 26 degrees c, the pxir 11 dna was reisolated and examined by electron microscopy. using ... | 1978 | 564241 |
three-dimensional structure of the lipovitellin-phosvitin complex from amphibian oocytes. | microcrystals of the lipoprotein-phosphoprotein complex which are found in the oocytes of xenopus laevis were examined using electron microscopy. analysis of fourier transforms of the images of the (010) and (001) projections showed the space group to be p2(1)22(1). ten projections were combined to produce a map of the complex having about 20 a resolution. the lipoprotein complex consists of two subunits related by a local twofold symmetry axis. the density was averaged around the local symmetry ... | 1978 | 564460 |
analysis of xenopus laevis ovary and somatic cell polyadenylated rna by molecular hybridization. | 1978 | 564793 | |
studies on the conformation of the 3' terminus of 18-s rrna. | we have studied the conformation of the 3' end of 18-s rna from human, hamster and xenopus laevis cells. the 3'-terminal oligonucleotide in a t1 ribonuclease digest of 18-s rna from hela cells was identified, using a standard fingerprinting method. the sequence (g)-a-u-c-a-u-u-a, established by eladari and galibert for hela 18-s rrna, was confirmed. an identical 3' terminus is present in hamster fibroblasts and xenopus laevis cells. the ease of identification of this oligonucleotide has enabled ... | 1978 | 565287 |
actin in xenopus oocytes. ii. intracellular distribution and polymerizability. | the largest oocytes of xenopus laevis were broken open in the absence of shearing forces which might transfer actin from particulate to supernatant fractions. particulate and postmitochondrial supernatant fractions were prepared by centrifugation. sds-electrophoretic fractionation on polyacrylamide gels and quantitative scanning techniques were used to separate actin and to assay its amount in cellular fractions. the actin has been identified in electrophoretograms by its molecular weight and it ... | 1978 | 565782 |
the effects of high hydrostatic pressure on microfilaments and microtubules in xenopus laevis. | xenopus laevis embryos of stages 14-20 were subjected, for periods of 5-330 min, to hydrostatic pressures ranging from 500 to 10 000 psi. the specimens were fixed under corresponding pressures and their neuroepithelium was studied under light and electron microscopy. a pressure of 3000 psi, maintained for as long as 180 min, did not inhibit neurulation though it induced slight deformities of the neuroepithelium. a pressure of 4000 psi, applied for 180 min, disrupted the apical ring of microfilam ... | 1978 | 565800 |
changes of nucleosome frequency in nucleolar and non-nucleolar chromatin as a function of transcription: an electron microscopic study. | the morphology of nucleolar and non-nucleolar (lampbrush chromosome loops) chromatin was studied in the electron microscope during states of reduced transcriptional activity in amphibian oocytes (xenopus laevis, triturus alpestris, t. cristatus). reduced transcriptional activity was observed in maturing stages of oocyte development and after treatment with an inhibitor, actinomycin d. strands of nucleolar chromatin appear smooth and thin, and contain only few, if any, nucleosomal particles in th ... | 1978 | 566162 |
the nucleotide sequence of oocyte 5s dna in xenopus laevis. i. the at-rich spacer. | the primary sequence of the principal spacer region in x. laevis oocyte 5s dna has been determined. the spacer is at-rich and comprises half or more of each repeating unit. the sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: caacagttttcaaaaggtttcgaagttttt(t). the spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (a2) which is variable in length in different repeating units, flanked ... | 1978 | 566163 |
the nucleotide sequence of oocyte 5s dna in xenopus laevis. ii. the gc-rich region. | the primary sequence of the gc-rich half of the repeating unit in x. laevis 5s dna has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. the gc-rich half of the repeating unit contains a single long duplication of 174 nucleotides. the duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. the duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotid ... | 1978 | 566164 |
