Publications
| Title | Abstract | Year Filter | PMID(sorted descending) Filter |
|---|
| [formation of phenol compounds in various cultivars of wheat (triticum aestivum l.)]. | the formation of soluble phenol compounds, including flavonols, was studied in winter (erythrospermum, lutescens 230, and r 47-28) and spring cultivars (lada) of wheat (triticum aestivum l.). the contents of soluble phenol compounds and flavonols were 1.8-2.6 and 0.5-1.3 mg/kg fresh weight, respectively. these results illustrate the similarity of phenol metabolism in leaves of winter and spring wheat cultivars. the exception was the cultivar r 47-28 that accumulated the maximum amount of phenol ... | 2006 | 15810742 |
| developmental changes in the metabolic protein profiles of wheat endosperm. | a combined two-dimensional gel electrophoresis-mass spectrometry approach was utilized to identify over 250 proteins of wheat (triticum aestivum l., cv. butte 86) starchy endosperm that participate in 13 biochemical processes: atp interconversion reactions, carbohydrate metabolism, cell division, cytoskeleton, lipid metabolism, nitrogen metabolism, protein synthesis/assembly, protein turnover, signal transduction, protein storage, stress/defense, transcription/translation, and transport. endospe ... | 2005 | 15800972 |
| the wheat (triticum aestivum l.) leaf proteome. | the wheat leaf proteome was mapped and partially characterized to function as a comparative template for future wheat research. in total, 404 proteins were visualized, and 277 of these were selected for analysis based on reproducibility and relative quantity. using a combination of protein and expressed sequence tag database searching, 142 proteins were putatively identified with an identification success rate of 51%. the identified proteins were grouped according to their functional annotations ... | 2005 | 15800971 |
| spelt (triticum aestivum ssp. spelta) as a source of breadmaking flours and bran naturally enriched in oleic acid and minerals but not phytic acid. | the nutritional value of breadmaking cereal spelt (triticum aestivum ssp. spelta) is said to be higher than that of common wheat (triticum aestivum ssp. vulgare), but this traditional view is not substantiated by scientific evidence. in an attempt to clarify this issue, wholemeal and milling fractions (sieved flour, fine bran, and coarse bran) from nine dehulled spelt and five soft winter wheat samples were compared with regard to their lipid, fatty acid, and mineral contents. in addition, tocop ... | 2005 | 15796621 |
| antioxidant activity of commercial soft and hard wheat (triticum aestivum l.) as affected by gastric ph conditions. | phenolic compounds from soft and hard wheat and their milling fractions were extracted into distilled deionized water, and their in vitro antioxidant activities were evaluated. wheat samples were used as such (nontreated) or subjected to ph adjustment (treated) in order to simulate gastrointestinal ph conditions. the total phenolic content (tpc) was determined using folin-ciocalteu's procedure. the total antioxidant activity (taa) was determined using trolox equivalent antioxidant capacity assay ... | 2005 | 15796575 |
| effects of interactions between cadmium and zinc on phytochelatin and glutathione production in wheat (triticum aestivum l.). | it has been proposed that phytochelatins (pcs) act as a biomarker for the evaluation of metal toxicity. little attention has been paid to the effects on metal combinations and glutathione (gsh), the most abundant cellular thiol. in the present study the effects of interactions between cadmium (cd) and zinc (zn) on pc and gsh production were examined in wheat tissue over 14 days' exposure. the results showed that the presence of zn alleviated cd toxicity, accompanied by a reduction of cd uptake. ... | 2005 | 15793816 |
| molecular characterization and origin of novel bipartite cold-regulated ice recrystallization inhibition proteins from cereals. | to understand the molecular basis of freezing tolerance in plants, several low temperature-responsive genes have been identified from wheat. among these are two genes named tairi-1 and tairi-2 (triticum aestivum ice recrystallization inhibition) that are up-regulated during cold acclimation in freezing-tolerant species. phytohormones involved in pathogen defense pathways (jasmonic acid and ethylene) induce the expression of one of the two genes. the encoded proteins are novel in that they have a ... | 0 | 15792959 |
| the identification of foam-forming soluble proteins from wheat (triticum aestivum) dough. | proteomic methods have been used to identify foam-forming soluble proteins from dough that may play an important role in stabilising gas bubbles in dough, and hence influence the crumb structure of bread. proteins from a soluble fraction of dough (dough liquor) or dough liquor foam have been separated by two-dimensional gel electrophoresis, and 42 identified using a combination of matrix-assisted laser desorption/ionization-time of flight and quadrupole-time of flight analyses. major polypeptide ... | 2005 | 15789342 |
| evidence for the plasma membrane localization of al-activated malate transporter (almt1). | aluminum (al)-activated malate transporter (almt1) was recently identified from wheat (triticum aestivum). heterologous expression of almt1 led to higher malate exudation that is associated with enhanced al tolerance in transgenic plants. here, we show the first direct evidence that almt1 is localized in the plasma membrane of al-tolerant wheat. phase partitioning experiments showed that this transporter was associated with the plasma membrane fraction. almt1 was detected in an al-tolerant wheat ... | 2005 | 15769806 |
| development of snp assays for genotyping the puroindoline b gene for grain hardness in wheat using pyrosequencing. | grain hardness is one of the most important quality characteristics of cultivated bread wheat (triticum aestivum l.) and has been reported to result from either a failure to express puroindoline a (pina) or single-nucleotide mutations in puroindoline b (pinb). up to now, seven alleles from pinb-d1a to pinb-d1g were identified in bread wheat. compared to the dna coding region of pinb-d1a (allele for softness), six single-nucleotide polymorphisms (snps) were detected in six alleles for pinb-d1. in ... | 2005 | 15769137 |
| oxidative stress and phytochelatin characterisation in bread wheat exposed to cadmium excess. | in this work, we first investigated if the bread wheat (triticum aestivum l.) cv. albimonte can be defined as "shoot cadmium excluder"--by comparing the cadmium (cd) content in leaves and roots and by calculating the shoot-to-root cd concentration ratio. furthermore, we evaluated if the exposure to cd excess could generate oxidative stress in leaves and roots of this cv., in terms of hydrogen peroxide (h(2)o(2)) accumulation, nad(p)h oxidation rate, and variations in reduced glutathione (gsh) co ... | 2005 | 15763665 |
| expression of fission yeast cdc25 driven by the wheat adp-glucose pyrophosphorylase large subunit promoter reduces pollen viability and prevents transmission of the transgene in wheat. | cell number was to be measured in wheat (triticum aestivum) endosperm expressing spcdc25 (a fission yeast cell-cycle regulator) controlled by a supposedly endosperm-specific promoter, agp2 (from the large subunit of adp glucose pyrophosphorylase). wheat was transformed by biolistics either with agp2::gus or agp2::spcdc25. pcr and rt-pcr checked integration and expression of the transgene, respectively. in cv. chinese spring, agp2::gus was unexpectedly expressed in carpels and pollen, as well as ... | 2005 | 15760362 |
