Publications
| Title | Abstract | Year(sorted ascending) Filter | PMID Filter |
|---|
| submerse cultivation of the fungus metarrhizium anisopliae (metsch.). | 1965 | 14339691 | |
| toxins from the entomogenous fungus metarrhizium anisopliae. i. production in submerged and surface cultures, and in inorganic and organic nitrogen media. | 1966 | 5949415 | |
| toxins from the entomogenous fungus metarrhizium anisopliae. ii. symptoms and detection in moribund hosts. | 1966 | 5949416 | |
| oral infection of second-instar nymphs of schistocerca gregaria by metarrhizium anisopliae. | 1966 | 5949417 | |
| a selective medium for the isolation of beauveria tenella and of metarrhizium anisopliae. | 1966 | 5949419 | |
| the effect of certain insecticides on the entomogenous fungi beauveria bassiana and metarrhizium anisopliae. | 1967 | 6064157 | |
| pathogenicity of metarrhizium anisopliae, and other fungi, for five elaterids (coleoptera) in saskatchewan. | 1968 | 5716586 | |
| heterokaryosis in the entomogenous fungus, metarrhizium anisopliae. | 1971 | 5165096 | |
| metarrhizium anisopliae (metchinkoff) sorokin., and its host range. | 1971 | 5165180 | |
| fine structure of the fungus metarrhizium anisopliae infecting three species of larval elateridae (coleoptera). iv. development within the host. | 1971 | 4324208 | |
| ultrastructural changes in tissues of larval elateridae (coleoptera) infected with the fungus metarrhizium anisopliae. | 1971 | 4926798 | |
| a bacterium and dipterous parasite in wild populations of cowpea curculio larvae: effects of treatment with spores of metarrhizium anisopliae. | 1971 | 4930318 | |
| [physiological properties of the entomopathogenic fungus metarrhizium anisopliae (metch.) sor. development under submerge-surface culture]. | 1972 | 5077288 | |
| [the effect in vitro of the toxins of the mushroom metarrhizium anisopliae (metsch.) sorok. on the hemocytic reaction of oryctes rhinoceros l. (coleoptera)]. | the filtrate of metarhizium cultures contains toxic-substances inhibiting the process of formation of granuloma by oryctes in vitro. this inhibition results from marked alterations of both nucleus and cytoplasm of hemocytes under the action of the fungal toxins. | 1975 | 809180 |
| [detection of metarrhizium anisopliae (metsch.) sorokin (deuteromycetes, moniliales) fungus in larvae and pupae of horseflies in kazakhstan]. | 1975 | 129671 | |
| [fungus, metarrhizium anisopliae, as a possible regulator of the number of horseflies]. | in water bodies of the flood-plains of the ili and turgen rivers (alma-ata district) there were found larvae of tabanus autumnalis infected with the fungus metarrhizium anisopliae. experiments on the infection of t. autumnalis with this fungus yielded 100% mortality of larvae and adult insects. the possibility of creation of an artificial infection nidus under natural conditions was established. | 1976 | 134344 |
| age of three dipteran hosts as a factor governing the pathogenicity of beauveria bassiana and metarrhizium anisopliae. | 1977 | 908836 | |
| [nature of the parasite-host relations of the entomopathogenic fungi, metarrhizium anisopliae (metsch.) sorokin and beauveria bassiana (bals.) vouill. (fungi imperfecti) to ceratophyllus fasciatus bosc. (siphonaptera) fleas]. | 1978 | 567273 | |
| isolation of metarrhizium anisopliae, beauveria tenella and fusarium oxysporum (deuteromycetes) and their pathogenicity to culex fatigans and anopheles stephensi. | 1979 | 535971 | |
| [action of the fungus metarrhizium anisopliae metschnikoff on various species of triatominae (hemiptera, reduviidae)]. | 1982 | 6760352 | |
| a method for laboratory-scale mass cultivation of metarhizium anisopliae. | 1982 | 6890500 | |
| studies on the prolonged storage of metarhizium anisopliae conidia: effect of temperature and relative humidity on conidial viability and virulence against mosquitoes. | 1983 | 6841994 | |
| effect of formulation on the viability of metarhizium anisopliae conidia. | 1983 | 6841995 | |
| studies on the prolonged storage of metarhizium anisopliae conidia: effect of growth substrate on conidial survival and virulence against mosquitoes. | 1983 | 6841996 | |
| studies on the structure of a novel peptide antibiotic, k-582. | a novel peptide antibiotic, k-582, which exhibited significant growth inhibition of candida, viruses and ascites tumor in mice, was found in the culture medium of a strain of metarhizium anisopliae by kondo et al. (j. antibiotics 33, 535-542 (1980) ]. k-582 consisted of two components, designated k-582 a and k-582 b. threonine, tyrosine, ornithine, and an unusual amino acid were common in both peptides, but lysine was an extra component of k-582 a. the unusual amino acid was identified to be thr ... | 1983 | 6885240 |
| infectivity of a venezuelan strain of metarhizium anisopliae to aedes aegypti larvae. | 1984 | 6539354 | |
| peptide antibiotic k-582 production in relation to amino acid metabolism in metarrhizium anisopliae. | formation of the basic antibiotic, k-582 was stimulated by supplying metarrhizium anisopliae u-47 with several amino acids present in its structure. the addition of l-arginine to the basal medium resulted in the almost exclusive formation of k-582 b, while l-lysine increased k-582 a formation. some carbon sources were observed to have effects similar to those obtained with the above mentioned amino acids. furthermore, when l-arginine was added in excess to the basal medium, free gamma-hydroxyarg ... | 1984 | 6539767 |
| effect of soil fungistasis on zoopathogenic fungi. | the inhibiting action of west-siberian soils on spore germination and the growth and development of zoopathogenic fungi such as emmonsia (chrysosporium) crescens , trichophyton mentagrophytes, beauveria bassiana , metarrhizium anisopliae , paecilomyces farinosus , p. fumoso -roseus and chrysosporium keratinophilum have been studied by the authors. the influence of carbon sources and the root exudates of plants on fungistasis have also been studied. | 1984 | 6727979 |