translation of mouse interferon mrna in xenopus laevis oocytes and in rabbit reticulocyte lysates. | 1978 | 566552 | |
translation "in vitro" of globin mrna from xenopus laevis. | rna isolated from xenopus laevis reticulocytes and characterized as globin mrna (meza et al., 1978) was tested for its capacity to stimulate "in vitro" a wheat germ translation system, and the ability to synthesize a polypeptide. the latter was identified as globin by its electrophoretic mobility and immunoprecipitation with antiglobin antibody. | 1978 | 566631 |
changes of the external and internal pigment pattern upon fertilization in the egg of xenopus laevis. | external and internal pigment shifts in xenopus laevis eggs were studied between fertilization and first cleavage. externally visible, constant features are: (1) the 'activation contraction', a pigment shift towards the animal side taking place between 5 and 15 min post fertilization (p.f.) and (2) the concentration of the pigment around the sperm entrance point leading to the formation of the grey crescent at the opposite side of the egg. hence, in xenopus the grey crescent is not formed by rot ... | 1978 | 566780 |
[modulation of the citrate cycle in mitochondria of xenopus laevis oocytes and biorhythms. i. characteristics of "holocoherent" mitochondria]. | 1978 | 567416 | |
in vivo aminoacylation and 'processing' of turnip yellow mosaic virus rna in xenopus laevis oocytes. | 1978 | 567751 | |
frequency response of the lateral-line organ of xenopus laevis. | the stimulus response relation of the epidermal lateral-line organ of xenopus laevis was studied by recording activity of single afferent nerve fibres in isolated preparations. linear frequency response analysis over a frequency range of 0.1--100hz was performed under steady-state conditions, using small amplitude, sinusoidal water displacements produced by a glass sphere at a short distance from the skin. period histograms of afferent nerve activity were computed, and amplitude, phase and mean ... | 1978 | 567787 |
the simultaneous production of two classes of cytoplasmic immunoglobulins by single cells in xenopus laevis. | 1978 | 568035 | |
transmembrane effects of lectins. i. effects of wheat germ agglutinin and soybean agglutinin on furrow formation and cortical wound healing in xenopus laevis eggs. | 1978 | 568554 | |
post-translational assembly of lens alpha-crystallin in the reticulocyte lysate and in xenopus laevis oocytes. | lens mrna was translated in reticulocyte lysate predominantly into monomeric alpha-crystallin chains. lens polyribosomes added to the cell-free system produced the same polypeptides, but these were detected predominantly in alpha-crystallin aggregates. lens mrna, after microinjection into xenopus laevis oocytes, produced alpha-crystallin subunits that were exclusively found in the form of high-molecular-weight complexes. also after injection of the purified 14-s mrna, coding for the alphaa subui ... | 1978 | 569053 |
studies of the injection of poly(a)+ protamine mrna into xenopus laevis oocytes. | 1978 | 569063 | |
recombinant plasmids containing xenopus laevis globin structural genes derived from complementary dna. | details are presented of the in vitro synthesis of double-stranded dna complementary to purified xenopus globin messenger rna, using a combination of reverse transcriptase, fragment 'a' of e. coli dna polymerase 1 and s1 endonuclease. after selection of duplex dna molecules approaching the length of xenopus globin messenger rna by sedimentation of the dna through neutral sucrose gradients, the 3'-oh termini of the synthetic globin gene sequences were extended with short tracts of oligo dgmp usin ... | 1978 | 347404 |
intracellular motility of mitochondria: role of the inner compartment in migration and shape changes of mitochondria in xth-cells. | mitochondrial movements have been followed by phase-contrast microscopy in living xth-cells (xenopus laevis tadpole-heart cells) in tissue culture. the same organelles have been viewed subsequently in electron micrographs. locomotion of mitochondria proceeds at velocities up to 100 micrometer/min. formation of branches of mitochondria and other shape changes may occur with the same speed. mitochondrial motility can be classified into 4 types: (i) alternating extension and contraction at the two ... | 1978 | 348713 |