| modeling carbon and nitrogen transformations for adjustment of compost application with nitrogen uptake by wheat. | environmentally sound management of the use of composts in agriculture relies on matching the rate of release of available n from compost-amended soils to the crop demand. to develop such management it is necessary to (i) characterize the properties of composts that control their rates of decomposition and release of n and (ii) determine the optimal amount of composts that should be applied annually to wheat (triticum aestivum l.). carbon and n mineralization were measured under controlled condi ... | 2005 | 15758119 |
| prediction of zinc, cadmium, lead, and copper availability to wheat in contaminated soils using chemical speciation, diffusive gradients in thin films, extraction, and isotopic dilution techniques. | to predict the availability of metals to plants, it is important to understand both solution- and solid-phase processes in the soil, including the kinetics of metal release from its binding agent (ligand and/or particle). the present study examined the speciation and availability of zn, cd, pb, and cu in a range of well-equilibrated metal-contaminated soils from diverse sources using several techniques as a basis for predicting metal uptake by plants. wheat (triticum aestivum l.) was grown in 13 ... | 2005 | 15758102 |
| wheat cytogenetics in the genomics era and its relevance to breeding. | hexaploid wheat is a species that has been subjected to most extensive cytogenetic studies. this has contributed to understanding the mechanism of the evolution of polyploids involving diploidization through genetic restriction of chromosome pairing to only homologous chromosomes. the availability of a variety of aneuploids and the ph mutants (ph1 and ph2) in bread wheat also allowed chromosome manipulations leading to the development of alien addition/substitution lines and the introgression of ... | 2005 | 15753592 |
| synaptic behaviour of hexaploid wheat haploids with different effectiveness of the diploidizing mechanism. | haploids of three cultivars of triticum aestivum (thatcher, chris, and chinese spring) were obtained from crosses with zea mays. the level of chromosome pairing at metaphase i and the synaptic behaviour at prophase i was studied. there were differences in the meiotic behaviour of the haploids from different cultivars. thatcher and chris haploids had significantly higher levels of pairing at metaphase i than chinese spring haploids. this metaphase i pairing was correlated with higher levels of sy ... | 2005 | 15753579 |
| chromosome organization in wheat endosperm and embryo. | we have analysed the chromosome organization in endosperm and embryo of bread wheat (triticum aestivum l.), in order to compare these tissues with developing anthers, in which the centromeres associate, and the developing root xylem vessel cells, in which the chromosomes endoreduplicate to become polytene and associate via their centromeres. both endosperm and embryo showed a typical rabl configuration and a degree of non-homologous centromere association and the endosperm also showed extensive ... | 2005 | 15753574 |
| first report of phoma sorghina (sacc.) boerema dorenbosch & van kest on wheat leaves (triticum aestivum l.) in argentina. | a new disease caused by phoma sorghina has been detected for the first time on wheat plants in the province of buenos aires, argentina. the pathogen was isolated from wheat leaves growing under field conditions, cultured on pda and identified by its morphobiometric and cultural characters. the disease symptoms and morphological characters of the pathogen are described. pathogenicity of the isolate was confirmed by inoculating 10 wheat cultivars under greenhouse conditions. | 2005 | 15750734 |
| molecular basis of evolutionary events that shaped the hardness locus in diploid and polyploid wheat species (triticum and aegilops). | the hardness (ha) locus controls grain hardness in hexaploid wheat (triticum aestivum) and its relatives (triticum and aegilops species) and represents a classical example of a trait whose variation arose from gene loss after polyploidization. in this study, we investigated the molecular basis of the evolutionary events observed at this locus by comparing corresponding sequences of diploid, tertraploid, and hexaploid wheat species (triticum and aegilops). genomic rearrangements, such as transpos ... | 2005 | 15749759 |
| microsatellite dna polymorphism divergence in chinese wheat (triticum aestivum l.) landraces highly resistant to fusarium head blight. | genetic differences between 20 chinese wheat (triticum aestivum l.) landraces highly resistant to fusarium head blight (fhb) and 4 wheat lines highly susceptible to fhb were evaluated by means of microsatellite markers, in order to select suitable parents for gene mapping studies. thirty-nine out of 40 microsatellite markers (97.5%) were polymorphic among the 24 wheat genotypes. a total of 276 alleles were detected at the 40 microsatellite loci. the number of alleles per locus ranged from 1 to 1 ... | 2005 | 15741658 |
| biomonitoring of air pollution in a seasonally dry tropical suburban area using wheat transplants. | air pollution has been identified as a serious problem throughout the world which causes tremendous loss to the crops by affecting plant growth and yield. earlier, air pollution was restricted to urban and industrial regions. over the last few decades, however, it has become evident that pollutants can be transported over long distances and hence their impact may be felt widely over rural areas. the present study was conducted to evaluate the impact of urban air pollution on suburban agriculture ... | 2005 | 15736874 |
| a novel dwarfing mutation in a green revolution gene from brassica rapa. | mutations in the biosynthesis or signaling pathways of gibberellin (ga) can cause dwarfing phenotypes in plants, and the use of such mutations in plant breeding was a major factor in the success of the green revolution. della proteins are ga signaling repressors whose functions are conserved in different plant species. recent studies show that ga promotes stem growth by causing degradation of della proteins via the ubiquitin-proteasome pathway. the most widely utilized dwarfing alleles in wheat ... | 2005 | 15734906 |
| manganese toxicity thresholds for restoration grass species. | manganese toxicity thresholds for restoration plants have not been established. as a result, ecological risk assessments rely on toxicity thresholds for agronomic species, which may differ from those of restoration species. our objective was to provide mn toxicity thresholds for grasses commonly used in restoration. we used a greenhouse screening study where seedlings of redtop, slender wheatgrass, tufted hairgrass, big bluegrass, basin wildrye, and common wheat were grown in sand culture and ex ... | 2005 | 15734591 |
| inheritance and qtl analysis of durable resistance to stripe and leaf rusts in an australian cultivar, triticum aestivum 'cook'. | an f4-derived f6 recombinant inbred line population (n = 148) of a cross between the durable stripe (yellow) rust (caused by puccinia striiformis) and leaf (brown) rust (caused by puccinia triticina) resistant cultivar, triticum aestivum 'cook', and susceptible genotype avocet-yra was phenotyped at several locations in canada and mexico under artificial epidemics of leaf or stripe rusts and genotyped using amplified fragment length polymorphism (aflp) and microsatellite markers. durable adult pl ... | 2005 | 15729401 |
| mapping of genes expressed in fusarium graminearum-infected heads of wheat cultivar 'frontana'. | the isolation, physical, and genetic mapping of a group of wheat genes expressed in infected heads of triticum aestivum 'frontana' resistant to fusarium head blight is reported. a cdna library was built from heads of 'frontana' through suppressive subtractive hybridization, to enrich for sequences induced by the pathogen fusarium graminearum during infection. a group of 1794 clones was screened by dot blot hybridization for differential gene expression following infection. twenty of these clones ... | 2005 | 15729400 |
