Publications

TitleAbstractYear
Filter
PMID(sorted descending)
Filter
molecular epidemiology, evolution and phylogeny of sars coronavirus.shortly after its emergence in southern china in 2002/2003, severe acute respiratory syndrome coronavirus (sars-cov) was confirmed to be the cause of sars. subsequently, sars-related covs (sarsr-covs) were found in palm civets from live animal markets in guangdong and in various horseshoe bat species, which were believed to be the ultimate reservoir of sarsr-cov. till november 2018, 339 sarsr-cov genomes have been sequenced, including 274 from human, 18 from civets and 47 from bats [mostly from ...201930844511
molecular epidemiology, evolution and phylogeny of sars coronavirus.shortly after its emergence in southern china in 2002/2003, severe acute respiratory syndrome coronavirus (sars-cov) was confirmed to be the cause of sars. subsequently, sars-related covs (sarsr-covs) were found in palm civets from live animal markets in guangdong and in various horseshoe bat species, which were believed to be the ultimate reservoir of sarsr-cov. till november 2018, 339 sarsr-cov genomes have been sequenced, including 274 from human, 18 from civets and 47 from bats [mostly from ...201930844511
viruses in bats and potential spillover to animals and humans.in the last two decades, several high impact zoonotic disease outbreaks have been linked to bat-borne viruses. these include sars coronavirus, hendra virus and nipah virus. in addition, it has been suspected that ebolaviruses and mers coronavirus are also linked to bats. it is being increasingly accepted that bats are potential reservoirs of a large number of known and unknown viruses, many of which could spillover into animal and human populations. however, our knowledge into basic bat biology ...201930665189
structure of interferon-stimulated gene product 15 (isg15) from the bat species myotis davidii and the impact of interdomain isg15 interactions on viral protein engagement.bats have long been observed to be the hosts and the origin of numerous human diseases. bats, like all mammals, rely on a number of innate immune mechanisms to combat invading pathogens, including the interferon type i, ii and iii responses. ubiquitin-like interferon-stimulated gene product 15 (isg15) is a key modulator of these interferon responses. within these pathways, isg15 can serve to stabilize host proteins modulating innate immune responses and act as a cytokine. post-translational modi ...201930644842
tmprss2 contributes to virus spread and immunopathology in the airways of murine models after coronavirus infection.transmembrane serine protease tmprss2 activates the spike protein of highly pathogenic human coronaviruses such as severe acute respiratory syndrome-related coronavirus (sars-cov) and middle east respiratory syndrome-related coronavirus (mers-cov). in vitro, activation induces virus-cell membrane fusion at the cell surface. however, the roles of tmprss2 during coronavirus infection in vivo are unclear. here, we used animal models of sars-cov and mers-cov infection to investigate the role of tmpr ...201930626688
sars-like coronavirus wiv1-cov does not replicate in egyptian fruit bats (rousettus aegyptiacus).severe acute respiratory syndrome (sars)-like wiv1-coronavirus (cov) was first isolated from rhinolophus sinicus bats and can use the human angiotensin converting enzyme 2 (ace2) receptor. in the current study, we investigate the ability of wiv1-cov to infect rousettus aegyptiacus bats. no clinical signs were observed throughout the experiment. furthermore, only four oropharyngeal swabs and two respiratory tissues, isolated on day 3 post inoculation, were found positive for viral rna. two out of ...201830572566
recent advances in aiv biosensors composed of nanobio hybrid material.since the beginning of the 2000s, globalization has accelerated because of the development of transportation systems that allow for human and material exchanges throughout the world. however, this globalization has brought with it the rise of various pathogenic viral agents, such as middle east respiratory syndrome coronavirus (mers-cov), severe acute respiratory syndrome coronavirus (sars-cov), zika virus, and dengue virus. in particular, avian influenza virus (aiv) is highly infectious and cau ...201830544883
bioaerosol sampling for respiratory viruses in singapore's mass rapid transit network.as a leading global city with a high population density, singapore is at risk for the introduction of novel biological threats. this risk has been recently reinforced by human epidemics in singapore of sars coronavirus, 2009 pandemic h1n1 influenza a virus, and enterovirus 71. other major threats to singapore include mers-coronavirus and various avian and swine influenza viruses. the ability to quickly identify and robustly track such threats to initiate an early emergency response remains a sig ...201830504827
attenuation of replication by a 29 nucleotide deletion in sars-coronavirus acquired during the early stages of human-to-human transmission.a 29 nucleotide deletion in open reading frame 8 (orf8) is the most obvious genetic change in severe acute respiratory syndrome coronavirus (sars-cov) during its emergence in humans. in spite of intense study, it remains unclear whether the deletion actually reflects adaptation to humans. here we engineered full, partially deleted (-29 nt), and fully deleted orf8 into a sars-cov infectious cdna clone, strain frankfurt-1. replication of the resulting viruses was compared in primate cell cultures ...201830310104
the papain-like protease determines a virulence trait that varies among members of the sars-coronavirus species.sars-coronavirus (cov) is a zoonotic agent derived from rhinolophid bats, in which a plethora of sars-related, conspecific viral lineages exist. whereas the variability of virulence among reservoir-borne viruses is unknown, it is generally assumed that the emergence of epidemic viruses from animal reservoirs requires human adaptation. to understand the influence of a viral factor in relation to interspecies spillover, we studied the papain-like protease (plp) of sars-cov. this key enzyme drives ...201830248143
structurally- and dynamically-driven allostery of the chymotrypsin-like proteases of sars, dengue and zika viruses.coronavirus 3c-like and flavivirus ns2b-ns3 proteases utilize the chymotrypsin fold to harbor their catalytic machineries but also contain additional domains/co-factors. over the past decade, we aimed to decipher how the extra domains/co-factors mediate the catalytic machineries of sars 3c-like, dengue and zika ns2b-ns3 proteases by characterizing their folding, structures, dynamics and inhibition with nmr, x-ray crystallography and md simulations, and the results revealed: 1) the chymotrypsin f ...201930217495
genomic characterization and infectivity of a novel sars-like coronavirus in chinese bats.sars coronavirus (sars-cov), the causative agent of the large sars outbreak in 2003, originated in bats. many sars-like coronaviruses (sl-covs) have been detected in bats, particularly those that reside in china, europe, and africa. to further understand the evolutionary relationship between sars-cov and its reservoirs, 334 bats were collected from zhoushan city, zhejiang province, china, between 2015 and 2017. pcr amplification of the conserved coronaviral protein rdrp detected coronaviruses in ...201830209269
