Publications

a mutant of escherichia coli defective in removing 3' terminal nucleotides from some transfer rna precursor molecules.	the conversion of precursor rna into bacteriophage t4 proline and serine transfer rnas includes two steps for the enzymatic removal of nucleotides from the 3' ends of rna chains. neither of these steps occur following infection of a mutant of escherichia coli that was previously shown to block the suppressor function of t4 serine transfer rna. cell-free extracts of this mutant are furthermore deficient in a wild type enzyme activity that removes nucleotides from the 3' ends of one of the rna cha ...	1975	1098779
membrane-associated proteins of t4-infected escherichia coli.		1975	1098277
characterisation of the bacteriophage t4 receptor site.		1975	1097935
carbon loss during irradiation of t4 bacteriophages and e. coli bacteria in electron microscopes.		1975	1097727
the nucleotide sequence of the dimeric precursor to glutamine and leucine transfer rnas coded by bacteriophage t4.		1975	1097716
information processing in immunogenetic analysis. v. some irregularities caused by simple-complex transformation of t universes.	a fairly uncomplicated t4 universe does give rise to a considerably complicated simple-complex image with several complexities regularly observed together in many immunogenetic systems. the present model thus 'explains' absence of antithetical alleles, absence of 'dosage' effects, presence of considerable quantitative variations of 'one and the same antigen' and peculiar 'non-autoantibodies'. these phenomena are exemplified for the rh system with regard to the d--du antigens, absence of d antige ...	1975	1097327
competition between bacteriophage f2 rna and bacteriophage t4 messenger rna.		1975	1096881
recovery of polysome function of t4-infected escherichia coli after brief treatment with chloramphenicol and rifampin.	t4-infected escherichia coli cells briefly exposed to rifampin, or to rifampin plus chloramphenicol, were capable of protein synthesis for some time after removal of the antibiotics, although ribonucleic acid synthesis was irreversibly inhibited. partially completed peptides trapped on polysomes by high levels of chloramphenicol were eventually completed after removal of the drug, as demonstrated by subjecting labeled peptides from appropriate polysome regions to polyacrylamide disc gel electrop ...	1975	1096805
packaging of dna into t4 bacteriophage: exclusion of host dna despite the absence of both host dna degradation and nuclear disruption.		1975	1096456
on the role of v gene in ultraviolet-induced enhancement of recombination among t4 phages.		1975	1096455
enzymic in vitro repair and chemical nature of dna chain breaks induced by incorporated phosphorus-32p decay.	in vitro repair of single strand breaks in t4 and phage dna caused by 32p decay was studied. zone centrifugation procedure showed that polynucleotide kinase, ligase enzyme system failed to repair 32p-damages. it was found that damaged dna contained gaps and could be repaired by dna-polymerase i, polynucleotide ligase treatment.	1975	1096080
phospholipase activity in bacteriophage-infected escherichia. ii. activation of phospholipase by t4 ghost infection.	the release of free fatty acids from the phospholipids of escherichia coli is initiated immediately after the attachment of t4 ghosts. a similar accumulation of free fatty acids is observed if the cells are infected with t4 phage in the presence of chloramphenicol or puromycin. an early accumulation of free fatty acids, however, is not observed in t4 infections in which chloramphenicol or puromycin are not present, nor does it occur if the e. coli are infected with t4 phage before ghost infectio ...	1975	1095777
organization and function of the tail of bacteriophage t4. ii. structural control of the tail contraction.		1975	1095753
bacteriophage t7 deoxyribonucleic acid replication in vitro. purification and properties of the gene 4 protein of bacteriophage t7.	the t7 gene 4 protein, a protein known from genetic analysis to participate in phage dna replication in vivo, has been purified approximately 500-fold with an in vitro complementation assay. the protein, purified from cells infected with a t7 gene 4 temperature-sensitive mutant, is thermolabile, establishing that the complementation activity is in the protein product of the phage gene 4. the purified protein has no detectable nuclease, dna polymerase, or rna polymerase activity. however, in addi ...	1975	1095580
bacteriophage t7 deoxyribonucleic acid replication invitro. bacteriophage t7 dna polymerase: an an emzyme composed of phage- and host-specific subunits.	the dna polymerase induced after infection of escherichia coli by phage t7 has been purified 500-fold to near homogeneity as judged by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. the purified enzyme complements extracts of cells infected with a t7 gene 5 mutant to permit cell-free replication of duplex t7 dna. in contrast, purified t4 dna polymerase or e. coli dna polymerase i is unable to do so, thus suggesting a specific requirement for the t7 enzyme in the ...	1975	1095579