| a new intervarietal linkage map and its application for quantitative trait locus analysis of "gigas" features in bread wheat. | a doubled-haploid (dh) population from an intervarietal cross between the japanese cultivar 'fukuho-komugi' and the israeli wheat line 'oligoculm' was produced by means of wheat x maize crosses. one hundred seven dh lines were genotyped to construct a simple sequence repeat (ssr) based linkage map with rflp, rapd, and inter-simple sequence repeat markers. out of 570 loci genotyped, 330 were chosen based on their positions on the linkage map to create a "framework" map for quantitative trait locu ... | 2005 | 15729398 |
| induction of wheat defense and stress-related genes in response to fusarium graminearum. | fusarium head blight (fhb), caused by species of the fungus fusarium, is a worldwide disease of wheat (triticum aestivum l.). the chinese t. aestivum 'ning7840' is one of few wheat cultivars with resistance to fhb. to identify differentially expressed genes corresponding to fhb resistance, a cdna library was constructed using pooled mrna isolated from glumes of 'ning7840' harvested at 2, 6, 12, 24, 36, 72, and 96 h after inoculation (hai) with a conidia spore suspension of fusarium graminearum. ... | 2005 | 15729394 |
| the application of bioassays as indicators of petroleum-contaminated soil remediation. | bioremediation has proven successful in numerous applications to petroleum contaminated soils. however, questions remain as to the efficiency of bioremediation in lowering long-term soil toxicity. in the present study, the bioassays spirotox, microtox, ostracodtoxkit f, umu-test with s-9 activation, and plant assays were applied, and compared to evaluate bioremediation processes in heavily petroleum contaminated soils. six higher plant species (secale cereale l., lactuca sativa l., zea mays l., ... | 2005 | 15722101 |
| nonrandom distribution and frequencies of genomic and est-derived microsatellite markers in rice, wheat, and barley. | earlier comparative maps between the genomes of rice (oryza sativa l.), barley (hordeum vulgare l.) and wheat (triticum aestivum l.) were linkage maps based on cdna-rflp markers. the low number of polymorphic rflp markers has limited the development of dense genetic maps in wheat and the number of available anchor points in comparative maps. higher density comparative maps using pcr-based anchor markers are necessary to better estimate the conservation of colinearity among cereal genomes. the pu ... | 0 | 15720707 |
| wheat leaf photosynthesis loss due to leaf rust, with respect to lesion development and leaf nitrogen status. | in wheat (triticum aestivum cv. soissons) plants grown under three different fertilisation treatments, we quantified the effect of leaf rust (puccinia triticina) on flag leaf photosynthesis during the whole sporulation period. bastiaans' model: y = (1 - x)beta was used to characterize the relationship between relative leaf photosynthesis (y) and disease severity (x). the evolution of the different types of symptoms induced by the pathogen (sporulating, chlorotic and necrosed tissues) was evaluat ... | 2005 | 15720636 |
| a high-density genetic map of hexaploid wheat (triticum aestivum l.) from the cross chinese spring x sq1 and its use to compare qtls for grain yield across a range of environments. | a population of 96 doubled haploid lines (dhls) was prepared from f1 plants of the hexaploid wheat cross chinese spring x sq1 (a high abscisic acid-expressing breeding line) and was mapped with 567 rflp, aflp, ssr, morphological and biochemical markers covering all 21 chromosomes, with a total map length of 3,522 cm. although the map lengths for each genome were very similar, the d genome had only half the markers of the other two genomes. the map was used to identify quantitative trait loci (qt ... | 2005 | 15719212 |
| partial sequences of nitrogen metabolism genes in hexaploid wheat. | our objective was to partially sequence genes controlling nitrogen metabolism in wheat species in order to find sequence polymorphism that would enable their mapping. primers were designed for nitrate reductase, nitrite reductase, glutamate dehydrogenase and glutamate synthase (gogat), and gene fragments were amplified on triticum aestivum, t. durum, t. monococcum, t. speltoides and t. tauschii. we obtained more than 8 kb of gene sequences, mainly as coding regions (60%). polymorphism was quanti ... | 2005 | 15714330 |
| alteration of the embryo transcriptome of hexaploid winter wheat (triticum aestivum cv. mercia) during maturation and germination. | grain dormancy and germination are areas of biology that are of considerable interest to the cereal community. we have used a 9,155-feature wheat unigene cdna microarray resource to investigate changes in the wheat embryo transcriptome during late grain development and maturation and during the first 48 h of postimbibition germination. in the embryo 392 mrnas accumulated by twofold or greater over the time course from 21 days postanthesis (dpa) to 40 dpa and on through 1 and 2 days postgerminati ... | 2005 | 15714317 |
| inheritance of fusarium head blight resistance in the soft red winter wheat ernie. | fusarium head blight (fhb), caused by fusarium graminearum schwabe [telomorph:gibberella zeae schw. (petch)], is an increasingly important disease of wheat (triticum aestivum l.). host-plant resistance is considered to be the most economical means of control, but a lack of unique sources of resistance has hindered efforts to breed resistant varieties. the soft red winter wheat, ernie, has moderately high fhb resistance and is widely used in u.s. breeding programs; however, the genetics of resist ... | 2004 | 15712009 |
| [effect of malonate on the structural and functional changes of wheat triticum aestivum l. root cells]. | a study was made of respiration, output of k+ and ultrastructure of wheat root cells treated for 6 h with malonic acid (ma) (15 mm), an inhibitor of succinate dehydrogenase. after a 1 h treatment, on the background of a decrease in respiration, and output of k+ an increased number of lumens of smooth endoplasmic reticulum was observed. these changes may be the result of lipid biosynthesis. within first hours of treatment with ma, the mitochondrial matrix was becoming more brightened, and after 3 ... | 2004 | 15704878 |
| the transcript composition of egg cells changes significantly following fertilization in wheat (triticum aestivum l.). | here, we report the transcript profile of wheat egg cells and proembryos, just after the first cell division. microdissected female gametophytes of wheat were used to isolate eggs and two-celled proembryos to construct cell type-specific cdna libraries. in total, 1197 expressed sequence tags (ests) were generated. analysis of these ests revealed numerous novel transcripts. in egg cells, 17.6% of the clustered ests represented novel transcripts, while 11.4% novel clusters were identified in the t ... | 2005 | 15703054 |
| inheritance of the light intensity response in spring cultivars of common wheat. | the effects of low/high light intensities and day length on ear emergence time in climatic chambers were studied in 12 common wheat (triticum aestivum l.) cultivars of different ecogeographical origin. low light intensity (li) affected the time to ear emergence in all the wheat cultivars of both the photoperiod sensitive and insensitive genotypes, increasing the number of days to ear emergence (dee). based on the increase in dee, we chose samples with different light intensity responses among th ... | 2004 | 15703045 |