lymphocyte surface immunoglobulin in xenopus laevis. light and electron microscopic demonstration by immunoperoxidase method. | 1978 | 355005 | |
a method for isolating uncontaminated nuclei from all stages of developing xenopus laevis embryos. | a method for isolating nuclei from xenopus laevis embryos has been developed. this procedure enables the isolation of nuclei, free from contamination with yolk and pigment granules, at all stages of embryoic development. using this method the nuclear yield is 60--70% of the estimated number of cells in the embryo. the dna, rna, histone and non-histone protein content of these nuclei during embryogenesis (from early cleavage to the swimming tadpole stage) has been measured. | 1978 | 370328 |
cloning of nematode trna genes and their expression in the frog oocyte. | transfer rna genes of the nematode caenorhabditis elegans have been cloned in e. coli using the plasmid col e1 as vector. the trnas coded by 3 hybrid plasmids were purified by hybridisation of labelled nematode trna with the plasmid dnas. each plasmid appears to code for a single distinct trna species. the expression of the cloned dnas was analysed in vivo by injection into nuclei of xenopus laevis oocytes. evidence is presented which suggests that these nematode trna genes are accurately transc ... | 1978 | 370775 |
amphibian cells in culture. ii. isolation of drug-resistant variants and an asparagine-independent variant. | with l-15 as the base medium, drug-resistant variants were isolated from two amphibian tissue culture strains: the xenopus laevis a8 diploid cell line and the icr 2a cell line of rana pipiens. four different classes of variants were obtained: (1) a8 cells resistant to chloramphenicol, an inhibitor of mitochondrial protein synthesis; (2) a8 cells resistant to ouabain, an inhibitor of the na+/k+-activated atpase of the plasma membrane;(3) icr 2a cells resistant to low (20 microgram/ml) and high (3 ... | 1978 | 307557 |
the effects of exogenous melatonin upon the gut of larval xenopus laevis. | 1978 | 310409 | |
lens regeneration from cornea of larval xenopus laevis in the presence of the lens. | in xenopus laevis tadpoles, wounding of the outer cornea failed to initiate lens regeneration. if both the outer and inner corneas were wounded or if the lens was dislocated, lens regeneration was initiated but failed to continue beyond stage iii. however, lensectomy followed by re-implantation of the lens resulted in the regeneration of a fully differentiated lens in several cases, despite the presence of the re-implanted lens. although some of the regenerates in these eyes were also arrested a ... | 1978 | 311375 |
method for the preparation of active maturation promoting factor (mpf) from in vitro matured oocytes of xenopus laevis. | a method for the large scale extraction of maturation promoting factor (mpf) from in vitro matured oocytes of xenopus laevis is described. mpf has been previously described only as a component(s) of hormone-matured cytoplasm within amphibian oocytes (or eggs) which is able to induce the reinitiation of the meiotic process from late diplotene stage until second metaphase arrest, when microinjected into diplotene arrested (fully grown) recipient oocytes. standard biochemical methods for the extrac ... | 1978 | 207616 |
embryopathies due to spermatozoal impairment in xenopus laevis. | an in vitro test system, involving gametes of xenopus laevis has been used to study the effect of antifertility agents upon spermatozoa as manifest in developing embryos. exposure to either the isomeric forms of dimethylmyleran, methyl methanesulphonate or gamma-radiation led to development of a range of embryopathies, whereas treatment with steroidal drugs or the rodent epididymal chemosterilants alpha-chlorohydrin and trimethylphosphate was compatible with production of apparently normal offsp ... | 1978 | 209323 |
chromatin assembly and transcription in eggs and oocytes of xenopus laevis. | 1978 | 209936 | |