complemented palindromic small rnas first discovered from sars coronavirus.in this study, we report for the first time the existence of complemented palindromic small rnas (cpsrnas) and propose that cpsrnas and palindromic small rnas (psrnas) constitute a novel class of small rnas. the first discovered 19-nt cpsrna uuaacaagcuuguuaaaga, named sars-cov-cpsr-19, was detected from a 22-bp dna complemented palindrome tctttaacaagcttgttaaaga in the severe acute respiratory syndrome coronavirus (sars-cov) genome. the phylogenetic analysis supported that this dna complemented p ...201830189613
sars-coronavirus open reading frame-3a drives multimodal necrotic cell death.the molecular mechanisms underlying the severe lung pathology that occurs during sars-cov infections remain incompletely understood. the largest of the sars-cov accessory protein open reading frames (sars 3a) oligomerizes, dynamically inserting into late endosomal, lysosomal, and trans-golgi-network membranes. while previously implicated in a non-inflammatory apoptotic cell death pathway, here we extend the range of sars 3a pathophysiologic targets by examining its effects on necrotic cell death ...201830185776
cryo-em structure of the sars coronavirus spike glycoprotein in complex with its host cell receptor ace2.the trimeric sars coronavirus (sars-cov) surface spike (s) glycoprotein consisting of three s1-s2 heterodimers binds the cellular receptor angiotensin-converting enzyme 2 (ace2) and mediates fusion of the viral and cellular membranes through a pre- to postfusion conformation transition. here, we report the structure of the sars-cov s glycoprotein in complex with its host cell receptor ace2 revealed by cryo-electron microscopy (cryo-em). the complex structure shows that only one receptor-binding ...201830102747
the impacts on health, society, and economy of sars and h7n9 outbreaks in china: a case comparison study.epidemics such as sars and h7n9 have caused huge negative impacts on population health and the economy in china.201830050581
[advances in the animal models of mers-cov].the middle east respiratory syndrome coronavirus (mers-cov) was first isolated in 2012 from patients that died from severe pneumonia. it was another coronavirus which resulted in severe infection of humans, apart from the severe acute respiratory syndrome coronavirus. the development of an appropriate animal model is necessary to study the pathogenesis and to evaluate the intervening measures against mers-cov infection. to date, several small animals(e.g., mice, syrian hamsters, and ferrets) hav ...201629963837
transcriptional and translational landscape of equine torovirus.the genus torovirus (subfamily torovirinae, family coronaviridae, order nidovirales) encompasses a range of species that infect domestic ungulates, including cattle, sheep, goats, pigs, and horses, causing an acute self-limiting gastroenteritis. using the prototype species equine torovirus (etov), we performed parallel rna sequencing (rna-seq) and ribosome profiling (ribo-seq) to analyze the relative expression levels of the known torovirus proteins and transcripts, chimeric sequences produced v ...201829950409
structural model of the sars coronavirus e channel in lmpg micelles.coronaviruses (cov) cause common colds in humans, but are also responsible for the recent severe acute, and middle east, respiratory syndromes (sars and mers, respectively). a promising approach for prevention are live attenuated vaccines (lavs), some of which target the envelope (e) protein, which is a small membrane protein that forms ion channels. unfortunately, detailed structural information is still limited for sars-cov e, and non-existent for other cov e proteins. herein, we report a stru ...201829474890
disulfiram can inhibit mers and sars coronavirus papain-like proteases via different modes.severe acute respiratory syndrome coronavirus (sars-cov) emerged in southern china in late 2002 and caused a global outbreak with a fatality rate around 10% in 2003. ten years later, a second highly pathogenic human cov, mers-cov, emerged in the middle east and has spread to other countries in europe, north africa, north america and asia. as of november 2017, mers-cov had infected at least 2102 people with a fatality rate of about 35% globally, and hence there is an urgent need to identify antiv ...201829289665
pathogen genomic surveillance elucidates the origins, transmission and evolution of emerging viral agents in china.in the past twenty years, numerous novel zoonotic viral agents with pandemic potential have emerged in china, such as the severe acute respiratory syndrome (sars) coronavirus and, more recently, the avian-origin influenza a/h7n9 virus, which have caused outbreaks among humans with high morbidity and mortality. in addition, several emerging and re-emerging viral pathogens have also been imported into china from travelers, e.g. the middle east respiratory syndrome (mers) coronavirus and zika virus ...201729270793
routes of transmission of influenza a h1n1, sars cov, and norovirus in air cabin: comparative analyses.identifying the exact transmission route(s) of infectious diseases in indoor environments is a crucial step in developing effective intervention strategies. in this study, we proposed a comparative analysis approach and built a model to simulate outbreaks of 3 different in-flight infections in a similar cabin environment, that is, influenza a h1n1, severe acute respiratory syndrome (sars) coronavirus (cov), and norovirus. the simulation results seemed to suggest that the close contact route was ...201829244221
absence of infection in asymptomatic contacts of index sars case in france.the first case of severe acute respiratory syndrome (sars) in france was diagnosed in march 2003. we conducted a serological survey to assess whether or not asymptomatic persons who had been in contact with this patient during his infectious stage had been infected. they were interviewed and asked to provide a blood sample for sars coronavirus immunoglobulin g antibody testing. despite the likely high infectivity of the sars patient, no asymptomatic sars infection was found in any of the 37 cont ...200629208086
discovery of a rich gene pool of bat sars-related coronaviruses provides new insights into the origin of sars coronavirus.a large number of sars-related coronaviruses (sarsr-cov) have been detected in horseshoe bats since 2005 in different areas of china. however, these bat sarsr-covs show sequence differences from sars coronavirus (sars-cov) in different genes (s, orf8, orf3, etc) and are considered unlikely to represent the direct progenitor of sars-cov. herein, we report the findings of our 5-year surveillance of sarsr-covs in a cave inhabited by multiple species of horseshoe bats in yunnan province, china. the ...201729190287
quality assurance for the diagnostics of viral diseases to enhance the emergency preparedness in europe.the threat posed by emerging and re-emerging communicable diseases and, more recently, by the intentional release of infectious agents in a susceptible population, has been receiving considerable attention at the national and international levels. public health efforts to strengthen disease detection, surveillance and control have been intensified. however, clinicians and clinical microbiology laboratories play an important role in the early detection of disease, the identification of the putati ...200529183474
cross-neutralization of sars coronavirus-specific antibodies against bat sars-like coronaviruses. 201729134417
