Publications
| Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
|---|
| separation of the infectious ribonucleic acid of potato spindle tuber virus from double-stranded ribonucleic acid of plant tissue extracts. | the infectious ribonucleic acid (rna) of potato spindle tuber virus (pstv) can be separated by hydroxyapatite chromatography from double-stranded rna detectable in low amounts in both infected and uninfected plant tissue extracts. the chromatographic behavior of ribonuclease-sensitive pstv rna resembles that of transfer rna. | 1971 | 4332146 |
| potato spindle tuber viroid. vi. monodisperse distribution after electrophoresis in 20 per cent polyacrylamide gels. | 1971 | 5130125 | |
| potato spindle tuber viroid. v. failure of immunological tests to disclose double-stranded rna or rna-dna hybrids. | 1971 | 5166353 | |
| potato spindle tuber virus: a plant virus with properties of a free nucleic acid. 3. subcellular location of pstv-rna and the question of whether virions exist in extracts or in situ. | 1971 | 5543290 | |
| potato spindle tuber viroid. vii. susceptibility of several solanaceous plant species to infection with low molecular-weight rna. | 1972 | 5031507 | |
| potato spindle tuber viroid. 8. correlation of infectivity with a uv-absorbing component and thermal denaturation properties of the rna. | 1972 | 4636118 | |
| potato spindle tuber viroid ix. molecular-weight determination by gel electrophoresis of formylated rna. | 1973 | 4712388 | |
| potato spindle tuber viroid. x. visualization and size determination by electron microscopy. | 1973 | 4728831 | |
| potato spindle tuber viroid. xi. a comparison of the ultraviolet light sensitivities of pstv, tobacco ringspot virus, and its satellite. | 1974 | 4817076 | |
| potato spindle tuber viroid. xii. an investigation of viroid rna as a messenger for protein synthesis. | 1974 | 4606921 | |
| potato spindle tuber viroid. xiii. inhibition of replication by actinomycin d. | 1975 | 1114697 | |
| potato spindle tuber viroid. xiv. replication in nuclei isolated from infected leaves. | 1975 | 1114704 | |
| piperonyl butoxide, a potent inhibitor of potato spindle tuber viroid in scopolia sinensis. | piperonyl butoxide has been found to act as potent inhibitor for potato spindle tuber viroid in scopolia sinensis hemsl plant. | 1975 | 1203757 |
| towards an understanding of viroid nature and replication. | in leaf strips and in nuclei isolated from potato spindle tuber viroid (pstv)-infected tomato, incorporation of [3h]ump into pstv is shown to be inhibited by pre-treatment of the leaf-strips with actinomycin d. these results demonstrate that pstv is synthesized in the cell nucleus and that replication may occur from a dna template. | 1976 | 1275410 |
| separation of potato spindle tuber viroid ribonucleic acid from scopolia sinensis into three infectious forms and the purification and oligonucleotide pattern of fraction ii rna. part ix. | the existence of three infectious forms of potato spindle tuber viroid (pstv) rna from scopolia sinensis was demonstrated by fractionation with high salt, by reverse phase and high pressure liquid chromatography, and by polyacrylamide gel electrophoresis. purification of fraction ii was achieved by the following steps: extraction of nucleic acid with phenol, precipitation of the rna with cetyltrimethylammonium bromide, fractionation of the rna with lithium chloride and isopropanol, and finally ... | 1976 | 953847 |
| viroids are single-stranded covalently closed circular rna molecules existing as highly base-paired rod-like structures. | viroids are uncoated infectious rna molecules pathogenic to certain higher plants. four different highly purified viroids were studied. by ultracentrifugation, thermal denaturation, electron microscopy, and end group analysis the following features were established: (i) the molecular weight of cucumber pale fruit viroid from tomato is 110,000, of citrus exocortis viroid from gynura 119,000, of citrus exocortis viroid from tomato 119,000 and of potato spindle tuber viroid from tomato 127,000. (ii ... | 1976 | 1069269 |
| hybridization of potato spindle tuber viroid to cellular dna of normal plants. | molecular hybridization experiments of (125)i-labeled potato spindle tuber viroid (pstv) with dna from uninfected or pstv-infected tomato plants showed that infrequent dna sequences complementary to pstv exist in both uninfected and infected cells. dna titration experiments revealed that at least 60% of pstv is represented by sequences in dna of several normal solanaceous host species. phylogenetically diverse plants contain sequences related to less of the pstv. pstv-infected tomato or gynura a ... | 1976 | 16592335 |
| synthesis of dna transcripts of potato spindle tuber viroid. | 1977 | 67055 | |
| separation and infectivity of circular and linear forms of potato spindle tuber viroid. | potato spindle tuber viroid can be separated into two fractions by polyacrylamide gelelectrophoresis in the presence of formamide and urea. one fraction contains predominantly circular molecules; the second fraction contains almost exclusively linear molecules. the purity of the fractions was estimated by electron microscopy of formaldehyde-denatured molecules. the length distributions of denatured circular and linear molecules were determined. both circular and linear molecules were found to be ... | 1977 | 269437 |
| size and secondary structure of potato spindle tuber viroid. | 1977 | 841846 | |
| de novo synthesis of potato spindle tuber viroid as measured by incorporation of 32p. | 1977 | 860413 | |
| synthesis of rna complementary to potato spindle tuber viroid using q beta replicase. | 1977 | 867818 | |
| comparative oligonucleotide fingerprints of three plant viroids. | 5' phosphorylation in vitro with gamma-32p-atp and t4 phage induced polynucleotide kinase was used to obtain rnaase a and rnaase t1 fingerprints of three plant viroids: potato spindle tuber viroid from tomato (pstv-tom), chrysanthemum stunt viroid from cineraria (chsv-cin) and citrus exocortis viroid from gynura aurantiaca (cev-gyn). these three viroids differ significantly from each other as judged from their oligonucleotide patterns. this supports the concept of individual viroid species. | 1977 | 896482 |