high affinity of carozolol for beta-adrenoceptors coupled to the adenylyl cyclase in ventricular myocardium of kitten and xenopus laevis. | catecholamine-induced stimulation of adenylyl cyclase in ventricular membranes of kitten and xenopus laevis was antagonized competitively by carazolol. apparent equilibrium constants ranging between 100-170 pm were estimated for the beta-adrenoceptor-carazolol complex. | 1978 | 210404 |
the effects of alpha and beta adrenergic agents on spleen cell antigen binding in four amphibian species. | adults of two urodele amphibian species (triturus cristatus carnifex and cynops hongkongensis) and two anuran species (rana temporaria and xenopus laevis laevis) were immunized with a 25% suspension of sheep or horse erythrocytes. after eight or 14 days, splenic lymphocytes were removed, and their specific red cell-binding capacities tested by immunocytoadherence. antigen-binding cells were classified as high-dose nonsecretory (s-) or secretory (s+), according to whether they bound a single laye ... | 1978 | 211039 |
cytochrome oxidase activity of mitochondria in xenopus laevis previtellogenic oocytes. | 1978 | 211159 | |
a biochemical comparison of xenopus laevis and mammalian myelin from the central and peripheral nervous systems. | myelin purified from the central nervous system of xenopus laevis contained the same major lipid and protein components as human myelin. however, some minor differences in the myelin proteins were noted. the xenopus basic protein had a higher apparent mol wt. on sodium dodecyl sulfate gels than the corresponding mammalian protein. the absolute specific activity of 2',3'-cyclic nucleotide 3'-phosphohydrolase in the xenopus myelin was considerably higher than in mammals. there were differences in ... | 1978 | 211203 |
cap analogues do not inhibit mrna translation in xenopus laevis oocytes. | 1978 | 212317 | |
the regulation of growth in the mesonephric kidney of adult xenopus laevis by an endogenous inhibitor of proliferation. | 1978 | 151645 | |
light and electron microscopic investigation of atpase activity in musculature during anuran tail resorption. | the histochemical activity of adenosine triphosphatase (atpase) was studied at light and electron microscopic levels in larval tail musculature of rana catesbeiana and rana ornativentris during late metamorphic stages. the presence of low, moderate or dark reaction of k2-edta-preincubated ca++-atpase was correlated with the variable degree of degeneration of white fibres even at the late stage of tail resorption. the reasons for an increase in this atpase activity in degenerating white muscle fi ... | 1978 | 153341 |
amphibian oocyte maturation and protein synthesis: related inhibition by cyclic amp, theophylline, and papaverine. | two inhibitors of cyclic amp phosphodiesterase (3':5'-cyclic-amp 5'-nucleotidohydrolase, ec 3.1.4.17), theophylline and papaverine, inhibit the maturation of xenopus laevis oocytes induced by four different stimuli: human chorionic gonadotropin, progesterone, testosterone, and lanthanum ions. addition of 1 mm cyclic amp to the medium delays maturation by approximately 2 hr. papaverine, theophylline, and cyclic amp inhibit amino acid incorporation into oocyte proteins by 50% or more but do not in ... | 1978 | 206889 |
displacement-loop replication initiation sequence in animal mitochondrial dna exists as a family of discrete lengths. | the single-stranded mitochondrial dna (mtdna) displacement-loop initiation sequence (7s mtdna) is hydrogen-bonded at the origin of replication in animal cell mtdna. analysis of 7s mtdna from several cell sources indicates that this initiation sequence exists as a family of fragments of relatively discrete lengths. mtdna from both mouse l cells and mouse liver has four major sizes of 7s mtdna fragments, ranging from 500 to 580 nucleotides in length. the 5'-end region of each of these species is t ... | 1978 | 273230 |
transcription of cloned trna gene fragments and subfragments injected into the oocyte nucleus of xenopus laevis. | cloned 3.18 kilobase fragments of xenopus laevis dna containing genes for trnamet1 and for at least one other 4s rna species are transcribed rapidly after their injection into the nucleus of x. laevis oocytes. the newly synthesized rna can be resolved by gel electrophoresis into a few predominant 4s rna species and a series of slower migrating components. one of the 4s rna species appears to be identical, by fingerprint analysis, to the trnamet1 isolated by hybridization of somatic cell rna to t ... | 1978 | 274710 |