| development of primers specific for lmw-gs genes located on chromosome 1d and molecular characterization of a gene from glu-d3 complex locus in bread wheat. | glutenins are multimeric aggregates of high molecular weight (hmw) and low molecular weight (lmw) subunits, which determine the quality in wheat. development of locus-specific primers is an important step toward cloning specific lmw glutenin subunits (lmw-gs) by pcr method. based on the publicly available, a pair of primer, namely primer 3 (5' ttgtagaaactgccatcctt 3') and primer 4 (5' gtcaccgctgcat cgacata 3') was designed and verified to specific for lmw-gs genes located on chromosome 1d in thi ... | 2004 | 15703035 |
| sorption of copper and zinc to the plasma membrane of wheat root. | sorption of cu(2+) and zn(2+) to the plasma membrane (pm) of wheat root (triticum aestivum l cv. scout 66) vesicles was measured at different ph values and in the presence of organic acids and other metals. the results were analyzed using a gouy-chapman-stem model for competitive sorption (binding and electrostatic attraction) to a negative binding site. the binding constants for the two investigated cations as evaluated from the sorption experiments were 5 m(-1) for zn(2+) and 400 m(-1) for cu( ... | 2004 | 15702373 |
| distribution and remobilization of iron and copper in wheat. | the amount of iron (fe) and copper (cu) that is loaded into grains of wheat (triticum aestivum) depends on both the amount of nutrient taken up by the plant post-anthesis and the amount that is remobilized from vegetative organs as they senesce. previous reports have shown that these two micronutrients behave quite differently in wheat in that cu is readily remobilized to the grain whilst fe shows poor remobilization. the object was to quantify the distribution of fe and cu in wheat and to show ... | 2005 | 15701664 |
| [variation of betaine and proline contents in wheat seedlings under salt stress]. | glycine betaine (gb) and proline contents of leaf and root were simultaneously determined by hplc-esi-ms at seedling stage in the three wheat (triticum aestivum l.) varieties (salt tolerance from high to low), sw12, ningchun no.4 and chinese spring (c.s) under 5 different salt stress levels. the gb contents among sw12, ningchun no.4 and c.s were found outstanding difference by anova (p<0.01) and consistent with salt tolerance in wheat. proline contents were not different among 3 wheat varieties ... | 2005 | 15692186 |
| [functional analysis of vernalization-related gene ver17 in flower development using antisense rna strategy in winter wheat]. | to understand the function of vernalization-related gene ver17 in winter wheat (triticum aestivum l. cv. jingdong no.1), an antisense rna strategy was used. the antisense ver17 with a vector pbi121 was constructed and transformed into winter wheat by using the pollen-tube-pathway method. fourteen independent transgenic plants transformed with antisense ver17 and five control transformants transformed with pbi121 blank vector were obtained and confirmed by gus histochemical assay and pcr-southern ... | 2005 | 15692181 |
| wheat genetic diversity trends during domestication and breeding. | it has been claimed that plant breeding reduces genetic diversity in elite germplasm which could seriously jeopardize the continued ability to improve crops. the main objective of this study was to examine the loss of genetic diversity in spring bread wheat during (1) its domestication, (2) the change from traditional landrace cultivars (lcs) to modern breeding varieties, and (3) 50 years of international breeding. we studied 253 cimmyt or cimmyt-related modern wheat cultivars, lcs, and triticum ... | 2005 | 15690175 |
| large deletions within the first intron in vrn-1 are associated with spring growth habit in barley and wheat. | the broad adaptability of wheat and barley is in part attributable to their flexible growth habit, in that spring forms have recurrently evolved from the ancestral winter growth habit. in diploid wheat and barley growth habit is determined by allelic variation at the vrn-1 and/or vrn-2 loci, whereas in the polyploid wheat species it is determined primarily by allelic variation at vrn-1. dominant vrn-a1 alleles for spring growth habit are frequently associated with mutations in the promoter regio ... | 2005 | 15690172 |
| degradation studies on benzoxazinoids. soil degradation dynamics of (2r)-2-o-beta-d-glucopyranosyl-4-hydroxy-(2h)- 1,4-benzoxazin-3(4h)-one (diboa-glc) and its degradation products, phytotoxic allelochemicals from gramineae. | wheat (triticum aestivum l.) has been found to possess allelopathic potential and studies have been conduced to apply wheat allelopathy for biological weed control. 2,4-dihydroxy-(2h)-1,4-benzoxazin-3(4h)-one (diboa) is a common product found in wheat, corn, and rye exudates and it can be released to the environment by that way. in this report, the stability of diboa is studied in two soils from crop lands of wheat cv. astron and cv. ritmo. these varieties were selected by their concentrations o ... | 2005 | 15686401 |
| structure-activity relationships (sar) studies of benzoxazinones, their degradation products and analogues. phytotoxicity on standard target species (sts). | benzoxazinones 2,4-dihydroxy-7-methoxy-(2h)-1,4-benzoxazin-3(4h)-one (dimboa) and 2,4-dihydroxy-(2h)-1,4-benzoxazin-3(4h)-one (diboa) have been considered key compounds for understanding allelopathic phenomena in gramineae crop plants such as corn (zea mays l.), wheat (triticum aestivum l.), and rye (secale cereale l.). the degradation processes in the environment observed for these compounds, in which soil microbes are directly involved, could affect potential allelopathic activity of these pla ... | 2005 | 15686399 |
| mapping of gluten t-cell epitopes in the bread wheat ancestors: implications for celiac disease. | celiac disease is a prevalent disorder characterized by a chronic intestinal inflammation driven by hla-dq2 or -dq8-restricted t cells specific for ingested wheat gluten peptides. the dominant t-cell responses are to epitopes that cluster within a stable 33mer fragment formed by physiologic digestion of distinct alpha-gliadins. celiac disease is treated by excluding all gluten proteins from the diet. conceivably, a diet based on baking-quality gluten from a wheat species that expresses no or few ... | 2005 | 15685550 |
| characterization of b- and c-type low molecular weight glutenin subunits by electrospray ionization mass spectrometry and matrix-assisted laser desorption/ionization mass spectrometry. | low molecular weight glutenin subunits (lmw-gs) are typically subdivided into three groups, according to their molecular weights and isoelectric points, namely the b-, c-, and d groups. enriched b- and c-type lmw-gs fractions extracted from the bread wheat cultivar chinese spring were characterized using high performance liquid chromatography (hplc) directly interfaced with electrospray ionization mass spectrometry and hplc coupled off-line with matrix-assisted laser desorption/ionization mass s ... | 2005 | 15682464 |
| long oligonucleotide microarrays in wheat: evaluation of hybridization signal amplification and an oligonucleotide-design computer script. | a computer script was written in the perl language to design equal-length long oligonucleotides from dna sequences. the script allows the user to specify g + c content, melting temperature, self-complementarity, the maximum number of contiguous duplicate bases, whether to start with the first start codon and whether to report reverse complements. microarrays were fabricated with 95 oligonucleotides (60 mers) representing 41 genes. the microarray was interrogated with cdna from roots and shoots o ... | 2005 | 15682265 |
| scanning electron microscopy of fusarium damaged kernels of spring wheat. | kernels of five wheat cultivars (triticum aestivum) of different bread-making quality were examined. grown under field conditions, heads of wheat were inoculated in the flowering stage with an aqueous suspension of fusarium culmorum conidia. wheat heads were collected from the control and inoculated plots at full maturity. control (non-inoculated) kernels without any symptoms of disease and fusarium damaged kernels (fdk) were examined under scanning electron microscopy (sem). examination of the ... | 2005 | 15681039 |