| studies on the primary and secondary structure of potato spindle tuber viroid: products of digestion with ribonuclease a and ribonuclease t1, and modification with bisulfite. | potato spindle tuber viroid (pstv), a small infectios rna, has been completely digested with rnase t1 and rnase a, and the resulting oligonucleotides have been sequenced using 5'-terminal 32p-labelling with gamma-32p atp and t4 polynucleotide kinase, fingerprinting and controlled nuclease p1 digestion. modified nucleotides have not been detected in 5'-positions of these oligonucleotides. pstv consists of about 359 nucleotides and contains a remarkable stretch of 18 purines, mainly adenosines; th ... | 1978 | 418383 |
| nucleotide sequence and secondary structure of potato spindle tuber viroid. | the viroid of the potato spindle tuber disease (pstv) is a covalently closed ring of 359 ribonucleotides. as a result of intramolecular base pairing, a serial arrangement of double-helical sections and internal loops form a unique rod-like secondary structure. pstv is the first pathogen of a eukaryotic organism for which the complete molecular structure has been established. | 1978 | 643081 |
| in vivo synthesis of potato spindle tuber viroid: kinetic relationship between the circular and linear forms. | 1978 | 664231 | |
| potato spindle tuber viroid: circular dichroism spectrum and physical chemical studies of its interaction with ethidium bromide. | the presence and extent of base-paired secondary structure in the protein-free potato spindle tuber viroid rna has been investigated by spectroscopic techniques. dye-binding studies with the intercalating dye, ethidium bromide, indicate the presence of base-paired regions in the molecule. variation of the induced chirality in the dye with the dye to rna phosphate ratio indicate the presence of two base-paired regions in the molecule. | 1978 | 728834 |
| potato spindle tuber and citrus exocortis viroids undergo no major sequence changes during replication in two different hosts. | potato spindle tuber viroid and citrus exocortis viroid, each purified from tomato (lycopersicon esculentum) and from gynura aurantiaca, were iodinated in vitro with (125)i, digested with ribonuclease t1, and subjected to two-dimensional rna fingerprinting analysis. with the exception of minor variations, each viroid retained its distinctive fingerprint pattern irrespective of the host species from which it was isolated. we conclude that the nucleotide sequences of these viroids are principally ... | 1978 | 16592502 |
| in vitro synthesis and characterization of dna complementary to potato spindle tuber viroid. | when dnase-digested calf thymus dna is used as primer, the rna-directed dna polymerase of avian myeloblastosis virus will accept potato spindle tuber viroid (pstv) as a template for dna synthesis. the dna obtained hybridizes specifically to pstv and low molecular weight rna isolated from pstv-infected plants; no hybridization to unrelated viral rnas or tow molecular weight rna isolated from uninoculated host plants was detectable. purified pstv cdna is heterogeneous in length, but the mean chain ... | 1978 | 18627880 |
| measurement of viroid sequence homology by hybridization with complementary dna prepared in vitro. | dna complementary to potato spindle tuber viroid (ystv cdna) has been used in rna dna hybridization experiments to study pstv replication in a variety of hosts and to measure the amount of sequence homology between ystv and several independently isolated viroids. when pstv cdna was hybridized with low molecular weight rna isolated from pstv-infected tomato at different times after inoculation, pstv . pstv cdna hybrids were detectable before symptoms began to appear. low molecular weight rna was ... | 1978 | 18627881 |
| evidence for a single infectious species of potato spindle tuber viroid. | potato spindle tuber viroid (pstv) has been separated into two electrophoretic species on polyacrylamide gels containing 8 m urea at 60 degrees. only the slower-migrating electrophoretic form was infectious and is presumably the circular form of the molecule. both forms had similar base compositions with a 55-58% gc content, similar to the citrus exocortis viroid. labeling studies in vivo suggest that the viroid is not methylated. | 1979 | 429145 |
| tomato dna contains no detectable regions complementary to potato spindle tuber viroid as assayed by solution and filter hybridization. | a previous report (hadidi et al. (1976) proc. nat. acad. sci. usa73, 2453-2457) has suggested that potato spindle tuber viroid (pstv) rna contains sequences complementary to the dna of its host and, to a lesser extent, to the dna of some nonhost species. our studies indicate, however, that the apparent hybridization between (125)i-labeled pstv and tomato dna which can be observed in both solution and filter hybridization experiments is a consequence of the hybridization of host rnas (mostly ribo ... | 1980 | 18631656 |
| tomato dna contains no detectable regions complementary to potato spindle tuber viroid as assayed by southern hybridization. | dna was isolated from crude nuclear pellets prepared from rutgers tomato plant leaf tissue from both potato spindle tuber viroid (pstv)-infected and uninfected plants. following digestion by the dna restriction enzymes ecori, xbai, or bamhi, the dna was fractionated by agarose gel electrophoresis, transferred to nitrocellulose filters, and incubated with a variety of 125i-labeled rna probes under conditions which permit hybridization. analysis of autoradiogram patterns and fingerprints of the rn ... | 1980 | 18631657 |
| molecular cloning and characterization of potato spindle tuber viroid cdna sequences. | double-stranded cdna has been synthesized from a polyadenylylated potato spindle tuber viroid (pstv) template and inserted in the pst i endonuclease site of plasmid pbr322 by using the oligo(dc).oligo(dg)-tailing procedure. tetracycline-resistant ampicillin-sensitive transformants contained sequences complementary to pstv [(32)p]cdna, and one recombinant clone (pdc-29) contains a 460-base-pair insert. this cloned double-stranded pstv cdna contains the cleavage sites for six restriction endonucle ... | 1980 | 16592877 |
| are viroids escaped introns? | a complex of considerable stability is possible between the 5' end of u1 rna and a specific nucleotide sequence of the potato spindle tuber viroid complement. because base-pairing between the 5' end of u1 rna and the ends of introns is believed by some to be responsible for the precise alignment and correct excision of introns, the u1-related sequence may represent the two ends of a presumed intron ancestor of the viroid complement after circularization. | 1981 | 16593072 |