distribution and evolutionary history of the mobile genetic element s2m in coronaviruses.the mobile genetic element s2m has been described in several families of single-stranded rna viruses. the function remains elusive, but an increasing number of s2m-containing sequences are being deposited in publicly available databases. currently, more than 700 coronavirus sequences containing s2m can be found in genbank, including the severe acute respiratory syndrome (sars) coronavirus genome. this is an updated review of the pattern of s2m in coronaviruses, the possible functional implicatio ...201628933407
a novel chemical compound for inhibition of sars coronavirus helicase.we have discovered a novel chemical compound, (e)-3-(furan-2-yl)-n-(4-sulfamoylphenyl) acrylamide, that suppresses the enzymatic activities of sars coronavirus helicase. to determine the inhibitory effect, atp hydrolysis and double-stranded dna unwinding assays were performed in the presence of various concentrations of the compound. through these assays, we obtained ic50 values of 2.09 ± 0.30 µm (atp hydrolysis) and 13.2 ± 0.9 µm (dna unwinding), respectively. moreover, we found that the compou ...201728910865
in silico analysis of the cyanobacterial lectin scytovirin: new insights into binding properties.scytovirin is a lectin isolated from the cyanobacterium scytonema varium that has shown activity against hiv, sars coronavirus and zaire ebola virus. its 95 amino acids are divided into two structural domains (sd), the first spanning amino acids 1-48 (sd1) and the second 49-95 (sd2). interestingly, the domains are nearly identical but differ in their affinities for carbohydrates. with the aim of enhancing understanding of the binding properties of scytovirin, we performed molecular dynamics (md) ...201728756560
comprehensive structural analysis of designed incomplete polypeptide chains of the replicase nonstructural protein 1 from the severe acute respiratory syndrome coronavirus.the cotranslational folding is recognized as a very cooperative process that occurs after the nearly completion of the polypeptide sequence of a domain. here we investigated the challenges faced by polypeptide segments of a non-vectorial β-barrel fold. besides the biological interest behind the sars coronavirus non-structural protein 1 (nsp1, 117 amino acids), this study model has two structural features that motivated its use in this work: 1- its recombinant production is dependent on the tempe ...201728750053
two-amino acids change in the nsp4 of sars coronavirus abolishes viral replication.infection with coronavirus rearranges the host cell membrane to assemble a replication/transcription complex in which replication of the viral genome and transcription of viral mrna occur. although coexistence of nsp3 and nsp4 is known to cause membrane rearrangement, the mechanisms underlying the interaction of these two proteins remain unclear. we demonstrated that binding of nsp4 with nsp3 is essential for membrane rearrangement and identified amino acid residues in nsp4 responsible for the i ...201728738245
role of fomites in sars transmission during the largest hospital outbreak in hong kong.the epidemic of severe acute respiratory syndrome (sars) had a significant effect on global society in the early 2000s and the potential of its resurgence exists. studies on the modes of transmission of sars are limited though a number of outbreak studies have revealed the possible airborne route. to develop more specific and effective control strategies, we conducted a detailed mechanism-based investigation that explored the role of fomite transmission in the well-known ward 8a outbreak. we con ...201728727803
kanyawara virus: a novel rhabdovirus infecting newly discovered nycteribiid bat flies infesting previously unknown pteropodid bats in uganda.bats are natural reservoir hosts of highly virulent pathogens such as marburg virus, nipah virus, and sars coronavirus. however, little is known about the role of bat ectoparasites in transmitting and maintaining such viruses. the intricate relationship between bats and their ectoparasites suggests that ectoparasites might serve as viral vectors, but evidence to date is scant. bat flies, in particular, are highly specialized obligate hematophagous ectoparasites that incidentally bite humans. usi ...201728706276
toward the identification of viral cap-methyltransferase inhibitors by fluorescence screening assay.two highly pathogenic human coronaviruses associated with severe respiratory syndromes emerged since the beginning of the century. the severe acute respiratory syndrome sars-coronavirus (cov) spread first in southern china in 2003 with about 8000 infected cases in few months. then in 2012, the middle east respiratory syndrome (mers-cov) emerged from the arabian peninsula giving a still on-going epidemic associated to a high fatality rate. covs are thus considered a major health threat. this is e ...201728676301
discovery of a highly divergent coronavirus in the asian house shrew from china illuminates the origin of the alphacoronaviruses.although shrews are one of the largest groups of mammals little is known about their role in the evolution and transmission of viral pathogens including coronaviruses. we captured 266 asian house shrews (suncus murinus) in jiangxi and zhejiang provinces, china, during 2013-2015. coronavirus (cov) rna was detected in 24 asian house shrews, with an overall prevalence of 9.02%. complete viral genome sequences were successfully recovered from the rna positive samples. the newly discovered shrew cov ...201728637760
this could be the start of something big-20 years since the identification of bats as the natural host of hendra virus.hendra virus was first described in 1994 in australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the brisbane suburb of hendra. this year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes) as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. they included animal and public health experts, environmental scientists, veterin ...201528616459
targeting endosomal acidification by chloroquine analogs as a promising strategy for the treatment of emerging viral diseases.emerging viruses such as hiv, dengue, influenza a, sars coronavirus, ebola, and other viruses pose a significant threat to human health. majority of these viruses are responsible for the outbreaks of pathogenic lethal infections. to date, there are no effective therapeutic strategies available for the prophylaxis and treatment of these infections. chloroquine analogs have been used for decades as the primary and most successful drugs against malaria. concomitant with the emergence of chloroquine ...201728596841
allelic variation in the toll-like receptor adaptor protein ticam2 contributes to sars-coronavirus pathogenesis in mice.host genetic variation is known to contribute to differential pathogenesis following infection. mouse models allow direct assessment of host genetic factors responsible for susceptibility to severe acute respiratory syndrome coronavirus (sars-cov). based on an assessment of early stage lines from the collaborative cross mouse multi-parent population, we identified two lines showing highly divergent susceptibilities to sars-cov: the resistant cc003/unc and the susceptible cc053/unc. we generated ...201728592648