| effect of fungicide treatment on the quality of wheat flour and breadmaking. | fungicides are applied to crop plants to ensure disease protection and improve growth. to assess the effects of five commercial foliar and spike fungicides in four different combinations on wheat (triticum aestivum l.), various quality parameters and flour processing properties, including baking quality, were determined. three commonly used wheat cultivars with different quality classes (e, b, and c) were tested. falling number, crude protein content, water absorption ability, protease activity, ... | 2004 | 15675809 |
| non-phosphorylating bypass of the plant mitochondrial respiratory chain by stress protein csp 310. | recently, it has been reported that the cold-stress protein csp 310, discovered in the cytoplasm of cold-resistant winter cereals, causes uncoupling of oxidative phosphorylation during cold stress. to understand how the uncoupling mechanism of csp differs from that of cyanide-insensitive alternative oxidase and plant mitochondrial uncoupling protein, we determined the effect of respiratory-chain inhibition on winter wheat (triticum aestivum l. cv. zalarinka) mitochondria. our data show a possibl ... | 0 | 15668769 |
| regulation by vrn-1/fr-1 chromosomal intervals of cbf-mediated cor/lea gene expression and freezing tolerance in common wheat. | vrn-1/fr-1 chromosomal regions of common wheat possess major qtls for both winter hardiness (fr) and vernalization requirement (vrn). the vrn-1/fr-1 intervals are assigned to long arms of the homologous group 5 chromosomes. to investigate the role of the vrn-1/fr-1 intervals on the low-temperature (lt) inducibility of wheat cor/lea genes and its putative transcription factor gene wcbf2, lt response of these genes was monitored using near-isogenic lines (nils) for the vrn-1 loci. the wcbf2 transc ... | 2005 | 15668223 |
| variation in barley yellow dwarf virus transmission efficiency by rhopalosiphum padi (homoptera: aphididae) after acquisition from transgenic and nontransformed wheat genotypes. | the effects of different acquisition access periods (aaps) and inoculation access periods (iaps) on the transmission efficiency of barley yellow dwarf luteovirus (bydv) by rhopalosiphum padi (l.) (homoptera: aphididae) after feeding on transgenic or nontransformed wheat, triticum aestivum l., genotypes were studied. three wheat genotypes were tested as virus sources: virus-susceptible 'lambert' and 'lambert'-derived transgenic lines 103.1j and 126.02, which express the bydv-pav coat protein gene ... | 2004 | 15666729 |
| combining ability in the f1 and f2 generations of diallel cross in hexaploid wheat (triticum aestivum l. em. thell). | the f(1) and f(2) progenies of a ten-parent diallel cross (excluding reciprocals) of hexaploid wheat (triticum aestivum l. em. thell) were analyzed for combining ability for quantitative and quality traits. the results indicated significant differences among the parents for general combining ability (gca) and crosses for specific combining ability (sca) for all the characters studied. the gca and sca components of variance were significant for all the traits. however, the gca component of varian ... | 2004 | 15660971 |
| heterosis studies for yield and its components in bread wheat over environments. | a set of diallel crosses involving 10 parents was made to have information on the extent of heterosis over mid-parent and better parent and inbreeding depression for yield and yield contributing characters under three different environments. marked heterobeltiosis for grain yield and its important components were observed. for grain yield, 83 crosses showed significant positive heterobeltiosis in all the three sowing dates, however, twenty crosses showed significant consistent heterobeltiosis fo ... | 2004 | 15660970 |
| large intraspecific haplotype variability at the rph7 locus results from rapid and recent divergence in the barley genome. | to study genome evolution and diversity in barley (hordeum vulgare), we have sequenced and compared more than 300 kb of sequence spanning the rph7 leaf rust disease resistance gene in two barley cultivars. colinearity was restricted to five genic and two intergenic regions representing <35% of the two sequences. in each interval separating the seven conserved regions, the number and type of repetitive elements were completely different between the two homologous sequences, and a single gene was ... | 2005 | 15659632 |
| a ph-stating mechanism in isolated wheat (triticum aestivum) aleurone layers involves malic acid transport. | acidification of the starchy endosperm by the aleurone layer following germination has been established; however, the physiological and metabolic responses of this tissue to external ph have been incompletely investigated. in this investigation, isolated wheat (triticum aestivum) aleurone layers were incubated in different solutions at initial ph values of 3, 4 and 6 in the absence of phytohormones. after 24 h of incubation, the initial ph of all malate and succinate buffers shifted towards a va ... | 2004 | 15658800 |
| genetic and biochemical analysis of common wheat cultivars lacking puroindoline a. | puroindoline a (pin-a) and puroindoline b (pin-b), two basic isoforms encoded by the pina-d1 and pinb-d1 loci respectively, involved in controlling grain texture in wheat, were isolated from starch granules of soft wheat cultivars using three different extraction procedures, and fractionated by acidic polyacrylamide gel electrophoresis (a-page). tris buffer containing 1% triton x-114 extracted pin-a and small amounts of pin-b, whereas 1% sds preferably extracted pin-b. large amounts of both puro ... | 2005 | 15657742 |
| differential exudation of two benzoxazinoids--one of the determining factors for seedling allelopathy of triticeae species. | benzoxazinoids (bx) are natural phytotoxins that function as chemical defense compounds in several species. the release of bx by intact plant roots associated these compounds with root allelopathy in triticeae species; however, the significance of exudate concentrations of bx for plant-plant interactions is still a controversial question. a biological screening of 146 cultivars of four triticeae species (triticum aestivum l., triticum durum desf., triticum spelta l., and secale cereale l.) demon ... | 2005 | 15656658 |
| impact of cre1, cre8 and cre3 genes on cereal cyst nematode resistance in wheat. | the cereal cyst nematode (ccn; heterodera avenae), a root disease of cereal crops, is a major economic constraint in many wheat (triticum aestivum)-growing areas of the world. the objective of this study was to assess the impact of the cre1, cre8 and cre3 genes on ccn resistance. a population of 92 doubled-haploid (dh) lines derived from a cross between wheat cvs. frame and silverstar as well as 1,851 wheat breeding lines were screened for ccn resistance at the primary industries research victor ... | 2005 | 15655664 |
| influence of the gibberellin-sensitive rht8 dwarfing gene on leaf epidermal cell dimensions and early vigour in wheat (triticum aestivum l.). | the gibberellin-insensitive rht-b1b and rht-d1b dwarfing genes are known to reduce the size of cells in culms, leaves and coleoptiles of wheat. resulting leaf area development of gibberellin-insensitive wheats is poor compared to standard height (rht-b1a and rht-d1a) genotypes. alternative dwarfing genes to rht-b1b and rht-d1b are available that reduce plant height, such as the gibberellin-responsive rht8 gene. this study aims to investigate if rht8 has a similar dwarfing effect on the size of l ... | 2005 | 15655105 |