| longer-than-unit-length viroid minus strands are present in rna from infected plants. | nucleic acids isolated from uninfected and potato spindle tuber viroid-infected rutgers tomato plants were fractionated on agarose gels under two different sets of denaturing conditions and hybridized to (125)i-labeled viroid in a series of blot hybridization experiments. complementary strand nucleic acids detected in extracts of infected plants were heterogeneous in size, with four discrete bands containing molecules approximately 700, 1050, 1500, and 1800 nucleotides long. enzymatic studies in ... | 1981 | 16593104 |
| plant cell suspension cultures sustain long-term replication of potato spindle tuber viroid. | cell suspension cultures were established from tomato plants (lycopersicum esculentum cv. "rutgers") infected with either a severe (tps cell line) or a mild (tpm cell line) strain of potato spindle tuber viroid (pstv) and from uninfected plants (th cell line). based on measurements of packed cell volume, the tps line exhibited a slower growth rate than the th line, and reached lower levels of total cell volume during the stationary phase. the tpm line was intermediate between the other two. all ... | 1981 | 18635038 |
| sensitive and rapid diagnosis of potato spindle tuber viroid disease by nucleic acid hybridization. | a sensitive and reliable new method for the detection of potato spindle tuber viroid in potato tubers has been developed. the method is based on hybridization of highly radioactive recombinant dna to viroid rna that has been attached to a solid support. the method can be automated and permits the rapid testing of large numbers of tubers. | 1981 | 17847478 |
| specifically primed synthesis in vitro of full-length dna complementary to potato-spindle-tuber viroid. | potato spindle tuber viroid (pstv) rna is transcribed in vitro by reverse transcriptase into complementary dna in the presence of synthetic oligodeoxyribonucleotides as primers. in the case of priming with the pentadecadeoxyribonucleotide d(t-t-c-t-t-t-t-t-t-c-t-t-t-t-c) complementary to pstv rna from nucleotides 49 to 63, specificity of transcription initiation allows rapid sequencing of part of the viroid genome using chain-terminating dideoxyribonucleoside triphosphates. the dna transcripts o ... | 1981 | 6169524 |
| a severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only. | fingerprint analyses of two potato spindle tuber viroid (pstv) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the rnase t1 and rnase a fingerprints. the complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides caaaaaag, cuuuuucucuaucuuacuug, and aaaaaaggac in the 'severe' strain are replaced by caauaag, cuuuuucucuaucuuucu ... | 1981 | 6271277 |
| nuclear dna from uninfected or potato spindle tuber viroid-infected tomato plants contains no detectable sequences complementary to cloned double-stranded viroid cdna. | high molecular weight tomato nuclear dna was isolated from uninfected and potato spindle tuber viroid (pstv)-infected tomato leaves. restriction digests were fractionated on agarose gels, denatured and transferred to diazobenzyloxymethylpaper, and hybridized to 32p-labeled cloned double-stranded pstv cdna. no hybridization to dna from either uninfected or infected tissue could be detected under conditions that permitted detection of cloned double-stranded pstv cdna at a concentration equivalent ... | 1981 | 6273895 |
| chrysanthemum stunt viroid: primary sequence and secondary structure. | the sequence of the 356 nucleotide residues of chrysanthemum stunt viroid (csv) has been determined. overlapping linear viroid fragments were obtained by partial ribonuclease digestion, radiolabelled in vitro at their 5'-ends, and sequenced using partial enzymic cleavage methods. of the csv sequence, 69% is contained in the published sequence of potato spindle tuber viroid (pstv). differences in the primary sequence of csv and pstv suggest that neither the positive nor putative negative strands ... | 1981 | 7279660 |
| continuous replication of potato spindle tuber viroid (pstv) in permanent cell cultures of potato and tomato. | the continuous replication of potato spindle tuber viroid (pstv) in callus cultures from pstv-infected wild-type potato (solanum demissum l.) and tomato (lycopersicon peruvianum l. mill) plants and in cell suspensions derived from potato protoplasts (solanum tuberosum l.) inoculated in vitro is described. the persistence of pstv replication in these cell lines through at least 14 subculture passages, which corresponds to a continuous replication over a period of more than one year, was demonstra ... | 1981 | 7284577 |
| avocado sunblotch viroid: primary sequence and proposed secondary structure. | the sequence of the 247 nucleotide residues of the single strand circular rna of avocado sunblotch viroid (asbv) was determined using partial enzymic cleavage methods on overlapping viroid fragments obtained by partial ribonuclease digestion followed by 32p-labelling in vitro at their 5'-ends. asbv is much smaller than potato spindle tuber viroid (pstv; 359 residues) and chrysanthemum stunt viroid (csv; 356 residues). a secondary structure model for asbv is proposed and contains 67% of its resid ... | 1981 | 7322921 |
| viroid rna is accepted as a template for in vitro transcription by dna-dependent dna polymerase i and rna polymerase from escherichia coli. | the rna genome of potato spindle tuber viroid (pstv) is transcribed in vitro into complementary dna and rna by dna-dependent dna polymerase i and rna polymerase, respectively, from escherichia coli. in vitro synthesis of complementary rna produces distinct transcripts larger than unit length thus reflecting the in vivo mechanism of viroid replication. the influence of varying experimental conditions on the transcription process is studied; actinomycin d is found to drastically reduce complementa ... | 1982 | 6760914 |
| viroids and prions. | viroids are small "naked" infectious rna molecules that are pathogens of higher plants. the potato spindle tuber viroid (pstv) is composed of a covalently closed circular rna molecule containing 359 ribonucleotides. the properties of pstv were compared with those of the scrapie agent, which causes a degenerative neurological disease in animals. pstv was inactivated by ribonuclease digestion, psoralen photoadduct formation, zn2+ -catalyzed hydrolysis, and chemical modification with nh2oh. the scr ... | 1982 | 6813855 |
| analysis of acid-extractable tomato leaf proteins after infection with a viroid, two viruses and a fungus and partial purification of the "pathogenesis-related" protein p 14. | gel electrophoretic analysis revealed marked alterations in the pattern of acid-extractable proteins from tomato leaves after infection with a viroid (pstv), two viruses [tobacco mosaic virus (tmv) and cucumber mosaic virus (cmv)], and a fungus (cladosporium fulvum) when compared to the pattern from healthy leaves. a pathogen-specific appearance of new protein bands was only found after infection with tmv (mw 17,400 and 65,000), cmv (mw 9000 and 8000) and cladosporium fulvum (mw 28,000). with th ... | 1982 | 6891893 |