cloned single repeating units of 5s dna direct accurate transcription of 5s rna when injected into xenopus oocytes. | single and multiple repeating units of three types of xenopus 5s dna recombined with the plasmid pmb9 serve as templates for the accurate synthesis of 5s rna after their injection into xenopus laevis oocyte nuclei. all 15 cloned single repeating units of x. laevis oocyte 5s dna that were tested supported 5s rna synthesis. three cloned fragments of x. borealis oocyte 5s dna and one cloned single repeating unit of x. borealis somatic 5s dna were templates for 5s rna synthesis. we conclude that the ... | 1978 | 275856 |
induction of maturation in xenopus laevis oocytes by a steroid linked to a polymer. | a progesterone analog has been covalently linked via an amide bond to polyethylene oxide (molecular weight, 20,000). this macromolecular steroid molecule displays the biological activity of progesterone in inducing meiotic maturation when incubated with xenopus laevis oocytes (stage vi) in vitro. its efficiency (half-maximum effective concentration, 30 mum) is approximately 10 times lower than that of its low molecular weight homolog (3 mum). control experiments with polyethylene oxide and an es ... | 1978 | 276879 |
the nucleotide sequence of the repeating unit in the oocyte 5s ribosomal dna of xenopus laevis. | 1978 | 277309 | |
does 3'-terminal poly(a) stabilize human fibroblast interferon mrna in oocytes of xenopus laevis? | polynucleotide phosphorylase (polyribonucleotide:orthophosphate nucleotidyltransferase, ec 2.7.7.8) purified from escherichia coli was used enzymatically to deadenylate polyadenylated human fibroblast interferon mrna preparations obtained from human diploid fibroblasts (fs-4 strain) induced by poly(i)-poly(c) (20 microgram/ml) in the presence of cycloheximide (50 microgram/ml, 4 hr). both the polyadenylated and the deadenylated interferon mrna preparations were translated into biologically activ ... | 1978 | 283411 |
translation of type c viral rnas in xenopus laevis oocytes: evidence that the 120,000-molecular-weight polyprotein expressed in abelson leukemia virus-transformed cells is virus coded. | the genomic rna of abelson leukemia virus (ablv) has been purified and translated in xenopus laevis oocytes. the primary ablv-specific protein synthesized is a polyprotein corresponding in molecular weight and immunological properties to a previously described p15 and p12 containing 110,000- to 130,000-molecular-weight polyprotein expressed in ablv-transformed cells. in contrast, translation of woolly monkey sarcoma virus genomic rna resulted in symthesis of a 55,000-molecular-weight polyprotein ... | 1978 | 214586 |
progesterone-induced meiosis in xenopus laevis oocytes: a role for camp at the "maturation-promoting factor" level. | cholera toxin inhibition of progesterone-induced meiosis of xenopus laevis oocytes in vitro has been correlated with increased camp levels. inhibition of germinal vesicle breakdown (gvbd) and camp increase occurred after a lag period of 2 hr, when cholera toxin was injected, or 4--5 hr, when applied externally. the ability of the maturation-promoting factor (mpf) to provoke gvbd when injected into recipient oocytes was found to be dependent upon whether the oocytes had been exposed to cholera to ... | 1978 | 215320 |
[properties of sex steroid-binding protein from xenopus laevis blood serum and detection of an estradiol-binding component in frog liver cytosol which differs from sex steroid-binding protein]. | binding and physico-chemical properties of sex steroid-binding protein (sbp) from blood serum and those of estrogen-binding components from liver cytosol of pubertal male and female species of clawed frog xenopus laevis were studied. it was shown that sbp from both sex species of x. laevis specifically binds estradiol (e2) (ka=5 . 10(6) m-1). concentration of sbp binding sites for e2 is 7 . 10(-12) mole per mg of protein. testosterone 5alpha-dihydrotestosterone and e2 effectively compete with [3 ... | 1978 | 216428 |