| characterization of est-derived microsatellites in the wheat genome and development of essr markers. | est-derived microsatellites or simple sequence repeats (essr) occur in expressed sequence tags (est). here we report characteristics of essrs in the wheat genome, construction of consensus chromosome bin maps of ssr-containing ests ((ssr)ests), and development of essr markers for the 21 wheat chromosomes. a perl script known as misa was used to identify essrs in wheat ests available in the database http://wheat.pw.usda.gov/cgi-bin/ace/search/west ). among 492,832 ests from the database, 36,520 ( ... | 2005 | 15650880 |
| [molecular study and c-banding of chromosomes in common wheat alloplasmic lines obtained from the backcross progeny of barley-wheat hybrids hordeum vulgare l. (2n = 14) x triticum aestivum l. (2n = 42) and differing in fertility]. | we studied common wheat alloplasmic lines differing in fertility traits, which had been obtained from the backcross progeny of barley-wheat hybrids hordeum vulgare l. (2n = 14) x triticum aestivum l. (2n = 42), using molecular analysis and chromosome c-banding. it was found that the nuclei of all alloplasmic lines studied, regardless of their fertility traits, contained only the common wheat chromosomes (2n = 42). the formation of line l-79(10)(3)f6, stable for self-fertility, from line l-79(10) ... | 2004 | 15648150 |
| [effect of an introgression from aegilops cylindrica host on manifestation of productivity traits in winter common wheat f2 plants]. | the effect of introgression of a chromosome 1d segment from aegilops cylindrica to winter common wheat on productivity traits in f2 plants was studied using storage protein loci as genetic markers. an allele of the gliadin-coding gli-d1 locus served as a marker of the introgression. using of two- and three-locus interaction models, it was shown that the introgression tagged with gli-d1 affected the manifestation of productivity traits (productive tillering, grain weight per plant and grain numbe ... | 2004 | 15648149 |
| [detection of the introgression of genome elements of the aegilops cylindrica host. into the triticum aestivum l. genome by issr and ssr analysis]. | to reveal sites of the donor genome in wheat crossed with aegilops cylindrica, which acquired conferred resistance to fungal diseases, a comparative analysis of introgressive and parental forms was conducted. two systems of pcr analysis, issr and ssr-pcr, were employed. upon use of 7 issr primers in genotypes of 30 individual plants bc1 f9 belonging to lines 5/55-91 and 5/20-91, 19 issr loci were revealed and assigned to introgressive fragments of aegilops cylindrica genome in triticum aestivum. ... | 2004 | 15648148 |
| development of the single nucleotide polymorphism marker of the wheat lr1 leaf rust resistance gene. | the range of publicly available data on plant nucleotide sequences opens a new possibility in the design of snp assays. the purpose of this study was to identify point mutations in genomic sequences closely linked to the lr1 leaf rust resistance gene, and to develop snp markers based on primer extension (snupe) facilitating efficient marker-based selection procedures, e.g. the pyramiding of resistance genes. studies were performed on the panel of 37 wheat cultivars, the set of 41 thatcher near-i ... | 2004 | 15647804 |
| combined use of linked markers for genotyping the pm1 locus in common wheat. | genotyping of 98 wheat cultivars/lines was carried out with molecular markers that are linked to the pm1 locus: two bi-allelic (dominant) markers: the sequence-tagged site xsts638-7a and the amplified fragment length polymorphism xe39m58-77-7a; and the multi-allelic simple sequence repeat marker xgwm344-7a. employing segregation data recorded in the population chinese spring x virest (pm1e), genetic mapping revealed that xgwm344-7a and xe39m58-77-7a were distally linked to pm1e in the repulsion ... | 2004 | 15647799 |
| genetic mapping of three alleles at the pm3 locus conferring powdery mildew resistance in common wheat (triticum aestivum l.). | a set of differential isolates of blumeria graminis f.sp. tritici was used to identify 10 alleles at the pm3 locus on the short arm of chromosome 1a. three f3 populations were used to map pm3h in abessi, pm3i in line n324, and pm3j alleles in gus 122 relative to microsatellite markers. in total, 13 marker loci were mapped on chromosome 1as and 1 marker on 1al. the order of marker loci in the 3 mapping populations is consistent with previously published maps. all 3 alleles were mapped in the dist ... | 2004 | 15644971 |
| high level of genetic diversity among spelt germplasm revealed by microsatellite markers. | the genetic diversity of spelt (triticum aestivum (l.) thell. subsp. spelta (l.) thell.) cultivated presently is very narrow. although the germplasm collections of spelt are extensive, the related genetic knowledge is often lacking and makes their use for genetic improvement difficult. the genetic diversity and structure of the spelt gene pool held in gene banks was determined using 19 simple sequence repeat (ssr) markers applied to 170 spelt accessions collected from 27 countries and 4 continen ... | 2004 | 15644962 |
| molecular characterization of a gene encoding n-myristoyl transferase (nmt) from triticum aestivum (bread wheat). | myristoyl-coa:protein n-myristoyl transferase (nmt; ec 2.3.1.97) acylates the gly residue abutting the n-terminal met with a myristic acid following the removal of the met residue in certain eukaryotic proteins, and in some cases myristoylation is essential to cell growth and survival. we report the cloning of a full-length cdna encoding nmt from triticum aestivum (tanmt). the cdna included a predicted open reading frame of 1317 nucleotides, which encoded a predicted protein of 438 amino acids c ... | 2004 | 15644961 |
| [rapd marker analysis of continuous divergent selection in cross-bred population of wheat (triticum aestivum l.)]. | a base population was established through multi-parent random crossing by using taigu dominant male-sterile wheat, and then five cycles of 2-way selection for four quantitative characters were conducted. the dynamic changes of genetic structures in the open-pollinated wheat population were examined by rapd technique. seven primers in rapd analysis amplified 116 sites. the results of gene frequencies and phenotypic bands showed abundant genetic variations existed in the population. the percentage ... | 2003 | 15639875 |
| identification of oligopeptidase b in higher plants. purification and characterization of oligopeptidase b from quiescent wheat embryo, triticum aestivum. | proteolytic enzymes in general, and cysteine proteases in particular, play key roles in seed germination and early seedling growth. however, the precise mechanism by which the serine proteases are regulated remains unclear. trypsin-like activity was detected in wheat germ (quiescent embryo) and this activity increased in the germinating embryo. in this work, a trypsin-like serine protease expressed in wheat germ was purified to homogeneity by chromatography through deae-cellulose, phenyl-sepharo ... | 2004 | 15632308 |
| [physiological effects of taurine on the growth of wheat (triticum aestivum l.) seedlings]. | wheat (triticum aestivum l.) seedlings were grown in taurine solution at concentrations of 10, 100, 500, 1000 and 5000 mg/l, and the photochemistry efficiency, the relative permeability of membrane, membrane lipid peroxidation and the growth indexes in wheat seedlings were determined. the results showed that taurine treatments distinctly promoted the growth of wheat seedlings and increased root length, plant height, dry weight and fresh weight single plant of wheat seedlings. in addition, the ph ... | 2004 | 15627716 |