| in vitro transcription of viroid rna into full-length copies by rna-dependent rna polymerase from healthy tomato leaf tissue. | rna-dependent rna polymerase from healthy tomato plant tissue accepts potato spindle tuber viroid (pstv) rna as a template for the in vitro synthesis of full-length rna copies of the pstv genome. viroid transcription requires the presence of mn2+ and /or mg2+ ions and is not inhibited by concentrations of 10(-5) m alpha-amanitin. this is the first report of a well-defined product synthesized in vitro by an rna-dependent rna polymerase from healthy plants. | 1982 | 6896006 |
| molecular cloning and characterization of a complete dna copy of potato spindle tuber viroid rna. | double-stranded cdna has been synthesized from rna of a severe strain of potato spindle tuber viroid using a synthetic oligodeoxyribonucleotide as a primer. upon cloning in bacteriophage m13mp9, two recombinant phages were selected to construct a pbr322-derived plasmid containing a complete viroid dna copy. elucidation of the nucleotide sequence revealed four differences with the previously established sequence of another pstv strain, three of which were base exchanges and one a deletion. | 1982 | 6897677 |
| nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid. | the complete nucleotide sequence of citrus exocortis viroid (cev, propagated in gymura) and chrysanthemum stunt viroid (csv, propagated in cineraria) has been established, using labelling in vitro and direct rna sequencing methods and a new screening procedure for the rapid selection of suitable rna fragments from limited digests. the covalently closed circular single-stranded viroid rnas consist of 371 (cev) and 354 (csv) nucleotides, respectively. as previously shown for potato spindle tuber v ... | 1982 | 7060550 |
| stiffness of viroids and viroid-like rna in solution. | the sedimentation coefficients of the potato spindle tuber viroid, four viroid-like rnas from cadang-cadang-disease, circular rna from velvet tobacco mottle virus, circular rna from solanum nodiflorum mottle virus and double stranded rna5 from cucumber mosaic virus were measured in the analytical ultracentrifuge. the numbers of nucleotides of the rna species varied between 246 and 670. the hydrodynamic models of rigid rods and flexible cylinders were applied for the interpretation of the sedimen ... | 1982 | 7145708 |
| cell-free circularization of viroid progeny rna by an rna ligase from wheat germ. | linear, potato spindle tuber viroid rna has been used as a substrate for an rna ligase purified from wheat germ. linear viroid molecules are efficiently converted to circular molecules (circles) which are indistinguishable by electrophoretic mobility and two-dimensional oligonucleotide pattern from viroid circles extracted from infected plants. in light of recent evidence for multimeric viroid replication intermediates, cleavage followed by rna ligation by a cellular enzyme may (i) be a normal s ... | 1982 | 17740972 |
| purification and characterization of hop stunt viroid. | the hop stunt viroid (hsv) has been purified from cucumber leaves infected with the hop stunt disease agent. electron microscopic observation of denatured hsv shows a typical viroid rna molecule of covalently closed circular form. the molecular length was estimated to be 290-300 nucleotides by electron microscopic measurement and polyacrylamide gel electrophoresis using potato spindle tuber viroid as a standard. hsv is one of the smallest viroids characterized so far. hsv preparations were separ ... | 1982 | 18635127 |
| rna intermediates in potato spindle tuber viroid replication. | two double-stranded rna intermediates of viroid replication have been isolated from potato spindle tuber viroid (pstv)-infected tomato tissue and characterized by polyacrylamide gel electrophoresis and dna-rna hybridization techniques. these replicative intermediates contain monomeric circular or linear pstv strands complexed with a multimeric complementary rna strand. synchronous synthesis of single-stranded pstv is accompained by a simultaneous marked increase in double-stranded pstv rna; thus ... | 1982 | 16593138 |
| comparative sequence and structure of different isolates of citrus exocortis viroid. | the nucleotide sequences of two new australian isolates of citrus exocortis viroid (cev), cev-de25 and cev-de26, have been determined and compared with the previously sequenced australian isolate, cev-a (j. e. visvader, a. r. gould, g. e. breuning, and r. h. symons. febs lett.137, 288-292 (1982).) and a californian isolate, cev-c (h. j. gross, g. krupp, h. domdey, m. raba, p. jank, c. lossow, h. alberty, k. ramm, and h. l. sanger. eur. j. biochem.121, 249-257 (1982).). sequencing of recombinant ... | 1983 | 18639139 |
| subcellular localization of viroids in highly purified nuclei from tomato leaf tissue. | approximately 95% of the viroid rna which is present in potato spindle tuber viroid (pstv)-infected tomato plant leaf issue, is associated with the nucleolar fraction obtained from purified nuclei. viroids were released from the nucleolar fraction by increasing the ionic strength of the medium to 0.66 suggesting that viroid rna is present in these subnuclear components in a protein-nucleic acid complex. a purification procedure for nuclei from leaf tissue had to be newly developed; it involves t ... | 1983 | 11892810 |
| oligomeric forms of potato spindle tuber viroid (pstv) and of its complementary rna are present in nuclei isolated from viroid-infected potato cells. | different oligomeric forms of pstv are detected in nuclei isolated from pstv-infected potato cells by means of molecular hybridization, using as probes synthetic oligodeoxyribonucleotides with sequence specificity for (+)pstv and for (-)pstv. in addition to several species of longer-than-unit-length (-)pstv molecules, two oligomeric forms of (+)pstv are detected, which correspond in size to rna strands of approximately two and three times viroid unit-length. they must be considered as the precur ... | 1983 | 6626709 |