| comparative studies of metarhizium anisopliae and tolypocladium cylindrosporum as pathogens of mosquito larvae. | mosquito fungal pathogens, metarhizium anisopliae and tolypocladium cylindrosporum, were compared with regard to virulence against the larvae of aedes aegypti, anopheles stephensi and culex pipiens. culex pipiens larvae were much more susceptible to m. anisopliae conidia than an. stephensi or ae. aegypti. but ae. aegypti and cx. pipiens larvae were equally susceptible to t. cylindrosporum propagules which weakly attack an. stephensi. using a high concentration conidial suspension (10(7) sp/ml) o ... | 1986 | 2906985 |
| [method of biological control of triatominae, vectors of chagas disease, using entomopathogenic hyphomycetes. preliminary study]. | bioassays determined the pathogenic activity of 14 strains of 5 entomopathogenic hyphomycetous species (fungi imperfecti), beauveria bassiana, beauveria brongniartii, metarhizium anisopliae, nomuraea rileyi and paecilomyces fumosoroseus to rhodnius prolixus. treatments consisted of direct spraying with conidial titrated suspensions on first instar larvae. when tested at 3 x 10(5) conidia/cm2, only 2 strains, b. bassiana n. 297 and b. bassiana n. 326 killed 100% of larvae at 10 days post-exposure ... | 1987 | 3111731 |
| [cytometric study of the effects of destruxin e on leukemic cells in mice]. | the activity of destruxin e, a cryptogamic toxin isolated from the hyphomycete metarhizium anisopliae, was studied on mouse leukemia cells (l 1210 and p 388) in culture. besides a cytotoxic effect, a cytostatic effect (increase of diploïd cells proportion) was observed with all doses for p 388 (from 10 micrograms/ml to 0.001 microgram/ml) and to a concentration of 0.1 microgram/ml for l 1210. at the lower doses, the effect on cellular dna content appears distinctly. | 1987 | 3121146 |
| distribution of chymoelastases and trypsin-like enzymes in five species of entomopathogenic deuteromycetes. | nine isolates of the entomopathogenic deuteromycetes metarhizium anisopliae, beauveria bassiana, verticillium lecanii, nomuraea rileyi, and aschersonia aleyrodis produced basic (pi greater than 7.0) chymoelastases that possessed extended binding sites, comprising at least four or five subsites, with preference for hydrophobic residues at the primary binding site. most isolates also produced additional acidic enzymes with similar specificities against ester and amide substrates but which lacked a ... | 1987 | 3310895 |
| characterization of cuticle-degrading proteases produced by the entomopathogen metarhizium anisopliae. | two chymoelastases and three trypsinlike proteases were separated from culture filtrates of the entomopathogen metarhizium anisopliae. a chymoelastase (pr1) (pi 10.3 mr 25,000) and trypsin (pr2) (pi 4.42, mr 28,500) were purified to homogeneity by ammonium sulphate precipitation, isoelectric focusing, and affinity chromatography. inhibition studies showed that both enzymes possessed essential serine and histidine residues in the active site. pr1 shows greater activity than pr2 or mammalian enzym ... | 1987 | 3545084 |
| compatibility of metarhizium anisopliae var. anisopliae with chemical pesticides. | the effects of various insecticides on the mycelial growth, sporulation and conidial germination of metarhizium anisopliae var. anisopliae isolate e9 were studied in the laboratory. chlorpyrifos was the most toxic organophosphate to mycelial growth and sporulation at all concentrations. temephos, malathion and leptophos were highly toxic to sporulation while malathion was the most inhibitory to germination. the carbamates, carbofuran, methomyl and oxamyl were moderately toxic to mycelial growth ... | 1987 | 3657906 |
| crystal and molecular structure of destruxin b. | the cyclic hexadepsipeptide mycotoxin destruxin b, produced by metarrhizium anisopliae, crystallizes in the orthorhombic space group p212121, with a = 11.010(2)a, b = 14.679(5)a, c = 21.273(7)a and z = 4. the structure was solved by direct methods and refined by least-squares technique to a final unweighted r value of 0.051, for 3361 reflections with i greater than 3 sigma (i). the backbone of the peptide is asymmetric and is made of 5 trans peptide and ester units and 1 cis peptide unit. the ba ... | 1988 | 3366552 |
| route of invasion and histopathology of metarhizium anisopliae in culex quinquefasciatus. | 1988 | 3418133 | |
| nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle. | the attachment of the conidia of the insect-pathogenic fungi nomuraea rileyi, beauveria bassiana, and metarrhizium anisopliae to insect cuticle was mediated by strong binding forces. the attachment was passive and nonspecific in that the conidia adhered readily to both host and nonhost cuticle preparations. the hydrophobicity of the conidial wall and the insect epicuticle appeared to mediate the adhesion process. detergents, solvents, and high-molecular-weight proteins known to neutralize hydrop ... | 1988 | 16347689 |
| novel gtp-binding proteins in plasma membranes of the fungus metarhizium anisopliae. | we report the existence of several families of gtp-binding proteins in plasma membranes of metarhizium anisopliae. two proteins (18.4 and 24 kda) resemble mammalian gn-proteins in their being toxin insensitive, binding [alpha-32p]gtp on nitrocellulose blots of sodium dodecyl sulfate (sds)-polyacrylamide gels, and also in their immunological properties. four other proteins (31-38.2 kda) were similar except that they did not bind [alpha-32p]gtp after treatment with sodium dodecyl sulfate. an 18.2 ... | 1989 | 2508639 |
| glossina morsitans morsitans: mortalities caused in adults by experimental infection with entomopathogenic fungi. | various strains of the entomopathogenic fungi: beauveria bassiana, metarhizium anisopliae, paecilomyces fumosoroseus and p. farinosus were found to be pathogenic for adult tsetse, glossina morsitans morsitans but b. bassiana and m. anisopliae were the most pathogenic, often causing mortalities of up to 100%. dose-mortality relationships were demonstrated for both b. bassiana and m. anisopliae and male tsetse were observed to be more susceptible to infection than females. pure cultures of b. bass ... | 1989 | 2565071 |