| [effects of nitric oxide on root growth and its oxidative damage in wheat seedling under salt stress]. | effects of nitric oxide (no), a substance newly found to have protective functions in plants, on root growth of wheat (triticum aestivum l. yangmai 158) seedlings under salt stress were studied. sodium nitroprusside (snp), an no donor, markedly alleviated the inhibitory effect of salt on root elongation at salt concentrations around 150 mmol/l, but was ineffective when nacl concentration was at 300 mmol/l or higher. it was most effective at 0.05-0.1 mmol/l, and had harmful effect at 0.30-5 mmol/ ... | 2004 | 15627712 |
| cloning and characteristics of an allene oxide synthase gene (taaos) of winter wheat. | allene oxide synthase (aos) is the first enzyme in the lipoxygenase pathway which leads to the formation of jasmonic acid (ja). a full length cdna of taaos was cloned in winter wheat (triticum aestivum l. cv. jinghua no.3) seedlings. the open reading frame encompassed 1410 bp encoding a polypeptide of 470 amino acids with calculated molecular mass of 51.9 kd. southern blot analysis suggested there are three copies of the gene in wheat genome. the taaos mrna could be strongly induced by exogenous ... | 2004 | 15627690 |
| [nuclear and cytoplasmic genome analysis of somatic hybrid of triticum aestivum l. and leymus chinensis (trin.) tzvel]. | intergeneric somatic hybrids were obtained by fusion between protoplasts of triticum aestivum l. cv. jinan 177 and leymus chinensis (trin.) tzvel. protoplasts of l. chinensis were exposed to uv (300 microw/cm(2)) for 30 s, 45 s and 1 min before fusion. the results of morphological and chromosomal observation, isozyme pattern as well as rapd analysis and the 5s rdna space sequence analysis showed the hybrid nature of the regenerated colonies of fusion combination t (+) l (uv 30 s). restriction fr ... | 2004 | 15627685 |
| imidazolinone-tolerant crops: history, current status and future. | imidazolinone herbicides, which include imazapyr, imazapic, imazethapyr, imazamox, imazamethabenz and imazaquin, control weeds by inhibiting the enzyme acetohydroxyacid synthase (ahas), also called acetolactate synthase (als). ahas is a critical enzyme for the biosynthesis of branched-chain amino acids in plants. several variant ahas genes conferring imidazolinone tolerance were discovered in plants through mutagenesis and selection, and were used to create imidazolinone-tolerant maize (zea mays ... | 2005 | 15627242 |
| [research advances in wheat (triticum aestivum) allelopathy]. | wheat (triticum aestivum) is the main food crop in the world, and plays an important role in agricultural production. in order to enhance wheat yield, herbicides and germicides were intensively applied and made negative effects on the environment. wheat possesses allelopathic potential for weed suppression and disease control through the release of secondary metabolites from its living plants or residues, which could avoid the environment pollution brought by herbicides and germicides. this pape ... | 2004 | 15624846 |
| transfer of small chromosome fragments of agropyron elongatum to wheat chromosome via asymmetric somatic hybridization. | the chromosome constitution of hybrids and chromatin patterns of agropyron elongatum (host)neviski in f5 somatic hybrid lines ii -1-3 and i-1-9 between triticum aestivum l. and a. elongatum were analyzed. based on the statistic data of pollen mother cells, f5 i-1-9 and ii-1-3 had 20-21 bivalents with a frequency of 84.66% and 85.28%, of which, 89.83% and 89.57% were ring bivalents. the result indicated that both hybrid lines were basically stable in the chromosome constitution and behavior. rapd ... | 2004 | 15623155 |
| [resolving capacity of monosomic line analysis in cytogenetic studies of common wheat]. | basing on statistic analysis of the character of homologue pairing in the series of monosomic lines of wheat milturum 553 it was found that the diversions of monosomic and disomic plants from their original parent were caused by the changes in the system of actions and interrelations of genes caused by hemizygous state of chromosomes. resolving capacity of monosomic line analysis as a method of cytogenetic investigations of wheat was demonstrated. input of each chromosome in determination of mei ... | 2008 | 15619985 |
| complementation of sugary-1 phenotype in rice endosperm with the wheat isoamylase1 gene supports a direct role for isoamylase1 in amylopectin biosynthesis. | to examine the role of isoamylase1 (isa1) in amylopectin biosynthesis in plants, a genomic dna fragment from aegilops tauschii was introduced into the isa1-deficient rice (oryza sativa) sugary-1 mutant line em914, in which endosperm starch is completely replaced by phytoglycogen. a. tauschii is the d genome donor of wheat (triticum aestivum), and the introduced fragment effectively included the gene for isa1 for wheat (taisa1) that was encoded on the d genome. in taisa1-expressing rice endosperm ... | 2005 | 15618430 |
| agropyron elongatum chromatin localization on the wheat chromosomes in an introgression line. | the introgressed small-chromosome segment of agropyron elongatum (host.) neviski (thinopyrum ponticum podp.) in f5 line ii-1-3 of somatic hybrid between common wheat (triticum aestivum l.) and a. elongatum was localized by sequential fluorescence in situ hybridization (fish), genomic in situ hybridization (gish) and karyotype data. karyotype analysis offered basic data of arm ratios and relative lengths of 21 pairs of chromosomes in parent wheat jinan177 and hybrid ii-1-3. using special high rep ... | 2005 | 15616822 |
| [trends in genetic diversity change of spring bread wheat cultivars released in russia in 1929-2003]. | using genealogy analysis, we studied genetic diversity of 340 cultivars of spring bread wheat that were released on the territory of russia in 1929-2003. trends in the temporal change of genetic diversity were inferred from analysis of a set of n x m matrices, where n is the number of the released cultivars and m is the number of original ancestors. the pool of original ancestors of the spring bread wheat cultivars for the total period of study included 255 landraces, of which 88 were from the f ... | 2004 | 15612570 |
| [revealing hereditary variation of winter hardiness in cereals]. | a set of cereal crops and differentiating cultivars was shown to be of utility for identifying the major abiotic factors that limit the survival of winter crops in the cold season of a particular year. with this approach, the season was identified (1997-1998, belgorod) when the survival of cereals depended on the tolerance to anaerobiosis rather than on the frost resistance. differentiation of common wheat cultivars with respect to this property was attributed to a locus designated win1 (winter ... | 0 | 15612569 |
| [change in lectin specificity of winter wheat seedlings in the course of infection with mycoplasms]. | the activity of soluble lectins in leaves and roots of seedlings of winter wheat (triticum aestivum l.) cultivar mironovskaya 808 increased 1 day and 2 days, respectively, after infection with the mycoplasma acholeplasma laidlawii 118. analysis of acid-soluble proteins of wheat leaves by page revealed the appearance of 22- and 20-kda polypeptides, the disappearance of a 14-kda polypeptide, and an increase in the content of polypeptides with molecular weights of 76, 48, 25, and 18 kda. the 18-kda ... | 2004 | 15609859 |
| [effects of cytokinin preparations on the stability of the photosynthetic apparatus of two wheat cultivars under water deficiency]. | carboxylase activities of the key enzyme of carbon metabolism, ribulose-bisphosphate carboxylase/oxygenase (rubisco; ec 4.1.1.39), and phosphoenolpyruvate carboxylase (pepc; ec 4.1.1.31), as well as intensities of carbon dioxide photosynthetic assimilation in young seedlings and adult leaves of the wheat triticum aestivum l. cultivars mironovskaya 808 (a more tolerant) and lyutestsens 758 (a less tolerant), were compared under conditions of progressive water deficiency. the water stress had more ... | 2013 | 15609857 |