dna supercoiling by xenopus laevis oocyte extracts: requirement for a nuclear factor. | a purified system is described for the introduction of negative supercoils into simian virus 40 dna. the system consists of histones h2a, h2b, h3, and h4, dna-relaxing enzyme, and a purified factor from xenopus laevis stage 6 oocyte nuclei. the nuclei are prepared en masse by the technique of f. scalenghe, m. buscaglia, c. steinheil, and m. crippa [(1978) chromosoma 60, 299-308]. the supercoiled simian virus 40 dna prepared by this method is indistinguishable from simian virus 40 supercoiled dna ... | 1978 | 217004 |
effects of fasting and cortisol administration on carbohydrate metabolism in xenopus laevis daudin. | 1978 | 217800 | |
[effects of cyclic amp treatment on the migration of primordial germ cells in the embryo of xenopus laevis]. | after a treatment of early embryos by ampc, only 40% of the primordial germ cells are found in the gonads; the others are found in the dorsal mesentery and especially in the intestinal wall. | 1978 | 226281 |
free rna polymerase activities in isolated nuclei from xenopus laevis embryos. stimulation of endogenous template-bound rna polymerase ii activity by poly d(a-t) [proceedings]. | 1978 | 81029 | |
further studies of the prospective fates of blastomeres at the 32-cell stage of xenopus laevis embryos. | each blastomere in the marginal zone of xenopus laevis embryos at the 32-cell stage was stained with nile blue sulphate. only specimens with the typical arrangement of blastomeres of morulae of this species were used, and special care was taken to prevent the dye from spreading to neighbouring cells and to determine the extent of stained areas. the prospective fate of each blastomere was studied and a new fate-map of the 32-cell embryo was drawn by tracing the movement of stain during the course ... | 1978 | 83458 |
[inhibition by the enterotoxin of vibrio cholerase of meiosis reinitiation of the xenopus laevis oocyte induced in vitro by progesterone]. | progesterone reinitiates in vitro meiosis in xenopus laevis oocytes. this action of the hormone can be abolished by the exotoxin of vibrio cholerae. the concentration of toxin which inhibits 50% of the progesterone (10 mum) action in about 2.5 pm. binding experiments using 125i labelled toxin demonstrated the existence of high affinity binding sites (kd approximately 0.2 nm) located probably on the surface of the oocytes. | 1978 | 95900 |
[histochemistry of the ball cell in larval epidermis of xenopus laevis daudin]. | presented investigations of chemical composition and metabolism of ball cell in larval epidermis of xenopus point to a regressive shape of cell corresponding to former light and electron microscopical findings. the lower requirements of energy of this cell are covered by glycolysis and possibly by pentose phosphate cycle. our hypothesis of pressure-elastic ball of cell as structural element of larval epidermis could been further supported. | 1978 | 97905 |
clustered and interspersed repetitive dna sequences in four amphibian species with different genome size. | we have compared the amount of clustered and interspersed repetitive sequences in the genome of four amphibia with different dna contents per haploid nucleus: two anura (xenopus laevis, 3 pg and bufo bufo, 7 pg) and two urodela (triturus cristatus, 23 pg and necturus maculosus, 52 pg). high molecular weight dna of the four species was denatured and reassociated to the same cot in order to obtain duplex sequences with a similar reiteration frequency. single-stranded dna was digested off with the ... | 1978 | 101246 |
immunoglobulin evolution: chemical study of clawed toad (xenopus laevis) heavy and light chains. | nh2 terminal amino acid sequence determinations of clawed toad (xenopus laevis) immunoglobulins indicate that approximately 30% of the heavy chains and less than 5% of the light chains have unblocked nh2 termini. the major amino acid sequence of the x. laevis 7s immunoglobulin heavy chains is the same as that of the 19s immunoglobulin heavy chains. thus in the synthesis of the heavy chains, the vh genes coding for unblocked heavy chains can associate with ch genes of both the 19s and 7s classes. ... | 1978 | 103971 |