| [natural microbial control of crickets populations (orthoptera: gryllotalpidae: scapteriscus borellii): regulation of populations aggregated in time and space]. | from 1983 through 1988, a total of 1,762 collections, containing 31,312 individuals of the mole cricket, scapteriscus borellii, were made, principally in the state of são paulo, brazil. collections were found to fit a negative binomial distribution both as whole and when divided into monthly collections. in these collections, an iridovirus, a entomogenous nematode, and the fungi metarhizium anisopliae, beauveria bassiana, paecilomyces sp., and entomophtora sp., were found to be agents of natural ... | 1989 | 2640737 |
| virulence of entomogenous fungus metarhizium anisopliae var. anisopliae to aedes aegypti and aedes albopictus larvae. | 1990 | 2091906 | |
| increased abundance, size, and longevity of food-deprived mosquito populations exposed to a fungal larvicide. | to determine whether the quantity of food available to mosquitoes in their aquatic environment limits the effectiveness of microbial pathogens as biological control agents, experimentally well-nourished and malnourished larval aedes aegypti (linn.) were exposed to graded inocula of the entomopathogenic fungus, metarhizium anisopliae. first instar larvae were provided access either to 3 or to 5 mg of food, and lots from each food regimen were inoculated with 20, 40, 60, or 80 micrograms of fungal ... | 1990 | 2240376 |
| cloning and regulatory analysis of starvation-stress gene, ssga, encoding a hydrophobin-like protein from the entomopathogenic fungus, metarhizium anisopliae. | the nucleotide (nt) sequence of a starvation-stress gene (ssga) of the entomopathogenic fungus, metarhizium anisopliae, and its deduced amino acid (aa) sequence were determined. the primary structure of the ssga (96 aa; deduced m(r) = 9925; pi = 4.1) protein shares extensive similarities with fungal wall proteins of the 'hydrophobin' class, and the eight cys residues and putative signal sequences are conserved. secondary structure predictions suggest an additional resemblance to low-m(r) toxins ... | 1992 | 1398117 |
| use of a colorimetric system to detect enzymes expressed by germinating conidia of entomopathogenic fungi. | an apizym system, with 19 substrates, was used to detect enzymes expressed by germinating conidia of nomuraea rileyi (5 isolates), nomuraea atypicola, nomuraea anemonoides, beauveria bassiana and metarhizium anisopliae. similar enzyme profiles were obtained for two of the n. rileyi isolates (mississippi, ecuador) regardless of whether culture medium (sabouraud-maltose-yeast) or cuticle (from larvae of trichoplusia ni, heliothis zea or heliothis virescens) were used as substrates. centroid-cluste ... | 1992 | 1406899 |
| effect of some natural pesticides on entomogenous muscardine fungi. | five commercial preparations of natural pesticides were tested for in vitro compatibility with muscardine fungi, beauveria brongniartii and metarhizium anisopliae. neemark (azadirachtin) was found compatible with both the fungi. phytoallexin, the natural fungicide, significantly inhibited the growth of both the fungi, while other natural pesticides showed moderate to severe inhibition. | 1992 | 1459622 |
| molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus metarhizium anisopliae. | the proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. we report here the isolation and characterization of a cdna clone of the cuticle-degrading protease (pr1) of metarhizium anisopliae. the cdna sequence revealed that pr1 is synthesized as a large precursor (40.3 kda) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kda. the primary structu ... | 1992 | 1551399 |
| in vitro effect of fungal cyclodepsipeptides on leukemic cells: study of destruxins a, b and e. | the activities of three mycotoxins isolated from the hyphomycete metarhizium anisopliae: destruxin a, b, and e (da, db and de) are described and compared in vitro on leukemic cells. their antitumor effect was investigated by flow cytometry on growth, cell viability and cell cycle perturbation 48 h after destruxin exposure. against p388 leukemic cells, de displayed greater antiproliferative activity than da and db. the minimum concentration required to inhibit 50% of cell proliferation is 0.33 mi ... | 1992 | 1628110 |
| detection of molecular variation in the insect pathogenic fungus metarhizium using rapd-pcr. | dna polymorphism among isolates of the insect pathogenic fungus metarhizium anisopliae and m. flavoviride was investigated by rapd-pcr. dna fragments of between 0.3 and 2.7 kb were obtained using eight 10-mer pcr primers of arbitrary nucleotide sequence, and each isolate differed in the size and number of rapd products, indicating considerable polymorphism. isolate-specific rapd fingerprints were used to calculate relative genetic similarity; this differentiated isolates into two major groups, s ... | 1993 | 8224797 |
| random amplified polymorphic dna markers reveal a high degree of genetic diversity in the entomopathogenic fungus metarhizium anisopliae var. anisopliae. | metarhizium anisopliae isolates from several insect hosts and from various sugar cane growing areas of queensland, australia, were examined for genetic diversity using random amplified polymorphic dna (rapd) markers. thirty isolates of m. anisopliae var. anisopliae and one isolate of m. anisopliae var. majus were examined. ten randomly chosen 10mer or 11mer primers were used and rapd banding patterns were compared. thirty distinct genotypes could be distinguished amongst the 31 isolates tested o ... | 1993 | 8245834 |
| biosynthesis of destruxins. | l-[me-13c]-methionine, sodium [2-13c]acetate and sodium [1,2-13c]acetate were incorporated into destruxins a, b and e by the entomopathogenic fungus metarhizium anisopliae. nmr analysis established that methionine is involved in the n-methylation of l-valine and l-alanine, and that one intact acetate unit participates in the biosynthesis of the -ch(oh)-cooh fragment of the hydroxy acid moiety. the presence of two acetate units in proline and isoleucine agrees with the accepted biochemical scheme ... | 1993 | 7763948 |