sars-unique fold in the rousettus bat coronavirus hku9.the coronavirus nonstructural protein 3 (nsp3) is a multifunctional protein that comprises multiple structural domains. this protein assists viral polyprotein cleavage, host immune interference, and may play other roles in genome replication or transcription. here, we report the solution nmr structure of a protein from the "sars-unique region" of the bat coronavirus hku9. the protein contains a frataxin fold or double-wing motif, which is an α + β fold that is associated with protein/protein int ...201728580734
optimization of the production process and characterization of the yeast-expressed sars-cov recombinant receptor-binding domain (rbd219-n1), a sars vaccine candidate.from 2002 to 2003, a global pandemic of severe acute respiratory syndrome (sars) spread to 5 continents and caused 8000 respiratory infections and 800 deaths. to ameliorate the effects of future outbreaks as well as to prepare for biodefense, a process for the production of a recombinant protein vaccine candidate is under development. previously, we reported the 5 l scale expression and purification of a promising recombinant sars vaccine candidate, rbd219-n1, the 218-amino acid residue receptor ...201728456726
sars coronavirus papain-like protease up-regulates the collagen expression through non-samd tgf-β1 signaling.sars coronavirus (cov) papain-like protease (plpro) reportedly induced the production of tgf-β1 through p38 mapk/stat3-meidated egr-1-dependent activation (sci. rep. 6, 25754). this study investigated the correlation of plpro-induced tgf-β1 with the expression of type i collagen in human lung epithelial cells and mouse pulmonary tissues. specific inhibitors for tgf-βri, p38 mapk, mek, and stat3 proved that sars-cov plpro induced tgf-β1-dependent up-regulation of type i collagen in vitro and in v ...201728414040
basic scholarship in biosafety is critically needed to reduce risk of laboratory accidents.our firm conducted a risk/benefit assessment of "gain-of-function" research, as part of the deliberative process following a u.s. moratorium on the research (u.s. department of health and human services, u.s. government gain-of-function deliberative process and research funding pause on selected gain-of-function research involving influenza, mers, and sars viruses, 2014). due to significant missing but theoretically acquirable data, our biosafety assessment faced limitations, and we were forced ...201728405626
the role of epidermal growth factor receptor (egfr) signaling in sars coronavirus-induced pulmonary fibrosis.many survivors of the 2003 outbreak of severe acute respiratory syndrome (sars) developed residual pulmonary fibrosis with increased severity seen in older patients. autopsies of patients that died from sars also showed fibrosis to varying extents. pulmonary fibrosis can be occasionally seen as a consequence to several respiratory viral infections but is much more common after a sars coronavirus (sars-cov) infection. given the threat of future outbreaks of severe coronavirus disease, including m ...201728390872
viral rewiring of cellular lipid metabolism to create membranous replication compartments.positive-strand rna (+rna) viruses (e.g. poliovirus, hepatitis c virus, dengue virus, sars-coronavirus) remodel cellular membranes to form so-called viral replication compartments (vrcs), which are the sites where viral rna genome replication takes place. to induce vrc formation, these viruses extensively rewire lipid metabolism. disparate viruses have many commonalities as well as disparities in their interactions with the host lipidome and accumulate specific sets of lipids (sterols, glyceroph ...201728242560
the severe acute respiratory syndrome coronavirus nucleocapsid inhibits type i interferon production by interfering with trim25-mediated rig-i ubiquitination.severe acute respiratory syndrome (sars) is a respiratory disease, caused by a coronavirus (sars-cov), that is characterized by atypical pneumonia. the nucleocapsid protein (n protein) of sars-cov plays an important role in inhibition of type i interferon (ifn) production via an unknown mechanism. in this study, the sars-cov n protein was found to bind to the spry domain of the tripartite motif protein 25 (trim25) e3 ubiquitin ligase, thereby interfering with the association between trim25 and r ...201728148787
surveillance of bat coronaviruses in kenya identifies relatives of human coronaviruses nl63 and 229e and their recombination history.bats harbor a large diversity of coronaviruses (covs), several of which are related to zoonotic pathogens that cause severe disease in humans. our screening of bat samples collected in kenya from 2007 to 2010 not only detected rna from several novel covs but, more significantly, identified sequences that were closely related to human covs nl63 and 229e, suggesting that these two human viruses originate from bats. we also demonstrated that human cov nl63 is a recombinant between nl63-like viruses ...201728077633
characterization and phylogenetic analysis of new bat astroviruses detected in gabon, central africa.astroviruses are emerging rna viruses that cause enteropathogenic infections in humans and in other mammals. the identification of astroviruses in a wide range of animals highlights the zoonotic importance of these viruses. bats can harbor many different viruses, among which some are highly pathogenic for humans (for instance, nipah, ebola and sars coronavirus), and also several astroviruses. as some rna viruses can be directly transmitted from bats to humans, it is crucial to collect data about ...201727928918
a mouse model for mers coronavirus-induced acute respiratory distress syndrome.middle east respiratory syndrome coronavirus (mers-cov) is a novel virus that emerged in 2012, causing acute respiratory distress syndrome (ards), severe pneumonia-like symptoms and multi-organ failure, with a case fatality rate of ∼36%. limited clinical studies indicate that humans infected with mers-cov exhibit pathology consistent with the late stages of ards, which is reminiscent of the disease observed in patients infected with severe acute respiratory syndrome coronavirus. models of mers-c ...201627892925
sars-cov fusion peptides induce membrane surface ordering and curvature.viral membrane fusion is an orchestrated process triggered by membrane-anchored viral fusion glycoproteins. the s2 subunit of the spike glycoprotein from severe acute respiratory syndrome (sars) coronavirus (cov) contains internal domains called fusion peptides (fp) that play essential roles in virus entry. although membrane fusion has been broadly studied, there are still major gaps in the molecular details of lipid rearrangements in the bilayer during fusion peptide-membrane interactions. here ...201627892522
t-cell immunity of sars-cov: implications for vaccine development against mers-cov.over 12 years have elapsed since severe acute respiratory syndrome (sars) triggered the first global alert for coronavirus infections. virus transmission in humans was quickly halted by public health measures and human infections of sars coronavirus (sars-cov) have not been observed since. however, other coronaviruses still pose a continuous threat to human health, as exemplified by the recent emergence of middle east respiratory syndrome (mers) in humans. the work on sars-cov widens our knowled ...201727840203