| structural similarities between viroids and transposable genetic elements. | the primary structures of the tomato planta macho and tomato apical stunt viroids have been determined, and probable secondary structures are proposed. both viroids can assume the rodlike conformation with extensive base-pairing characteristic of all known viroids. sequence homologies between the two viroids (75%) and with members of the potato spindle tuber viroid group (73-83%) indicate that they both belong to this group. comparative sequence analysis of all members of the group reveals strik ... | 1983 | 6312450 |
| construction of infectious potato spindle tuber viroid cdna clones. | contiguous restriction fragments from two cloned partial-length potato spindle tuber viroid (pstv) cdnas were used to construct recombinant dnas containing full-length monomeric and dimeric pstv cdna. when five different pstv cdna plasmids and rna isolated from e. coli cells harboring these plasmids were tested for infectivity on tomato, plasmid dnas containing pstv cdna dimers were infectious. rna transcripts containing the sequence of pstv from these plasmids were also infectious. the sequence ... | 1983 | 6314259 |
| sequence homology between potato spindle tuber viroid and u3b snrna. | sequence homology was found by computer analysis between potato spindle tuber viroid (pstv) rna and u3b snrna of novikoff hepatoma cells. this homology is colinear in arrangement, extends in length to 81% of the entire u3b snrna molecule and is involved in the pstv molecule unique sites which, if depicted in terms of the secondary structure of the circular pstv molecule, reveal a conspicuous regularity in their location. a strong relation in primary structure between pstv and u3b snrna is demons ... | 1983 | 6196230 |
| contitions for optimal growth of a pstv-infected potato cell suspension and detection of viroid-complementary longer-than-unit-length rna in these cells. | a suspension culture from potato spindle tuber viroid (pstv)-infected cells of the wild type potato (solanum demissum) has been established, which is a suitable model system for studying pstv replicationin vivo. the conditions for rapid growth of these cells and for permanent extensive viroid biosynthesis within them are described. biosynthesis of pstv in the potato cells was demonstrated by(32)p-incorporation into nucleic acids and their subsequent electrophoretic analysis on polyacrylamide gel ... | 1983 | 24318372 |
| viroid replication: equilibrium association constant and comparative activity measurements for the viroid-polymerase interaction. | the binding and replication of purified potato spindle tuber viroid (pstv) by dna-dependent rna polymerase ii from wheat germ was studied in analytical ultracentrifugation experiments and in vitro transcription assays. the equilibrium association constant for the viroid-polymerase interaction is 1.9 x 10(7) m-1. both ultraviolet and fluorescent monitoring during the sedimentation experiments showed two distinguishable viroid-polymerase complexes. these are interpreted as resulting from a 1:1 and ... | 1984 | 6473106 |
| purification and partial characterization of the major "pathogenesis-related" tomato leaf protein p14 from potato spindle tuber viroid (pstv)-infected tomato leaves. | the acid-extractable leaf proteins of potato spindle tuber viroid (pstv) infected tomato plants were analysed electrophoretically on polyacrylamide gels. the most prominent alteration found during disease development was the appearance of a "pathogenesis-related" protein with an apparent molecular weight of 14,000 (called p14) which is drastically increased in concentration. its induction, however, is not viroid-specific because it is also accumulating after viral and fungal infections. the degr ... | 1984 | 6477130 |
| cloned single- and double-stranded dna copies of potato spindle tuber viroid (pstv) rna and co-inoculated subgenomic dna fragments are infectious. | a set of monomeric and oligomeric potato spindle tuber viroid (pstv) specific dna forms representing complete dna copies of the circular pstv rna genome were constructed and cloned in plasmid pbr322 and bacteriophage m13. both single- and double-stranded pstv dnas are capable of initiating viroid replication in mechanically inoculated tomato plants where it normally proceeds via the rna-rna pathway without dna being involved. all dimeric and higher multimeric forms were infectious irrespective o ... | 1984 | 6549294 |
| ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and hela 5s rna. | the positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid rna and hela 5s rrna. crosslinking in each of these molecules occurred at a single major site, which was located by rna fingerprinting and secondary analysis (and additional primer extension studies in the case of the viroid). various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to the ... | 1985 | 3863116 |
| complexes of viroids with histones and other proteins. | complexes of potato spindle tuber viroid (pstv) with nuclear proteins have been studied by in vitro reconstitution of the complexes and by isolation and characterization of in vivo complexes under non-dissociating conditions. for in vitro reconstitution, nuclear proteins were separated by sds-gel-electrophoresis, renatured and blotted onto nitrocellulose filters, and incubated with viroid. the viroid-protein complexes were crosslinked covalently, and the viroid containing protein bands were dete ... | 1985 | 3889835 |
| dot-blot procedure with [32p]dna probes for the sensitive detection of avocado sunblotch and other viroids in plants. | avocado sunblotch viroid (asbv) has been detected down to a level of about 20 pg per gram fresh weight of leaves by the use of a dot-blot hybridization procedure and partially purified nucleic acid extracts. three [32p]dna probes were compared, two prepared from full-length asbv clones in the single-strand m13mp93 vector and the other by primer extension on purified asbv. all three probes gave the same sensitivity of detection of asbv. the methods developed have also been used successfully for t ... | 1985 | 3980666 |
| synthesis of (+) and (-) rna molecules of potato spindle tuber viroid (pstv) in isolated nuclei and its impairment by transcription inhibitors. | transcription studies with highly purified potato cell nuclei in combination with a 'transcription-hybridization analysis' unequivocally demonstrate that the nucleus is the subcellular site where the entire process of pstv replication takes place. inhibition experiments with actinomycin d and alpha-amanitin furthermore suggest that the nuclear dna-dependent rna polymerases i and ii are involved in the synthesis of pstv (+) and (-) rna, respectively. | 1985 | 4016225 |