| analysis of aminopeptidase and dipeptidylpeptidase iv from the entomopathogenic fungus metarhizium anisopliae. | analytical and preparative isoelectric focusing were used to separate extracellular isoenzymes of aminopeptidase (pi 4.51, m(r) 45,000, ph optimum 7.0) and prolyl-dipeptidylpeptidase (pi 4.01, m(r) 74,000, ph optimum 8.0) produced by the entomopathogenic fungus metarhizium anisopliae during growth on locust cuticle. production of both activities is repressed by readily utilized nitrogen sources, but unlike the aminopeptidase, the dipeptidylpeptidase was also excreted at high levels during growth ... | 1993 | 8094738 |
| identification of molecular variants in mitochondrial dnas of members of the genera beauveria, verticillium, paecilomyces, tolypocladium, and metarhizium. | a set of five mitochondrial (mt) probes derived from a strain of beauveria bassiana was used to evaluate the similarity of mtdnas from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. the probes and genes encoded for (shown in parentheses) were pbbmte2 (nadi, atp6), pbbmte3 (atp6, small rrna [srrna]), pbbmte4 (srrna, co3, nad6), pbbse1 (nad6, trna, large rrna [lrrna]), and pbbxs1 (lrrna). the probes produced identical hybridization patterns in ecori-digested ... | 1993 | 16349124 |
| at least three genes are responsible for benomyl-resistance in metarhizium anisopliae. | four benomyl-resistant mutants isolated from metarhizium anisopliae were 10 to 500 times more resistant than the original mt strain. the resistance markers analysed in three of these mutants were due to three different mutations and no additive effect of these genes was observed in double mutants. the four mutants presented normal conidiation in the presence or absence of benomyl and no sensitivity or resistance to temperature. probably m. anisopliae has a mechanism of benomyl resistance differi ... | 1994 | 8127229 |
| partial characterization of specific inducers of a cuticle-degrading protease from the insect pathogenic fungus metarhizium anisopliae. | the insect pathogenic fungus metarhizium anisopliae produces several extracellular cuticle-degrading proteases and evidence is consistent with one of these, pr1, which is a chymoelastase, being a determinant of pathogenicity. we have shown previously that pr1 production is regulated by both carbon catabolite and nitrogen metabolite repression and also by specific induction under derepressed conditions by insect cuticle. in the present work we have established that an enzymically released protein ... | 1994 | 7812455 |
| laboratory evaluation of six species of entomopathogenic fungi for the control of the house fly (musca domestica l.), a pest of intensive animal units. | the effectiveness of six species of entomopathogenic fungi for the control of adult and larval stages of the house fly musca domestica was assessed in the laboratory. metarhizium anisopliae and tolypocladium cylindrosporum were the pathogens most virulent to house fly larvae. tolypocladium cylindrosporum prevented adult emergence at doses of 1 x 10(8), 10(7), 10(6), and 10(5) conidia/ml, and m. anisopliae prevented emergence at 1 x 10(8) and 10(7) conidia/ml, with only 1.0 and 16% emergence at 1 ... | 1994 | 7963644 |
| characterization of a novel carboxypeptidase produced by the entomopathogenic fungus metarhizium anisopliae. | preparative isoelectric focusing and gel filtration chromatography were used to purify a carboxypeptidase produced by the entomopathogenic fungus metarhizium anisopliae during growth on cockroach cuticle. the enzyme was inhibited by diisopropyl fluorophosphate, implying involvement of a serine residue in catalysis. however, the m. anisopliae enzyme differed from most serine carboxypeptidases in also being inhibited by the metal chelator 1,10-phenanthroline and in being a small (30 kda), basic (p ... | 1994 | 7979380 |
| isoforms of the cuticle-degrading pr1 proteinase and production of a metalloproteinase by metarhizium anisopliae. | the entomopathogenic fungus, metarhizium anisopliae, produces three distinct types of proteinases during growth on cockroach cuticle. these were separated by analytical isoelectric focusing and characterized according to their substrate specificity and inhibition patterns as pr1 subtilisin-like proteinases (four isoforms pi range approximately 9.3-10.2), a thermolysin-like metalloproteinase (pi approximately 7.3), and trypsin-like serine pr2 proteinases (two major isoforms, pi approximately 4.4 ... | 1994 | 8053668 |
| differentiation of species and strains of entomopathogenic fungi by random amplification of polymorphic dna (rapd). | polymerase chain reaction (pcr)-based technology, involving random amplification of polymorphic dna (rapd), was used to assess the genomic variability between 24 isolates of deuteromycetous fungi (metarhizium anisopliae, metarhizium flavoviride, unidentified strains of metarhizium and beauveria bassiana) which were found to infect grasshoppers or locusts. m. flavoviride showed little intraspecific variability in pcr-amplified fragments when compared to m. anisopliae. the high level of variabilit ... | 1994 | 8087878 |
| sequential product-ion spectra (ms3) with array detection and reaction-intermediate scanning of a cyclopeptide on a five-sector mass spectrometer. | a new strategy, based on sequential product-ion spectra (ms2 and ms3) and reaction-intermediate scanning (ms3), provides a rapid and unambiguous sequence determination of e-destruxin, a cyclodepsipeptidic toxin from metarrhizium anisopliae fungus. | 1994 | 7696704 |
| the subtilisins of the invertebrate mycopathogens verticillium chlamydosporium and metarhizium anisopliae are serologically and functionally related. | the major extracellular proteases from the nematophagous fungus verticillium chlamydosporium and the entomophagous fungus metarhizium anisopliae, vcp1 and pr1, respectively, are closely related both functionally and serologically. antibodies raised against either enzyme cross-reacted with both antigens, suggesting that they have common epitopes. the vcp1 and pr1 antisera labelled bovine pancreatic elastase and proteinase k, respectively. neither antiserum reacted with commercial chymotrypsin. an ... | 1995 | 7729666 |