alisporivir inhibits mers- and sars-coronavirus replication in cell culture, but not sars-coronavirus infection in a mouse model.currently, there is no registered treatment for infections with emerging zoonotic coronaviruses like sars- and mers-coronavirus. we here report that in cultured cells low-micromolar concentrations of alisporivir, a non-immunosuppressive cyclosporin a-analog, inhibit the replication of four different coronaviruses, including mers- and sars-coronavirus. ribavirin was found to further potentiate the antiviral effect of alisporivir in these cell culture-based infection models, but this combination t ...201727840112
cathepsin l helps to defend mice from infection with influenza a.host-derived proteases can augment or help to clear infections. this dichotomy is exemplified by cathepsin l (ctsl), which helps hendra virus and sars coronavirus to invade cells, but is essential for survival in mice with mycoplasma pneumonia. the present study tested the hypothesis that ctsl protects mice from serious consequences of infection by the orthomyxovirus influenza a, which is thought to be activated by host-supplied proteases other than ctsl. ctsl-/- mice infected with influenza a/p ...201627716790
a bat-derived putative cross-family recombinant coronavirus with a reovirus gene.the emergence of severe acute respiratory syndrome coronavirus (sars-cov) in 2002 and middle east respiratory syndrome coronavirus (mers-cov) in 2012 has generated enormous interest in the biodiversity, genomics and cross-species transmission potential of coronaviruses, especially those from bats, the second most speciose order of mammals. herein, we identified a novel coronavirus, provisionally designated rousettus bat coronavirus gccdc1 (ro-batcov gccdc1), in the rectal swab samples of rousett ...201627676249
the effect of inhibition of pp1 and tnfα signaling on pathogenesis of sars coronavirus.the complex interplay between viral replication and host immune response during infection remains poorly understood. while many viruses are known to employ anti-immune strategies to facilitate their replication, highly pathogenic virus infections can also cause an excessive immune response that exacerbates, rather than reduces pathogenicity. to investigate this dichotomy in severe acute respiratory syndrome coronavirus (sars-cov), we developed a transcriptional network model of sars-cov infectio ...201627663205
identification of a lineage d betacoronavirus in cave nectar bats (eonycteris spelaea) in singapore and an overview of lineage d reservoir ecology in se asian bats.coronaviruses are a diverse group of viruses that infect mammals and birds. bats are reservoirs for several different coronaviruses in the alphacoronavirus and betacoronavirus genera. they also appear to be the natural reservoir for the ancestral viruses that generated the severe acute respiratory syndrome coronavirus and middle east respiratory syndrome coronavirus outbreaks. here, we detected coronavirus sequences in next-generation sequence data created from eonycteris spelaea faeces and urin ...201627637887
immunodominant sars coronavirus epitopes in humans elicited both enhancing and neutralizing effects on infection in non-human primates.severe acute respiratory syndrome (sars) is caused by a coronavirus (sars-cov) and has the potential to threaten global public health and socioeconomic stability. evidence of antibody-dependent enhancement (ade) of sars-cov infection in vitro and in non-human primates clouds the prospects for a safe vaccine. using antibodies from sars patients, we identified and characterized sars-cov b-cell peptide epitopes with disparate functions. in rhesus macaques, the spike glycoprotein peptides s471-503, ...201627627203
immunodominant sars coronavirus epitopes in humans elicited both enhancing and neutralizing effects on infection in non-human primates.severe acute respiratory syndrome (sars) is caused by a coronavirus (sars-cov) and has the potential to threaten global public health and socioeconomic stability. evidence of antibody-dependent enhancement (ade) of sars-cov infection in vitro and in non-human primates clouds the prospects for a safe vaccine. using antibodies from sars patients, we identified and characterized sars-cov b-cell peptide epitopes with disparate functions. in rhesus macaques, the spike glycoprotein peptides s471-503, ...201627627203
pains and gains from china's experiences with emerging epidemics: from sars to h7n9.over the recent decades, china experienced several emerging virus outbreaks including those caused by the severe acute respiratory syndrome- (sars-) coronavirus (cov), h5n1 virus, and h7n9 virus. the sars tragedy revealed faults in china's infectious disease prevention system, propelling the chinese government to enact reforms that enabled better combating of the subsequent h1n1 and h7n9 avian flu epidemics. the system is buttressed by three fundamental, mutually reinforcing components: (1) endu ...201627525272
p53 down-regulates sars coronavirus replication and is targeted by the sars-unique domain and plpro via e3 ubiquitin ligase rchy1.highly pathogenic severe acute respiratory syndrome coronavirus (sars-cov) has developed strategies to inhibit host immune recognition. we identify cellular e3 ubiquitin ligase ring-finger and chy zinc-finger domain-containing 1 (rchy1) as an interacting partner of the viral sars-unique domain (sud) and papain-like protease (pl(pro)), and, as a consequence, the involvement of cellular p53 as antagonist of coronaviral replication. residues 95-144 of rchy1 and 389-652 of sud (sud-nm) subdomains ar ...201627519799
abelson kinase inhibitors are potent inhibitors of severe acute respiratory syndrome coronavirus and middle east respiratory syndrome coronavirus fusion.the highly pathogenic severe acute respiratory syndrome coronavirus (sars-cov) and middle east respiratory syndrome coronavirus (mers-cov) cause significant morbidity and morality. there is currently no approved therapeutic for highly pathogenic coronaviruses, even as mers-cov is spreading throughout the middle east. we previously screened a library of fda-approved drugs for inhibitors of coronavirus replication in which we identified abelson (abl) kinase inhibitors, including the anticancer dru ...201627466418
antibody-dependent enhancement of sars coronavirus infection and its role in the pathogenesis of sars. 201627390007
sars coronavirus fusion peptide-derived sequence suppresses collagen-induced arthritis in dba/1j mice.during the co-evolution of viruses and their hosts, the viruses have evolved numerous strategies to counter and evade host antiviral immune responses in order to establish a successful infection, replicate and persist in the host. recently, based on our model of immune signaling, the signaling chain homooligomerization (school) model, we suggested specific molecular mechanisms used by different viruses such as severe acute respiratory syndrome coronavirus (sars-cov) to modulate the host immune r ...201627349522
sars and mers: recent insights into emerging coronaviruses.the emergence of middle east respiratory syndrome coronavirus (mers-cov) in 2012 marked the second introduction of a highly pathogenic coronavirus into the human population in the twenty-first century. the continuing introductions of mers-cov from dromedary camels, the subsequent travel-related viral spread, the unprecedented nosocomial outbreaks and the high case-fatality rates highlight the need for prophylactic and therapeutic measures. scientific advancements since the 2002-2003 severe acute ...201627344959