| phytoecdysteroids: a novel defense against plant-parasitic nematodes. | the phytoecdysteroid, 20-hydroxyecdysone (20e), is a major molting hormone of invertebrates, possibly including nematodes. as 20e is inducible in spinach, the defensive role against plant-parasitic nematodes was investigated. the effects of direct application on nematodes was assessed by treating cereal cyst nematode, heterodera avenae, juveniles with concentrations of 20e from 8.2 x 10(-8) to 5.2 x 10(-5) m before applying to triticum aestivum growing in sand. h. avenae, heterodera schachtii (s ... | 2004 | 15609826 |
| real time rt-pcr and flow cytometry to investigate wheat kernel hardness: role of puroindoline genes and proteins. | developing seeds from triticum aestivum (wheat) cultivars were collected after flowering and analysed for puroindoline a and b gene expression by real time rt-pcr. mature seeds were investigated for the presence and the amount of starch-associated puroindoline a and b proteins by flow cytometry. puroindoline a gene and protein were found to have a predominant role in controlling wheat kernel hardness. | 2004 | 15604827 |
| a genetic and structural analysis of the n-glycosylation capabilities. | the recent draft sequencing of the rice (oryza sativa) genome has enabled a genetic analysis of the glycosylation capabilities of an agroeconomically important group of plants, the monocotyledons. in this study, we have not only identified genes putatively encoding enzymes involved in n-glycosylation, but have examined by maldi-tof ms the structures of the n-glycans of rice and other monocotyledons (maize, wheat and dates; zea mays, triticum aestivum and phoenix dactylifera); these data show tha ... | 2004 | 15604706 |
| a mini exon in the sucrose:sucrose 1-fructosyltransferase gene of wheat. | we previously reported the cloning of a wheat sucrose:sucrose 1-fructosyltransferase (1-sst) cdna, designated wft2. wft2 proteins have fructosyltransferase enzyme activity and initiate fructan synthesis (biosci. biotechnol. biochem. 66 (2002) 2297). in the current study, we cloned a genomic dna fragment carrying the full-length 1-sst gene from winter wheat (triticum aestivum). the genomic 1-sst gene is 3326 bp in length and contains four exons and three introns. exon 2 has only 9 bp. this sequen ... | 2004 | 15602819 |
| chloroplast and nuclear dna variation in common wheat: insight into the origin and evolution of common wheat. | to understand the origin and evolution of common wheat, chloroplast (ct) and nuclear dna variations were studied in five hexaploid and three tetraploid wheat subspecies. based on chloroplast simple sequence repeats at 24 loci, they were classified into two major plastogroups. plastogroup i consisted of 11 plastotypes, including the major plastotype h10 that occurred at the highest frequency (59%) in common wheat. plastogroup ii consisted of five plastotypes and occurred in eight out of 27 access ... | 2004 | 15599057 |
| [exogenous nitric oxide alleviates osmotic stress-induced membrane lipid peroxidation in wheat seedling leaves]. | when wheat (triticum aestivum l. yangmai 158) seedling (with three fully expanded leaves) roots were treated with 15% peg-6000 in combination with different concentrations (0.1 and 0.5 mmol/l) of exogenous nitric oxide donor sodium nitroprusside (snp) and no(-)(3)/no(-)(2) (control), the enhancement of lipoxygenase (lox) activity in wheat seedling leaves under osmotic stress was delayed at the lower concentration of snp treatment (0.1 mmol/l), while the generation rate of o(-.)(2), the enhanceme ... | 2004 | 15599047 |
| novel mode of resistance to fusarium infection by a mild dose pre-exposure of cadmium in wheat. | exposure of healthy wheat seeds (triticum aestivum var sonalika) to mild dose of cadmium (cd(2+)) given as 50 microm cdcl(2) for 48 h and then washed off cd(2+) offered resistance to the subsequent infection by fusarium oxysporum inoculum. seven days old seedlings having two primary leaves were aseptically inoculated with fungus, f. oxysporum (1 x 10(6)) spores. the seedlings pre-exposed to low level of cd(2+) survived the fusarium infection, while plantlets without cd(2+) stress wilted and then ... | 2004 | 15596097 |
| two point mutations identified in emmer wheat generate null wx-a1 alleles. | in this report, the wx-a1 mutations carried by a triticum dicoccoides line from israel and a triticum dicoccum line from yugoslavia are characterized. a single nucleotide insertion in the t. dicoccoides null allele and a single nucleotide deletion in the t. dicoccum null allele each cause frameshift mutations that induce premature termination codons more than 55 nucleotides upstream of the last exon-exon junction. in both mutants, wx-a1 transcripts were detectable in 10 day post-anthesis endospe ... | 2005 | 15592661 |
| preferential expression of a hlp homolog encoding a mitochondrial l14 ribosomal protein in stamens of common wheat. | interaction between nucleus and cytoplasm has essential roles in plant development, including that of floral organs. we isolated a wheat homolog whlp of arabidopsis huellenlos paralog (hlp) gene encoding a mitochondrial (mt) ribosomal protein l14. transient expression analysis using the green fluorescent protein (gfp) fusion protein showed that 50 amino residues located on the n-terminal of the wheat hlp homolog (whlp) protein acted as a mt-targeting signal (mts). expression patterns of the whlp ... | 2004 | 15588583 |
| marker-assisted selection for leaf rust resistance genes lr19 and lr24 in wheat (triticum aestivum l.). | leaf rust caused by puccinia recondita f.sp. tritici is a wheat disease of worldwide importance. wheat genotypes known to carry specific rust resistance genes and segregating lines that originated from various cross combinations and derived from distinct f2 lineage, so as to represent a diverse genetic background, were included in the present study for validation of molecular markers for lr19 and lr24. sts markers detected the presence of the leaf rust resistance gene lr19 in a thatcher nil (tc* ... | 2004 | 15586436 |
| ftir imaging of wheat endosperm cell walls in situ reveals compositional and architectural heterogeneity related to grain hardness. | endosperm cell walls of cultivars of wheat (triticum aestivum l.) selected for their endosperm texture (two soft and two hard) were analysed in situ by fourier transform infrared (ftir) microspectroscopy. ftir imaging coupled with statistical analysis was used to map the compositional and structural heterogeneity within transverse sections from which cell contents had been removed by sonication. in the majority of grains analysed, two distinct populations of endosperm cells could be identified b ... | 2005 | 15580525 |
| a reverse genetic, nontransgenic approach to wheat crop improvement by tilling. | we report the use of tilling (targeting induced local lesions in genomes), a reverse genetic, nontransgenic method, to improve a quality trait in a polyploid crop plant. waxy starches, composed mostly of amylopectin, have unique physiochemical properties. wheat with only one or two functional waxy genes (granule-bound starch synthase i, or gbssi) produces starch with intermediate levels of amylopectin. we have identified 246 alleles of the waxy genes by tilling each homoeolog in 1,920 allohexapl ... | 2005 | 15580263 |
| [analysis of intraspecific divergence of hexaploid wheat triticum spelta l. by chromosome c-banding]. | intraspecific divergence of hexaploid wheat triticum spelta was studied by chromosome c-banding in 41 accessions of different geographic origins. the spelt accessions did not differ in karyotype structure or heterochromatin distribution from common wheat, but showed greater intraspecific polymorphism for chromosome rearrangements (translocations, inversions) and banding patterns. on evidence of c-banding patterns, spelt was assumed to occupy an intermediate position between tetraploid and hexapl ... | 2004 | 15575503 |