| cuticle degrading proteases from insect moulting fluid and culture filtrates of entomopathogenic fungi. | insects degrade their own cuticle during moulting, a process which is catalysed by a complex mixture of enzymes. entomopathogenic fungi infect the insect host by penetration of the cuticle, utilizing enzymatic and/or physical mechanisms. protein is a major component of insect cuticle and a major recyclable resource for the insect and, therefore, represents a significant barrier to the invading fungus. to this end, both insects and entomopathogenic fungi produce a variety of cuticle degrading pro ... | 1995 | 7749618 |
| the novel desmethyldestruxin b2, from metarhizium anisopliae, that suppresses hepatitis b virus surface antigen production in human hepatoma cells. | we have examined the antiviral activity of a crude extract prepared from the culture medium of the fungus metarhizium anisopliae. eight active destruxins were identified which showed strong suppressive effect on the production of the hepatitis b surface antigen (hbsag) in human hepatoma hep3b cells. one new compound, desmethyldestruxin b2 [1], was isolated from m. anisopliae. this structure was determined based on its nmr and mass spectral data. | 1995 | 7623030 |
| cloning of a cuticle-degrading protease from the entomopathogenic fungus, beauveria bassiana. | a beauveria bassiana extracellular subtilisin-like serine endoprotease is a potential virulence factor by virtue of its activity against insect cuticles. a cdna clone of the protease was isolated from mycelia of b. bassiana grown on cuticle/chitin cultures. the amino acid sequence of this gene was compared to that of metarhizium anisopliae pr1, the only pathogenicity determinant so far described from an entomopathogenic fungus, and proteinase k, isolated from tritirachium album, a saprophytic fu ... | 1995 | 7875568 |
| an inner cell wall protein (cwp1) from conidia of the entomopathogenic fungus beauveria bassiana. | following the removal of the rodlet layer from aerial or submerged conidia of the entomopathogenic deuteromycetous fungus beauveria bassiana, sds-insoluble, formic-acid-extractable proteins were found in the residual cell wall material. two major proteins (12.8 and 14.0 kda) were extracted with formic acid from fractured aerial and submerged conidia but not from blastospores. oxidation of the sample extracted by formic acid resulted in a single protein band (15.4 kda) as judged by sds-page. anti ... | 1995 | 7773402 |
| manipulation of intracellular glycerol and erythritol enhances germination of conidia at low water availability. | the insect pathogens beauveria bassiana, metarhizium anisopliae and paecilomyces farinosus can be effective biocontrol agents when relative humidity (rh) is close to 100%. at reduced water availability, germination of propagules, and therefore host infection, cannot occur. cultures of b. bassiana, m. anisopliae and p. farinosus were grown under different conditions to obtain conidia with a modified polyol and trehalose content. conidia with higher intracellular concentrations of glycerol and ery ... | 1995 | 7773406 |
| cloning and characterisation of a gene encoding a cuticle-degrading protease from the insect pathogenic fungus metarhizium anisopliae. | metarhizium anisophilae (ma) secretes a range of proteases when grown in vitro on insect cuticle. a trypsin-like serine protease, pr2, was purified from culture filtrates by anion exchange chromatography and the n-terminal sequence determined. using oligodeoxyribonucleotide probes based on this sequence and that of the highly conserved trypsin active site, a gene was isolated from a lambda embl3 genomic library of ma isolate me1. sequencing of the gene and rt-pcr revealed that the gene contains ... | 1995 | 8529882 |
| biocontrol potential of the entomogenous fungi beauveria bassiana and metarhizium anisopliae for tsetse flies (glossina spp.) at developmental sites. | spores of two entomogenous fungi, beauveria bassiana and metarhizium anisopliae, were mixed with sterile sand at two different concentrations (1.0 and 0.5 g/liter) and larvae of tsetse flies glossina morsitans morsitans allowed to pupate in it, simulating field larviposition sites. one gram weight of b. bassiana-sand mixture was estimated to contain 1.4 x 10(6) spores/g and that of m. anisopliae-sand mixture 2.3 x 10(6) spores/g. adult tsetse emerging from pupae in sand-spore mixtures suffered h ... | 1995 | 8568279 |
| construction of an improved mycoinsecticide overexpressing a toxic protease. | mycoinsecticides are being used for the control of many insect pests as an environmentally acceptable alternative to chemical insecticides. a key aim of much recent work has been to increase the speed of kill and so improve commercial efficacy of these biocontrol agents. this might he achieved by adding insecticidal genes to the fungus, an approach considered to have enormous potential for the improvement of biological pesticides. we report here the development of a genetically improved entomopa ... | 1996 | 8692818 |
| high frequency gene conversion among benomyl resistant transformants in the entomopathogenic fungus metarhizium anisopliae. | three different methods, (i) peg, (ii) electroporation and (iii) biolistic, were employed to transform metarhizium anisopliae using benomyl resistance as a selectable marker. transformation frequencies and mitotic stability varied for each method, from 0.8 to 6.9 transformants micrograms-1 of dna and 46%, respectively, by the peg method; 1.3 to 1.8 transformants micrograms-1 of dna and 67% by electroporation; and 32 to 201 transformants micrograms-1 of dna and 90% by biolistic. we demonstrate by ... | 1996 | 8759798 |
| prospects for biological control of livestock ticks, rhipicephalus appendiculatus and amblyomma variegatum, using the entomogenous fungi beauveria bassiana and metarhizium anisopliae. | both beauveria bassiana and metarhizium anisopliae induced approximately 30% mortalities in adult rhipicephalus appendiculatus feeding on rabbits while m. anisopliae induced a mortality of 37% in adult amblyomma variegatum. both fungal species induced reductions in engorgement weights, fecundity, and egg hatchability in adult a. variegatum. m. anisopliae reduced fecundity by 94% in a. variegatum. furthermore, b. bassiana reduced egg hatchability to 0%, while 11% of the infected females failed to ... | 1996 | 8812559 |