infectious bronchitis coronavirus limits interferon production by inducing a host shutoff that requires accessory protein 5b.during infection of their host cells, viruses often inhibit the production of host proteins, a process that is referred to as host shutoff. by doing this, viruses limit the production of antiviral proteins and increase production capacity for viral proteins. coronaviruses from the genera alphacoronavirus and betacoronavirus, such as severe acute respiratory syndrome coronavirus (sars-cov), establish host shutoff via their nonstructural protein 1 (nsp1). the gammacoronavirus and deltacoronavirus ...201627279618
the proteome of the infectious bronchitis virus beau-r virion.infectious bronchitis is a highly contagious respiratory disease of poultry caused by the coronavirus infectious bronchitis virus (ibv). it was thought that coronavirus virions were composed of three major viral structural proteins until investigations of other coronaviruses showed that the virions also include viral non-structural and genus-specific accessory proteins as well as host-cell proteins. to study the proteome of ibv virions, virus was grown in embryonated chicken eggs, purified by su ...201527257648
recognition of lys48-linked di-ubiquitin and deubiquitinating activities of the sars coronavirus papain-like protease.deubiquitinating enzymes (dubs) recognize and cleave linkage-specific polyubiquitin (polyub) chains, but mechanisms underlying specificity remain elusive in many cases. the severe acute respiratory syndrome (sars) coronavirus papain-like protease (plpro) is a dub that cleaves isg15, a two-domain ub-like protein, and lys48-linked polyub chains, releasing diub(lys48) products. to elucidate this specificity, we report the 2.85 å crystal structure of sars plpro bound to a diub(lys48) activity-based ...201627203180
detection of the severe acute respiratory syndrome-related coronavirus and alphacoronavirus in the bat population of taiwan.bats have been demonstrated to be natural reservoirs of severe acute respiratory syndrome coronavirus (sars cov) and middle east respiratory syndrome (mers) cov. faecal samples from 248 individuals of 20 bat species were tested for partial rna-dependent rna polymerase gene of cov and 57 faecal samples from eight bat species were tested positive. the highest detection rate of 44% for scotophilus kuhlii, followed by 30% for rhinolophus monoceros. significantly higher detection rates of coronaviral ...201627178103
sars coronavirus papain-like protease induces egr-1-dependent up-regulation of tgf-β1 via ros/p38 mapk/stat3 pathway.sars coronavirus (sars-cov) papain-like protease (plpro) has been identified in tgf-β1 up-regulation in human promonocytes (proteomics 2012, 12: 3193-205). this study investigates the mechanisms of sars-cov plpro-induced tgf-β1 promoter activation in human lung epithelial cells and mouse models. sars-cov plpro dose- and time-dependently up-regulates tgf-β1 and vimentin in a549 cells. dual luciferase reporter assays with tgf-β1 promoter plasmids indicated that tgf-β1 promoter region between -175 ...201627173006
sars coronavirus papain-like protease inhibits the tlr7 signaling pathway through removing lys63-linked polyubiquitination of traf3 and traf6.severe acute respiratory syndrome coronavirus (sars-cov) papain-like protease (plpro) reportedly inhibits the production of type i interferons (ifns) and pro-inflammatory cytokines in toll-like receptor 3 (tlr3) and retinoic acid-inducible gene 1 (rig-i) pathways. the study investigated the inhibitory effect and its antagonistic mechanism of sars-cov plpro on tlr7-mediated cytokine production. tlr7 agonist (imiquimod (imq)) concentration-dependently induced activation of isre-, nf-κb- and ap-1-l ...201627164085
development of monoclonal antibody and diagnostic test for middle east respiratory syndrome coronavirus using cell-free synthesized nucleocapsid antigen.protein nativity is one of the most critical factors for the quality of antigens used as immunogens and the reactivities of the resultant antibodies. the preparation and purification of native viral antigens in conventional cell-based protein expression systems are often accompanied by technical hardships. these challenges are attributable mainly to protein aggregation and insolubility during expression and purification, as well as to very low expression levels associated with the toxicity of so ...201627148198
genetic diversity of coronaviruses in miniopterus fuliginosus bats.coronaviruses, such as severe acute respiratory syndrome coronavirus and middle east respiratory syndrome coronavirus, pose significant public health threats. bats have been suggested to act as natural reservoirs for both these viruses, and periodic monitoring of coronaviruses in bats may thus provide important clues about emergent infectious viruses. the eastern bent-wing bat miniopterus fuliginosus is distributed extensively throughout china. we therefore analyzed the genetic diversity of coro ...201627125516
development of a sars coronavirus vaccine from recombinant spike protein plus delta inulin adjuvant.given periodic outbreaks of fatal human infections caused by coronaviruses, development of an optimal coronavirus vaccine platform capable of rapid production is an ongoing priority. this chapter describes the use of an insect cell expression system for rapid production of a recombinant vaccine against severe acute respiratory syndrome coronavirus (sars). detailed methods are presented for expression, purification, and release testing of sars recombinant spike protein antigen, followed by adjuva ...201627076136
mers-cov infection of alpaca in a region where mers-cov is endemic. 201627070501
kinetic, mutational, and structural studies of the venezuelan equine encephalitis virus nonstructural protein 2 cysteine protease.the venezuelan equine encephalitis virus (veev) nonstructural protein 2 (nsp2) cysteine protease (ec 3.4.22.-) is essential for viral replication and is involved in the cytopathic effects (cpe) of the virus. the veev nsp2 protease is a member of merops clan cn and characteristically contains a papain-like protease linked to an s-adenosyl-l-methionine-dependent rna methyltransferase (sam mtase) domain. the protease contains an alternative active site motif, (475)nvcwak(480), which differs from pa ...201627030368
wildlife trade and human health in lao pdr: an assessment of the zoonotic disease risk in markets.although the majority of emerging infectious diseases can be linked to wildlife sources, most pathogen spillover events to people could likely be avoided if transmission was better understood and practices adjusted to mitigate risk. wildlife trade can facilitate zoonotic disease transmission and represents a threat to human health and economies in asia, highlighted by the 2003 sars coronavirus outbreak, where a chinese wildlife market facilitated pathogen transmission. additionally, wildlife tra ...201627008628
memory t cell responses targeting the sars coronavirus persist up to 11 years post-infection.severe acute respiratory syndrome (sars) is a highly contagious infectious disease which first emerged in late 2002, caused by a then novel human coronavirus, sars coronavirus (sars-cov). the virus is believed to have originated from bats and transmitted to human through intermediate animals such as civet cats. the re-emergence of sars-cov remains a valid concern due to the continual persistence of zoonotic sars-covs and sars-like covs (sl-covs) in bat reservoirs. in this study, the screening fo ...201626954467