| unusual properties of two branched rna's with circular and linear components. | irradiation with ultraviolet light was used to create two nonlinear rna molecules. circular potato spindle tuber viroid (pstv) rna was crosslinked at a single site to generate a figure eight-shaped molecule; 5s rrna from hela cells was transformed into an alpha-shaped molecule with a small circular element and two arms (1). crosslinked rna's could be separated from their untreated counterparts by electrophoresis in polyacrylamide gels containing urea. the gel mobility of crosslinked pstv was not ... | 1985 | 2410857 |
| molecular cloning of potato spindle tuber viroid (pstv) cdna synthesized by enzymatic elongation of pstv-specific dna primers: a general strategy for viroid cloning. | different cdnas were synthesized by primer extension from the rna of the severe strain kf 440 of potato spindle tuber viroid (pstv) with the aid of reverse transcriptase using three pstv-specific dna molecules as primers. the cdnas were made double-stranded and cloned into plasmid pbr 322. various overlapping subgenomic dna fragments were prepared from these clones and recombined in two different ways. in both cases a pstv dna copy was obtained which represented the entire pstv rna genome. the s ... | 1985 | 2985143 |
| correlation between structure and pathogenicity of potato spindle tuber viroid (pstv). | sequence analysis by primer-extension at the level of their cdna showed that the rna genomes of various field isolates of potato spindle tuber viroid (pstv) of different virulence differ from each other only in a few nucleotides in two distinct regions of the rod-shaped molecule. despite insertions and deletions the chain length of 359 nucleotides is strictly conserved in all the isolates studied. thermodynamic calculations revealed that due to the observed sequence differences the region locate ... | 1985 | 15938051 |
| infectivity studies on different potato spindle tuber viroid (pstv) rnas synthesized in vitro with the sp6 transcription system. | we have constructed two sets of clones in which one to six head-to-tail connected dna copies of the potato spindle tuber viroid (pstv) rna genome were inserted into the plasmid psp62- pl downstream of the promoter for sp6 rna polymerase. in vitro transcription of these constructs with the promoter-specific sp6 rna polymerase yielded the corresponding oligomeric single-stranded linear pstv rna molecules of (+) and (-) polarity. except for short vector-derived terminal sequences these in vitro syn ... | 1985 | 15938052 |
| amino acid sequence of the ;pathogenesis-related' leaf protein p14 from viroid-infected tomato reveals a new type of structurally unfamiliar proteins. | we have established the complete sequence of the 130 amino acid residues of the pathogenesis-related (pr) protein p14 accumulating in tomato leaves infected with the viroid of the spindle tuber disease of potato (pstv) and partial sequences of the pr protein 1a which accumulates in tobacco mosaic virus-infected tobacco leaves. both pr proteins are closely related to each other. however, no homology could be found between the sequence of p14 and any of the 3061 published protein sequences compile ... | 1985 | 16453639 |
| cell-free synthesis and processing of an infectious dimeric transcript of potato spindle tuber viroid rna. | a full-length cloned cdna insert containing the sequence of potato spindle tuber viroid (pstv) was dimerized and placed in the plasmid vector psp65 adjacent to a promoter for bacteriophage sp6 rna polymerase. in vitro transcription of this region yielded a single linear rna chain 760 bases in length containing two copies of pstv rna with about 20 bases of vector sequence at each end. bioassay on tomato plants revealed that this transcript has infectivity comparable to that of pstv itself, yieldi ... | 1985 | 18639847 |
| in vivo encapsidation of potato spindle tuber viroid by velvet tobacco mottle virus particles. | when nicotiana clevelandii was inoculated simultaneously with velvet tobacco mottle virus (vtmov) and potato spindle tuber viroid (pstv), replication of the viroid was greatly suppressed. however, both pathogens replicated if pstv was inoculated several days before the vtmov. small amounts of pstv were detected by dot-blot analysis of rna in highly purified vtmov isolated from coinfected plants indicating that the viroid had been encapsidated by the virus particles. moreover, tomato plants which ... | 1986 | 18640657 |
| transfer of agrobacterium dna to plants requires a t-dna border but not the vire locus. | agrobacterium tumefaciens induces tumors in plants by transferring and integrating oncogenes (t-dna) into the chromosomes of host plant cells. agrobacterium strains were used to transfer complementary dna copies of a potato spindle tuber viroid (pstv) to plant cells at a wound site on tomato plant stems. subsequently, infectious viroid rna was found in the leaves of these plants, indicating systemic pstv infection. this process utilized the t-dna transfer mechanisms of agrobacterium since pstv i ... | 1986 | 17800798 |
| potato spindle tuber viroid infections mediated by the ti plasmid of agrobacterium tumefaciens. | full length copies of potato spindle tuber viroid (pstv) were introduced into plant cells using an agrobacterium tumefaciens vector. crown galls containing the pstv dna were induced on tomato plants, and the plants analysed for systemic replication of the viroid. two separately derived multimeric pstv insertions in the t-dna were infectious on every plant inoculated. however, monomeric pstv gave rise to significant levels of infection only when an adjacent plant promoter could direct transcripti ... | 1986 | 24307321 |
| site-specific mutagenesis of potato spindle tuber viroid cdna: : alterations within premelting region 2 that abolish infectivity. | the infectivity of cloned viroid cdnas permits investigation of structure/function relationships in these unusual pathogenic rnas by systematic site-specific mutagenesis of the cdnas and subsequent bioassay. we have used three different strategies to create nucleotide substitutions within premelting region 2, a region of potato spindle tuber viroid (pstv) believed to be important in viroid replication: sodium bisulfitecatalyzed deamination of deoxycytosine residues, oligonucleotide-directed muta ... | 1986 | 24307277 |
| use of [32p]rna probes for the dot-hybridization detection of potato spindle tuber viroid. | a dot-hybridization assay using 32p-labelled rna probes (+rna and crna) transcribed from potato spindle tuber viroid (pstv) cdna was described. a complete cdna copy of pstv, originally cloned in pbr 322 (pav 401) was subcloned in the bamhi site of a 'riboprobe' cloning vectors psp 64 and psp 65 in opposite orientations. the reconstructed plasmids were designated pdx 1 and pdx 4, respectively. transcription of pdx 1 and pdx 4 plasmids by sp6 rna polymerase resulted in the generation of pstv-speci ... | 1986 | 3025243 |