| identification and differentiation of the entomopathogenic fungus beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis. | a series of genomic dna probes which exhibit specificity for beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal dna (hegedus and khachatourians, 1993a). to improve the sensitivity of a dna-based monitoring system for detection of this entomopathogenic fungus we have developed a pcr-based method. using sequence information from a region of the b. bassiana-specific probe pbb22, primers p1 (5'aagcttcgacatggtctg) and p3 (5ggaggtggtgaggttctgtt) were generated. th ... | 1996 | 8812610 |
| effects of destruxins, cyclic depsipeptide mycotoxins, on calcium balance and phosphorylation of intracellular proteins in lepidopteran cell lines. | the influence of the destruxin e, cyclodepsipeptidic mycotoxin produced by the filamentous entomopathogenic fungus metarhizium anisopliae, on calcium fluxes and protein phosphorylation of in vitro cultivated lepidopteran cell lines have been studied. the use of the fluorescent calcium indicator fura 2 am did not show a fast increase in the level of cytosolic calcium in lepidopteran and human cell lines treated with dtx e. in contrast, 45ca+2 assays detected a late but significant calcium influx ... | 1996 | 8856960 |
| biochemical characterization and ultrastructural localization of two extracellular trypsins produced by metarhizium anisopliae in infected insect cuticles. | proteinase 2 (pr2) is a fungal (metarhizium anisopliae) serine proteinase which has a tryptic specificity for basic residues and which may be involved in entomopathogenicity. analytical and preparative isoelectric focusing methods were used to separate two trypsin components, produced during growth on cockroach cuticle, with isoelectric points of 4.4 (molecular mass, 30 kda) and 4.9 (27 kda). the catalytic properties of the proteases were analyzed by their kinetic constants and by a combination ... | 1996 | 8919786 |
| study of structure-activity correlation in destruxins, a class of cyclodepsipeptides possessing suppressive effect on the generation of hepatitis b virus surface antigen in human hepatoma cells. | a new destruxin [destruxin e2 chlorohydrin] was isolated from the culture medium of metarrhizium anisopliae and its structure was determined by nmr spectroscopy and mass spectrometry. as compared with other destruxins, the new destruxin showed a lower suppressive activity on the production of hepatitis b virus surface antigen in human hepatoma hep3b cells. nmr study coupled with molecular modeling by computer graphics has revealed that the hydrophobicity nature of the convex surface characterist ... | 1996 | 8954084 |
| cloning and sequence analysis of an intron-containing domain from a peptide synthetase-encoding gene of the entomopathogenic fungus metarhizium anisopliae. | a gene encoding a putative peptide synthetase has been cloned and partially sequenced from the filamentous fungus, metarhizium anisopliae. the deduced amino acid sequence of one entire domain and the following spacer is typical of fungal peptide synthetases, showing good conservation of the six expected core sequences. there are two introns within this region, the first interrupting core 5 (rldltdie) of the domain and the second in a conserved area of the spacer region. | 1996 | 8964498 |
| characterization and ultrastructural localization of chitinases from metarhizium anisopliae, m. flavoviride, and beauveria bassiana during fungal invasion of host (manduca sexta) cuticle. | extracellular chitinases have been suggested to be virulence factors in fungal entomopathogenicity. we employed isoelectric focusing and a set of three fluorescent substrates to investigate the numbers and types of chitinolytic enzymes produced by the entomopathogenic fungi metarhizium anisopliae, metarhizium flavoviride, and beauveria bassiana. each species produced a variety of n-acetyl-(beta)-d-glucosaminidases and endochitinases during growth in media containing insect cuticle. m. flavovirid ... | 1996 | 16535278 |
| culture age, temperature, and ph affect the polyol and trehalose contents of fungal propagules. | the growth and conidial physiology of the entomopathogenic fungi beauveria bassiana, metarhizium anisopliae, and paecilomyces farinosus were studied under different conditions. the effects of culture age (up to 120 days), temperature (5 to 35(deg)c), and ph (2.9 to 11.1) were determined. growth was optimal at ph 5 to 8 for each isolate and between 20 and 35(deg)c, depending on the isolate. the predominant polyol in conidia was mannitol, with up to 39, 134, and 61 mg g of conidia(sup-1) for b. ba ... | 1996 | 16535354 |
| characterization and functional analysis of 12 naturally occurring reactive site variants of serpin-1 from manduca sexta. | serpin gene-1 from the tobacco hornworm, manduca sexta, encodes, through alternative exon usage, 12 reactive site variants (jiang, h., wang, y. and kanost, m. r., (1994) j. biol. chem. 269, 55-58; jiang, h., wang, y., huang, y., mulnix, a. b., kadel, j., cole, k., and kanost, m. r. (1996) j. biol. chem. 271, 28017-28023). these 43-kda proteins differ from each other only in their cooh-terminal 39-46 residues, which include the reactive site. to test the hypothesis that these proteins are protein ... | 1997 | 8995406 |
| attachment of metarhizium anisopliae to the southern green stink bug nezara viridula cuticle and fungistatic effect of cuticular lipids and aldehydes. | in this paper we examined the conidial attachment of metarhizium anisopliae on the southern green stink bug, nezara viridula, using the exuvia and nymphal stage of the host as a substrate for m. anisopliae conidiospores. initial studies using fluorescein isothiocyanate (fitc)-labeled conidia examined the differential binding of conidia to various sites on the cuticle. both the topography and the chemistry of the cuticle affected conidial adhesion. conidia were trapped in areas containing large n ... | 1997 | 9028925 |