glycopeptide antibiotics potently inhibit cathepsin l in the late endosome/lysosome and block the entry of ebola virus, middle east respiratory syndrome coronavirus (mers-cov), and severe acute respiratory syndrome coronavirus (sars-cov).ebola virus infection can cause severe hemorrhagic fever with a high mortality in humans. the outbreaks of ebola viruses in 2014 represented the most serious ebola epidemics in history and greatly threatened public health worldwide. the development of additional effective anti-ebola therapeutic agents is therefore quite urgent. in this study, via high throughput screening of food and drug administration-approved drugs, we identified that teicoplanin, a glycopeptide antibiotic, potently prevents ...201626953343
comparative epidemiology of human infections with middle east respiratory syndrome and severe acute respiratory syndrome coronaviruses among healthcare personnel.the largest nosocomial outbreak of middle east respiratory syndrome (mers) occurred in south korea in 2015. health care personnel (hcp) are at high risk of acquiring mers-coronavirus (mers-cov) infections, similar to the severe acute respiratory syndrome (sars)-coronavirus (sars-cov) infections first identified in 2003. this study described the similarities and differences in epidemiological and clinical characteristics of 183 confirmed global mers cases and 98 sars cases in taiwan associated wi ...201626930074
coexistence of multiple coronaviruses in several bat colonies in an abandoned mineshaft.since the 2002-2003 severe acute respiratory syndrome (sars) outbreak prompted a search for the natural reservoir of the sars coronavirus, numerous alpha- and betacoronaviruses have been discovered in bats around the world. bats are likely the natural reservoir of alpha- and betacoronaviruses, and due to the rich diversity and global distribution of bats, the number of bat coronaviruses will likely increase. we conducted a surveillance of coronaviruses in bats in an abandoned mineshaft in mojian ...201626920708
coexistence of multiple coronaviruses in several bat colonies in an abandoned mineshaft.since the 2002-2003 severe acute respiratory syndrome (sars) outbreak prompted a search for the natural reservoir of the sars coronavirus, numerous alpha- and betacoronaviruses have been discovered in bats around the world. bats are likely the natural reservoir of alpha- and betacoronaviruses, and due to the rich diversity and global distribution of bats, the number of bat coronaviruses will likely increase. we conducted a surveillance of coronaviruses in bats in an abandoned mineshaft in mojian ...201626920708
high-resolution analysis of coronavirus gene expression by rna sequencing and ribosome profiling.members of the family coronaviridae have the largest genomes of all rna viruses, typically in the region of 30 kilobases. several coronaviruses, such as severe acute respiratory syndrome-related coronavirus (sars-cov) and middle east respiratory syndrome-related coronavirus (mers-cov), are of medical importance, with high mortality rates and, in the case of sars-cov, significant pandemic potential. other coronaviruses, such as porcine epidemic diarrhea virus and avian coronavirus, are important ...201626919232
antigen production in plant to tackle infectious diseases flare up: the case of sars.severe acute respiratory syndrome (sars) is a dangerous infection with pandemic potential. it emerged in 2002 and its aetiological agent, the sars coronavirus (sars-cov), crossed the species barrier to infect humans, showing high morbidity and mortality rates. no vaccines are currently licensed for sars-cov and important efforts have been performed during the first outbreak to develop diagnostic tools. here we demonstrate the transient expression in nicotiana benthamiana of two important antigen ...201626904039
design and synthesis of a series of serine derivatives as small molecule inhibitors of the sars coronavirus 3cl protease.synthesis of serine derivatives having the essential functional groups for the inhibitor of sars 3cl protease and evaluation of their inhibitory activities using sars 3cl r188i mutant protease are described. the lead compounds, functionalized serine derivatives, were designed based on the tetrapeptide aldehyde and bai's cinnamoly inhibitor, and additionally performed with simulation on gold softwear. structure activity relationship studies of the candidate compounds were given reasonable inhibit ...201626879854
conformational flexibility of a short loop near the active site of the sars-3clpro is essential to maintain catalytic activity.the sars 3c-like proteinase (sars-3clpro), which is the main proteinase of the sars coronavirus, is essential to the virus life cycle. this enzyme has been shown to be active as a dimer in which only one protomer is active. however, it remains unknown how the dimer structure maintains an active monomer conformation. it has been observed that the ser139-leu141 loop forms a short 3(10)-helix that disrupts the catalytic machinery in the inactive monomer structure. we have tried to disrupt this heli ...201626879383
sars-cov and ifn: too little, too late.dysregulated type i interferon (ifn-i) expression can lead to severe pathology and disease. in this issue of cell host & microbe, channappanavar et al. (2016) use a sars-coronavirus animal model to describe how rapid and robust virus replication with delayed ifn-i can lead to lung immunopathology, with fatal outcomes.201626867172
fatal outcome of human coronavirus nl63 infection despite successful viral elimination by ifn-alpha in a patient with newly diagnosed all.human coronavirus nl63 (hcov-nl63) is one of four common human respiratory coronaviruses. despite high incidence, hcov infections are grossly understudied. we here report a case of hcov infection in a leukemia patient with fatal ards despite successful virus elimination by pegylated interferon-alpha (peg-ifn-α).201626854965
middle east respiratory syndrome coronavirus intra-host populations are characterized by numerous high frequency variants.middle east respiratory syndrome coronavirus (mers-cov) is an emerging human pathogen related to sars virus. in vitro studies indicate this virus may have a broad host range suggesting an increased pandemic potential. genetic and epidemiological evidence indicate camels serve as a reservoir for mers virus but the mechanism of cross species transmission is unclear and many questions remain regarding the susceptibility of humans to infection. deep sequencing data was obtained from the nasal sample ...201626790002
spatiotemporal interplay of severe acute respiratory syndrome coronavirus and respiratory mucosal cells drives viral dissemination in rhesus macaques.innate immune responses have a critical role in the control of early virus replication and dissemination. it remains unknown, however, how severe acute respiratory syndrome coronavirus (sars-cov) evades respiratory innate immunity to establish a systemic infection. here we show in chinese macaques that sars-cov traversed the mucosa through the respiratory tract within 2 days, resulting in extensive mucosal infiltration by t cells, mac387(+), and cd163(+) monocytes/macrophages followed by limited ...201626647718