| viroids and virusoids are related to group i introns. | group i introns are found in nuclear rrna genes, mitochondrial mrna and rrna genes, and chloroplast trna genes. the hallmarks of this intron class are a 16-nucleotide consensus sequence and three sets of complementary sequences. the viroids (circular pathogenic plant rnas) and the virusoids (plant satellite rnas) also contain the consensus sequence and the three sets of complementary bases. pairing of the complementary bases would generate a viroid structure resembling a group i intron, which mi ... | 1986 | 3462692 |
| structure of viroid replicative intermediates: physico-chemical studies on sp6 transcripts of cloned oligomeric potato spindle tuber viroid. | the structure and structural transitions of transcripts of cloned oligomeric viroid were studied in physico-chemical experiments and stability calculations. transcripts of (+) and (-) polarity, from unit up to sixfold length, were synthesized from dna clones of the potato spindle tuber viroid (pstv) with the sp6 transcription system. their structural properties were investigated by optical denaturation curves, high performance liquid chromatography (hplc), electron microscopy, sedimentation-diff ... | 1986 | 3808953 |
| nucleotide sequence and secondary structure of apple scar skin viroid. | the complete nucleotide sequence of apple scar skin viroid(assv) has been established, and a probable secondary structure is proposed. a single-stranded circular assv rna consists of 330 nucleotides and can assume the rodlike conformation with extensive base-pairing characteristic of all the known viroids. assv shows low sequence homologies with other viroids and lacks the central conserved region. these indicate that assv should be allocated to a separate viroid group. however, homologous seque ... | 1987 | 3658673 |
| purified scrapie prions resist inactivation by uv irradiation. | the development of effective purification protocols has permitted evaluation of the resistance of isolated scrapie prions to inactivation by uv irradiation at 254 nm. prions were irradiated on ice with doses of uv light ranging up to 120,000 j/m2. uv dosimetry experiments, performed with saccharomyces cerevisiae plasmid dna or eucaryotic cells, indicated that under these experimental conditions an incident uv dose of 10 j/m2 formed 2 thymine dimers per 5.1 x 10(6) daltons of eucaryotic cell dna. ... | 1987 | 3097336 |
| purified scrapie prions resist inactivation by procedures that hydrolyze, modify, or shear nucleic acids. | prions were purified from scrapie-infected hamster brains and incubated for 24 hr at 65 degrees with 2 mm zn2+ or 5 mm mg2+; no loss of infectivity was observed. bacteriophage m13, tobacco mosaic virus (tmv), potato virus x, and potato spindle tuber viroid were all inactivated by divalent metal ions under these conditions. prions also resisted inactivation by prolonged digestions with dnase i, rnases a and t1, and micrococcal nuclease. prions were resistant to psoralen photoadduct formation usin ... | 1987 | 3114950 |
| the sequence of a viroid from grapevine closely related to severe isolates of citrus exocortis viroid. | the primary structure of a grapevine viroid (gvs) isolated in spain was determined. the sequence consisted of 369 nucleotide residues forming a circular molecule. gvs presented extensive homology with viroids of the potato spindle tuber viroid (pstv) group, that was specially high in the case of citrus exocortis viroid (cev) both with variants found in isolates inducing severe (92% with cev-a) and mild (89% with cev-de26) symptoms on tomato. the secondary structure proposed for gvs showed that t ... | 1987 | 2438653 |
| the nature and biological significance of linear potato spindle tuber viroid molecules. | "naturally occurring" linear potato spindle tuber viroid (pstvl) was shown to be as infectious as circular pstv (pstvc). the occurrence of pstvl was shown not to be (a) an artifact of the extraction procedure per se; (b) due to the presence of metal ions in extraction buffers; or (c) related to the host species used for propagation, to a particular pstv strain, or to the duration of infection. from labeling and blot-hybridization experiments, it was concluded that in infected tissue pstvc appear ... | 1987 | 18644556 |
| oligomeric potato spindle tuber viroid (pstv) rna does not process autocatalytically under conditions where other rnas do. | in vitro-synthesized oligomeric linear rnas representing the replicative intermediates of potato spindle tuber viroid (pstv) were subjected to a large variety of in vitro conditions where self-splicing of group i introns occurs, and where self-cleavage and self-circularization of the satellite rna from tobacco ringspot virus particles and self-cleavage of oligomeric forms of avocado sunblotch viroid rna has been observed. no evidence whatsoever could be obtained that the pstv rna oligomers monom ... | 1987 | 18644557 |
| potato spindle tuber viroid: investigation of the long-distance, intra-plant transport route. | potato spindle tuber viroid (pstv) could be detected in tomato plants by dot-blot hybridization as early as 6-7 days postinoculation (p.i.), approximately 1 week before the appearance of symptoms. the viroid was always first detectable in the shoot tip of the plant and in leaves that were very close to the tip, followed temporally by detection in leaves further from the tip down to and eventually including the inoculated leaf. although pstv also moved down to the roots, it did not move into leav ... | 1987 | 18644563 |
| mutational analysis of potato spindle tuber viroid reveals complex relationships between structure and infectivity. | viroids are single-stranded, covalently closed circular rna pathogens that can be isolated from certain higher plants afflicted with specific diseases. their small size (246-375 nucleotides; m(r) 0.8-1.3 x 10(5)) and ability to replicate autonomously make viroids a unique model system in which to study the relationships between the structure of an rna and its biological function. the demonstrated infectivity of certain cloned viroid cdnas allows the use of site-specific mutagenesis techniques to ... | 1987 | 16593846 |