| the effect of humidity on germination and infection of termites by the hyphomycete, metarhizium anisopliae. | the effect of relative humidities (r.h.) from 90 to 100% on germination of a termite-active isolate of metarhizium anisopliae (isolate fi25 and fi610) was studied using a liquid germinating medium to which the appropriate amount of glycerol had been added. germination was increasingly delayed at water activities equivalent to 99, 98, and 96% r.h. and completely inhibited at 94, 92, and 90%. twenty-one isolates were then screened for germination at 96 and 100% r.h. all isolates showed delayed ger ... | 1997 | 9028930 |
| virulence of metarhizium anisopliae to embryos of the grass shrimp palaemonetes pugio | experiments were performed in which developing embryos of the grass shrimp, palaemonetes pugio, were exposed to conidiospores of the insect pathogenic fungus, metarhizium anisopliae. responses were variable, with significant (p </= 0.05) adverse effects observed in five of six experiments conducted. dead embryos and larvae with visible growth of m. anisopliae were observed in all experiments. growth of m. anisopliae was occasionally observed on embryos and larvae prior to death. delayed hatch wa ... | 1997 | 9056466 |
| 28s rdna group-i introns: a powerful tool for identifying strains of beauveria brongniartii. | the nuclear ribosomal dna of the entomopathogenic fungus beauveria brongniartii is polymorphic in terms of both restriction site and length. insertions of 350-450 bp long, identified as group-i introns, were detected in the 28s rdna. a panel of 47 strains of b. brongniartii, two b. bassiana and one metarhizium anisopliae of various geographical and biological origins were found to contain 14 variant forms of intron differing in size and restriction pattern, at four different positions. twelve ty ... | 1997 | 9131812 |
| adaptation of proteases and carbohydrates of saprophytic, phytopathogenic and entomopathogenic fungi to the requirements of their ecological niches. | the abilities of isolates of saprophytes (neurospora crassa, aspergillus nidulans), an opportunistic human pathogen (aspergillus fumigatus), an opportunistic insect pathogen (aspergillus flavus), plant pathogens (verticillium albo-atrum, verticillium dahliae, nectria haematococca), a mushroom pathogen (verticillium fungicola) and entomopathogens (verticillium lecanii, beauveria bassiana, metarhizium anisopliae) to utilize plant cell walls and insect cuticle components in different nutrient media ... | 1997 | 9202474 |
| carbon regulation of the cuticle-degrading enzyme pr1 from metarhizium anisopliae may involve a trans-acting dna-binding protein crr1, a functional equivalent of the aspergillus nidulans crea protein. | the pr1 gene of the entomopathogenic fungus metarhizium anisopliae encodes a serine protease that is highly active towards the insect cuticle and whose synthesis is subject to both carbon and nitrogen repression. the pr1 promoter region was sequenced revealing the presence of putative crea- and area-binding sites. in vitro bandshift experiments demonstrated that an aspergillus nidulans gst-crea fusion protein was capable of binding to two of the three putative crea sites. using a pcr-based strat ... | 1997 | 9211795 |
| entomopathogenous fungi degrade epicuticular hydrocarbons of triatoma infestans. | studies were undertaken to analyze the ability of entomopathogenous fungi to degrade insect hydrocarbons. strains of beauveria bassiana and metarhizium anisopliae pathogenic to the blood-sucking bug triatoma infestans were grown on hydrocarbon and non-hydrocarbon insect lipid extracts and on synthetic hydrocarbon-enriched media as the sole carbon source. entomopathogenous fungi were shown to utilize hydrocarbons as the only carbon source for their growth. insect-derived hydrocarbons served more ... | 1997 | 9244399 |
| analysis of swainsonine and its early metabolic precursors in cultures of metarhizium anisopliae. | the alpha-mannosidase inhibitor swainsonine is produced by the filamentous fungus metarhizium anisopliae. the primary metabolite pathway from which it is derived is known to be that leading to lysine. in order to effect improvements in the yield of swainsonine it is of interest to study the changes in the intracellular levels of lysine and its biosynthetic intermediates, as well as swainsonine itself, which accompany changes in culture conditions or in the genetics of the microbe. czapek-dox def ... | 1997 | 9298701 |
| isolation of a cdna encoding a novel subtilisin-like protease (pr1b) from the entomopathogenic fungus, metarhizium anisopliae using differential display-rt-pcr. | reverse transcription differential display pcr (rt-dd-pcr) was used to identify genes that are specifically expressed by metarhizium anisopliae when it contacts the host insect cuticle. using a homology-based subtilisin-like protease primer we identified a hitherto unsuspected differentially expressed subtilisin-like protease (pr1b) encoding gene. the deduced amino acid sequence shows 54% similarity to the well characterized pr1a subtilisin of m. anisopliae and karyotype analysis revealed that p ... | 1997 | 9332344 |
| pathogenicity of the entomopathogenic fungus metarhizium anisopliae (deuteromycetes) to ixodes scapularis (acari: ixodidae). | the entomopathogenic fungus metarhizium anisopliae is highly pathogenic to the black-legged tick, ixodes scapularis. spore concentrations of 10(8)/ml for engorged larvae and 10(7)/ml for engorged females resulted in 100% tick mortality, 2 wk postinfection. the lc50 value for engorged larvae (concentration to kill 50% of ticks) was 10(7) spores/ml. metarhizium anisopliae shows considerable potential as a microbial control agent for the management of ixodes scapularis. | 1997 | 9379283 |
| fungal keratitis caused by metarhizium anisopliae var. anisopliae. | metarhizium anisopliae var. anisopliae (metschnikov) sorokin 1883 to our knowledge has never been reported as an agent of human or animal mycosis. this fungus has great importance as an agent of biological control of different pests and mosquito larvae in colombia. it has been isolated as the aetiological agent of keratomycosis for the first time from the eye of a colombian male. | 1997 | 9402530 |