benchmark study for the cysteine-histidine proton transfer reaction in a protein environment: gas phase, cosmo, qm/mm approaches.proton transfer reactions are of crucial interest for the investigation of proteins. we have investigated the accuracy of commonly used quantum chemical methods for the description of proton transfer reactions in different environments (gas phase, cosmo, qm/mm) using the proton transfer between the catalytic dyad residues cysteine 145 and histidine 41 of sars coronavirus main protease as a case study. the test includes thermodynamic, kinetic, and structural properties. the study comprises comput ...201326587634
the role of host genetic factors in respiratory tract infectious diseases: systematic review, meta-analyses and field synopsis.host genetic factors have frequently been implicated in respiratory infectious diseases, often with inconsistent results in replication studies. we identified 386 studies from the total of 24,823 studies identified in a systematic search of four bibliographic databases. we performed meta-analyses of studies on tuberculosis, influenza, respiratory syncytial virus, sars-coronavirus and pneumonia. one single-nucleotide polymorphism from il4 gene was significant for pooled respiratory infections (rs ...201526524966
compounds derived from epigallocatechin-3-gallate (egcg) as a novel approach to the prevention of viral infections.pathogenic viral infections pose major health risks to humans and livestock due to viral infection-associated illnesses such as chronic or acute inflammation in crucial organs and systems, malignant and benign lesions. these lead to large number of illnesses and deaths worldwide each year. outbreaks of emerging lethal viruses, such as ebola virus, severe acute respiratory syndrome (sars) virus and middle east respiratory syndrome (mers) virus, could lead to epidemics or even pandemics if they ar ...201526490660
reconstitution of the receptor-binding motif of the sars coronavirus.the severe acute respiratory syndrome (sars) coronavirus (cov) identified in 2003 has infected ∼8000 people worldwide, killing nearly 10% of them. the infection of target cells by the sars cov is mediated through the interaction of the viral spike (s) protein (1255 amino acids) and its cellular receptor, angiotensin-converting enzyme 2 (ace2). the sars cov receptor-binding domain (amino acids n318-t509 of s protein) harbors an extended excursion along its periphery that contacts ace2 and is desi ...201526487711
orf8-related genetic evidence for chinese horseshoe bats as the source of human severe acute respiratory syndrome coronavirus.several lineage b betacoronaviruses termed severe acute respiratory syndrome (sars)-like covs (sl-covs) were identified from rhinolophus bats in china. these viruses are characterized by a set of unique accessory open reading frames (orfs) that are located between the m and n genes. among unique accessory orfs, orf8 is most hypervariable. in this study, the orf8s of all sl-covs were classified into 3 types, and, for the first time, it was found that very few sl-covs from rhinolophus sinicus have ...201626433221
identification of a novel small molecule inhibitor against sars coronavirus helicase.a new chemical inhibitor against severe acute respiratory syndrome (sars) coronavirus helicase, 7-ethyl-8-mercapto-3-methyl-3,7-dihydro-1h-purine-2,6-dione, was identified. we investigated the inhibitory effect of the compound by conducting colorimetry-based atp hydrolysis assay and fluorescence resonance energy transfer-based double-stranded dna unwinding assay. the compound suppressed both atp hydrolysis and double-stranded dna unwinding activities of helicase with ic50 values of 8.66 ± 0.26 μ ...201526387819
middle east respiratory syndrome coronavirus: transmission, virology and therapeutic targeting to aid in outbreak control.middle east respiratory syndrome coronavirus (mers-cov) causes high fever, cough, acute respiratory tract infection and multiorgan dysfunction that may eventually lead to the death of the infected individuals. mers-cov is thought to be transmitted to humans through dromedary camels. the occurrence of the virus was first reported in the middle east and it subsequently spread to several parts of the world. since 2012, about 1368 infections, including ~487 deaths, have been reported worldwide. nota ...201526315600
a synthetic consensus anti-spike protein dna vaccine induces protective immunity against middle east respiratory syndrome coronavirus in nonhuman primates.first identified in 2012, middle east respiratory syndrome (mers) is caused by an emerging human coronavirus, which is distinct from the severe acute respiratory syndrome coronavirus (sars-cov), and represents a novel member of the lineage c betacoronoviruses. since its identification, mers coronavirus (mers-cov) has been linked to more than 1372 infections manifesting with severe morbidity and, often, mortality (about 495 deaths) in the arabian peninsula, europe, and, most recently, the united ...026290414
the virus-host interplay: biogenesis of +rna replication complexes.positive-strand rna (+rna) viruses are an important group of human and animal pathogens that have significant global health and economic impacts. notable members include west nile virus, dengue virus, chikungunya, severe acute respiratory syndrome (sars) coronavirus and enteroviruses of the picornaviridae family.unfortunately, prophylactic and therapeutic treatments against these pathogens are limited. +rna viruses have limited coding capacity and thus rely extensively on host factors for succes ...201526287230
use of isotope-edited ftir to derive a backbone structure of a transmembrane protein.solving structures of membrane proteins has always been a formidable challenge, yet even upon success, the results are normally obtained in a mimetic environment that can be substantially different from a biological membrane. herein, we use noninvasive isotope-edited ftir spectroscopy to derive a structural model for the sars coronavirus e protein transmembrane domain in lipid bilayers. molecular-dynamics-based structural refinement, incorporating the ir-derived orientational restraints points t ...201426277945
severe acute respiratory syndrome (sars) coronavirus orf8 protein is acquired from sars-related coronavirus from greater horseshoe bats through recombination.despite the identification of horseshoe bats as the reservoir of severe acute respiratory syndrome (sars)-related coronaviruses (sarsr-covs), the origin of sars-cov orf8, which contains the 29-nucleotide signature deletion among human strains, remains obscure. although two sars-related rhinolophus sinicus bat covs (sarsr-rs-batcovs) previously detected in chinese horseshoe bats (rhinolophus sinicus) in yunnan, rsshc014 and rs3367, possessed 95% genome identities to human and civet sarsr-covs, th ...201526269185
severe acute respiratory syndrome (sars) coronavirus orf8 protein is acquired from sars-related coronavirus from greater horseshoe bats through recombination.despite the identification of horseshoe bats as the reservoir of severe acute respiratory syndrome (sars)-related coronaviruses (sarsr-covs), the origin of sars-cov orf8, which contains the 29-nucleotide signature deletion among human strains, remains obscure. although two sars-related rhinolophus sinicus bat covs (sarsr-rs-batcovs) previously detected in chinese horseshoe bats (rhinolophus sinicus) in yunnan, rsshc014 and rs3367, possessed 95% genome identities to human and civet sarsr-covs, th ...201526269185
Displaying items 701 - 800 of 3881