| linear oligomeric potato spindle tuber viroid (pstv) rnas are accurately processed in vitro to the monomeric circular viroid proper when incubated with a nuclear extract from healthy potato cells. | a nuclear extract for the processing of oligomeric viroid rna in vitro has been prepared from nuclei isolated from healthy potato cells grown in suspension culture. linear rna molecules containing concatameric units of (+) or (-) strands, respectively, of the potato spindle tuber viroid (pstv) were synthesized in vitro with the aid of the sp6 rna polymerase and used as substrates for processing. when oligomeric linear pstv (+)rnas are incubated with the nuclear extract, monomeric linear molecule ... | 1987 | 16453784 |
| evidence for a single rolling circle in the replication of potato spindle tuber viroid. | we analyzed in vivo-labeled rna to determine which of the two proposed rolling-circle models is more likely to depict the replication cycle of potato spindle tuber viroid. a key feature distinguishing the two models is the presence of a circular monomeric minus strand in one and not the other. chromatography on cellulose cf11 was used to purify a fraction containing the replication intermediates free from single-stranded progeny. heat denaturation followed by gel electrophoresis was used to seek ... | 1988 | 16594003 |
| the 7s rna from tomato leaf tissue resembles a signal recognition particle rna and exhibits a remarkable sequence complementarity to viroids. | from tomato leaf tissue we sequenced and characterized a 7s rna which consists of 299 nucleotides with either two or three additional uridine nucleotides at its 3'-terminus. about 56% of the nucleotides of this higher plant 7s rna are in nearly identical positions as those of the human 7sl rna which is an integral component of the signal recognition particle (srp) that mediates protein translocation. computer modelling and digestion studies with nucleases led to a secondary structure model for t ... | 1988 | 2468486 |
| a novel aspect of the information content of viroids. | viroids were found to exhibit a structural periodicity characterized by repeat units of a length of 11 or 12 (potato spindle tuber viroid group and coconut cadang-cadang viroid), 60 (apple scar skin viroid) and 80 (avocado sunblotch viroid) nucleotide residues, respectively. it is suggested that structural periodicity of viroids is an indication of their protein-binding ability. | 1988 | 3167064 |
| coconut tinangaja viroid: sequence homology with coconut cadang-cadang viroid and other potato spindle tuber viroid related rnas. | the nucleotide sequence of two variants of coconut tinangaja viroid (ctiv) were obtained. both sequence variants are 254 nucleotide residues in size but differ in sequence at two positions. in comparisons with other viroids, the sequences and proposed secondary structure of ctiv show most homology with the 246 nucleotide residue variant of coconut cadang-cadang viroid (cccv (246]. several regions throughout the rod-like molecules of ctiv show significant structural and sequence homology with oth ... | 1988 | 3341120 |
| grapevine yellow speckle viroid: structural features of a new viroid group. | a single stranded circular rna was isolated from grapevines infected with yellow speckle disease. the rna which we have called grapevine yellow speckle viroid (gysv), contains 367 nucleotide residues and has the potential to form the rod-like secondary structure characteristic of viroids. gysv has 37% sequence homology with the recently described apple scar skin viroid (assv; 330 residues) and has some sequence homology with the viroids in the potato spindle tuber viroid (pstv) group. the sequen ... | 1988 | 3344221 |
| interference between coinoculated viroids. | experiments were carried out to seek evidence of an interaction between two viroid rnas introduced to tomato plants in the same inoculum. at the level of symptom expression, the severe isolate of potato spindle tuber viroid (pstv) dominated the mild isolate. seventy-five percent of the plants inoculated with a 100-fold excess of the mild isolate developed unattenuated symptoms of severe disease. other experiments revealed that infectious rna molecules transcribed from cloned dna templates contai ... | 1988 | 3354205 |
| synthetic oligonucleotide hybridization probes to diagnose hop stunt viroid strains and citrus exocortis viroid. | four species of synthetic oligonucleotide probes for the diagnosis of hop stunt viroid (hsv) and citrus exocortis viroid (cev) were devised. probe hsv-1 detected all the members of hsv group, such as hsv-hop, hsv-grapevine, hsv-cucumber, hsv-citrus and a viroid-like rna isolated from plum trees affected by plum dapple fruit disease. probe hsv-2 discriminated hsv-grapevine from the other members of hsv group. hsv-hop and hsv-grapevine consist of the same numbers of nucleotides, with only one nucl ... | 1988 | 3366851 |
| a method for assessing the statistical significance of rna folding. | we have developed a statistical method that is designed for analyzing potential rna folded substructures. the statistical significance of rna folding is assessed by the segment score. the segment score is defined as the difference between the lowest free energy calculated for the real biological sequence and the mean of the lowest free energies from random permutations of the real segment sequence, divided by the standard deviation of the random sample. this procedure was applied to the well-stu ... | 1989 | 2480496 |
| imaging of viroids in nuclei from tomato leaf tissue by in situ hybridization and confocal laser scanning microscopy. | the intracellular localization of viroids has been investigated by viroid-specific in situ hybridization and analysis by digital microscopy of the distribution of the fluorescent hybridization signals. isolated nuclei from green leaf tissue of tomato plants infected with potato spindle tuber viroid (pstvd) were bound to microscope slides, fixed with formaldehyde and hybridized with biotinylated transcripts of cloned pstvd cdna. the bound probe was detected with lissamine--rhodamine conjugated st ... | 1989 | 2591366 |
| nucleotide sequence and proposed secondary structure of columnea latent viroid: a natural mosaic of viroid sequences. | the columnea latent viroid (clv) occurs latently in certain columnea erythrophae plants grown commercially. in potato and tomato, clv causes potato spindle tuber viroid (pstv)-like symptoms. its nucleotide sequence and proposed secondary structure reveal that clv consists of a single-stranded circular rna of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. the electrophoretic mobility of circular clv under nondenaturing condit ... | 1989 | 2602114 |