| effects of the entomopathogenic fungus metarhizium anisopliae and its secondary metabolites on morphology and cytoskeleton of plasmatocytes isolated from the greater wax moth, galleria mellonella. | the effects of metarhizium anisopliae infection and three different secondary metabolites released by the fungus, destruxin a and e and cytochalasin d, on the morphology and cytoskeleton of plasmatocytes of the greater wax moth galleria mellonella were studied. plasmatocytes isolated from m. anisopliae infected larvae exhibited impairment of attachment, spreading and cytoskeleton formation accompanied with the occurrence of blebbing and pycnotic nuclei. plasmatocytes treated with destruxin in vi ... | 1997 | 12770487 |
| [variability in esterases of metarhizium anisopliae]. | the variability in esterases of the entomogenous fungus metarhizium anisopliae was determined electrophoretically on 8.5% polyacrylamide gel. ten isolates from diverse taxonomic groups of insects were analyzed. the electrophoretic analysis showed differences and similarities between these isolates and it was possible to distinguish six different patterns. the results obtained show a great polymorphism for the esterase system of m. anisopliae. | 1997 | 15482022 |
| effect of temperature on vegetative growth among isolates of metarhizium anisopliae and m. flavoviride. | effects of temperature on vegetative growth on a semi-synthetic medium of 22 isolates of metarhizium anisopliae and 14 isolates of m. flavoviride were determined. the majority of isolates of both species grew between 11 and 32 degrees c; several isolates grew at 8 and 37 degrees c. none of the isolates grew at 40 degrees c. relative growth rate, calculated from the maximum growth rate for each isolate, was significantly affected by temperature and isolate, with significant isolate * temperature ... | 1997 | 16284806 |
| destruxin ed1 a cyclopeptide from the fungus metarhizium anisopliae. | a new destruxin ed1 has been isolated from the entomopathogenic fungus metarhizium anisopliae. its structure was deduced from the nmr and mass spectral data. | 1998 | 9862142 |
| effect of ph on physiology of metarhizium anisopliae for production of swainsonine. | the effect of ph on the production of swainsonine and fungal morphology at different stages of fermentation of metarhizium anisopliae was investigated. when no control was applied, the ph of the culture dropped from 6.5 to 3.8 within the first 72 hours and the concentration of swainsonine reached 43.3 mg 1(-1). when the ph was held constant either at the beginning or throughout the fermentation, the maximum recorded swainsonine level was only 8.4 mg 1(-1) corresponding with an increase in the fo ... | 1998 | 9867471 |
| ambient ph is a major determinant in the expression of cuticle-degrading enzymes and hydrophobin by metarhizium anisopliae. | secretion of proteolytic and chitinolytic enzymes is a hallmark of infection processes of metralhizium anisopliae in response to host (insect) cuticular signals. the regulation of these enzymes (subtilisin-like proteases [pr1a and pr1b], trypsin-like proteases [pr2], metalloproteases, aspartyl proteases, aminopeptidase, and chitinases) and a hydrophobin was investigated by northern analysis and/or enzyme assay. the production of each enzyme showed a differential expression pattern in response to ... | 1998 | 9464412 |
| cloning and phylogenetic analysis of chitin synthase genes from the insect pathogenic fungus, metarhizium anisopliae var. anisopliae. | degenerated pcr primers were used to amplify chitin synthase genes from genomic dna of metarhizium anisopliae var. anisopliae. through cloning and sequencing of approximately 600-bp fragments amplified by pcr, we found three genes encoding different types of chitin synthases, designated machs1, machs2, and machs3. southern blot analysis performed on genomic dna showed that each of the chitin synthases machs1, machs2, and machs3 is encoded by a single copy gene. alignment of their deduced amino a ... | 1998 | 9485597 |
| laboratory and field studies on the infection of stink bugs, nezara viridula, piezodorus guildinii, and euschistus heros (hemiptera: pentatomidae) with metarhizium anisopliae and beauveria bassiana in brazil | isolates of metarhizium anisopliae (cnpso-ma12) and beauveria bassiana (cnpso-bb56) were tested under field conditions as biological control agents of soybean stink bugs (nezara viridula, piezodorus guildinii, and euschistus heros). kaolin-based powder formulations of m. anisopliae or b. bassiana were applied to soybean plots at a rate of 1.5 x 10(13) conidia per ha. after treatment, field cages (0.25 m2) were placed in plots and stink bug adults were introduced into the cages. mycosis for both ... | 1998 | 9500941 |
| effects of metarhizium anisopliae on the tick boophilus microplus (acari: ixodidae) in stabled cattle. | 1998 | 9500942 | |
| group specific antibodies against the putative amp-binding domain signature sgttgxpkg in peptide synthetases and related enzymes. | the superfamily of adenylate forming enzymes including peptide synthetases, acyl-coa synthetases and insect luciferases is readily identified by the signature sequence sgttgxpkg. this sequence including an invariant lysyl residue is located in a disordered loop region and was predicted to be of significant antigenicity. antibodies were generated employing ytsgttgrpkgc attached to bovine serum albumin and have been successfully used to identify respective enzymes and adenylate forming domains in ... | 1998 | 9530507 |
| rapid screening of destruxins by liquid chromatography/mass spectrometry. | a liquid chromatographic/mass spectrometric (lc/ms) method utilizing an atmospheric pressure chemical ionization (apci) interface and in-source collisionally induced dissociation (cid) was developed for the rapid screening of the cyclic hexadepsipeptides destruxins, produced by the fungi metarhizium anisopliae and trichothecium roseum. the apci mass spectra are fully consistent with the high-energy cid data but the sequence ions are abundant over the whole mass range. in addition to 22 known des ... | 1998 | 9538526 |