the effect of trna derivatives bound with natural or synthetic mrna on the interaction of escherichia coli ribosomes with colicin e3.	ribosomal binding complexes directed by poly(u) or t4 mrna were formed with aminoacyl-trna or its derivatives bound to predominantly the p or a binding site. the defined binding complexes were reacted with colicin e3 and the reaction was assessed by the ability of the complexes to proceed with polypeptide synthesis. the results indicated that only one of the four complexes tested was completely resistant to colicin e3-induced inactivation: that of phe-trna bound in the presence of poly(u) to the ...	1975	1095372
effect of t4 ghosts on t4 development.		1975	1094680
presence of active polyribosomes in bacterial cells infected with t4 bacteriophage ghosts.	host protein synthesis of escherichia coli stops abruptly after t4 bacteriophage ghost infection. when infection was carried out in the presence of 10 mm mg2plus, infected cells still have active polyribosomes despite the complete stoppage of protein synthesis. on the other hand, when t4 ghost infection was carried out in the presence of 1 mm mg2plus, no polyribosomes were observed and most of the ribosomes were 30s and 50s subunit particles. subunits obtained from extracts of ghost-infected cel ...	1975	1094134
effect of dna delay mutations of bacteriophage t4 on genetic recombination.	studies have been made of the effect of the dna delay mutations of bacteriophage t4 on growth and genetic recombination in a number of escherichia coli hosts. dna delay mutations in genes 39, 52, 58 (61), and 60 result in abnormally high recombination frequencies. these high recombination frequencies are discussed in the context of other observations.	1975	1094133
high resolution scanning electron microscopy at the subcellular level.	recently developed scanning electron microscopes provide sufficient resolution to allow useful observation of subcellular biological objects. preparation methods for such objects need not be limited to the traditional coating and mounting procedures. many methods developed for transmission electron microscopy are immediately adaptable to scanning electron microscopy. we show that a number of techniques are available to the microscopist which yield adequate contrast and high resolution. as exampl ...	1975	1094123
proceedings: modification of e. coli rna polymerase induced by t4 phage infection.		1975	1094019
three steps in conversion of large precursor rna into serine and proline transfer rnas.	bacteriophage t4 serine and proline transfer rnas are derived from a common precursor rna. this precusor rna lacks -c-c-a sequences which could provide 3' termini for the mature transfer rnas. we have deduced part of the pathway leading to the formation of the c-c-a sequences in the transfer rnas by characterizing incompletely matured precursor molecules which accumulate during infection of mutant hosts that lack specific enzymes associated with transfer rna metabolism. maturation is initiated b ...	1975	1093182
nucleotide sequence determination of bacteriophage t2 and t6 species i ribonucleic acids.	the nucleotide sequences of species i rna coded for by bacteriophages t2 and t6 have been analyzed using 32-p-labeled material from t2 and t6-infected cultures of escherichia coli. the t1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from t4 species i rna to obtain a minimum estimate of the number of nucleotide sequence differences among the three species i rnas. analysis of fragments obtained by digestion with epsi ...	1975	1092687
nucleotide sequence determination of bacteriophage t4 species i ribonucleic acid.	the nucleotide sequence of t4 species i rna, one of several stable rna's specifically coded for by bacteriophage t4, has been determined using 32-p-labeled material from t4-infected cultures of escherichia coli. the purified rna species which has been sequenced has been shown to hybridize well to t4 dna (wilson j.h., kim, j.s., and abelson, j.n. (1972) j. mol. biol. 71, 547-556). the sequence is: pcgauucgaggaaauaucuuugccguaagccgaguagcguuuuugacggaacguucggauaugguugagauauggccuuuuaaaauauugaguagcguca ...	1975	1092686
biochemical studies on radiation-sensitive mutations in bacteriophage t4-1.	mutants of bacteriophage t4 which exhibit increased sensitivity to ultraviolet radiation were isolated and their abilities to induce an enzyme system to excise pyrimidine dimers were examined. among 16 mutants isolated, 12 mutants were found to be defective in inducing t4 endonuclease v, which catalyzes the formation of dimer-specific breaks in ultraviolet-irradiated dna. a leaky v mutant, which exhibits intermediate ultraviolet sensitivity, was also isolated; the mutant induces a low level of ...	1975	1092673
effects of p-fluorophenylalanine on the induction of mutations in bacteriophage t4. i. 5-bromouracil mutagenesis.	the amino acid analogue rho-fluorophenylalanine (pfpa) was found to have no mutagenic activity in the gamma system of bacteriophage t4. however, under standard conditions for 5-bromouracil (5-bu) mutagenesis, pfpa depressed the induced frequencies for both forward and reverse mutations. when the folate antagonist sulphanilamide (su) was omitted from the mutangenic treatment medium or when it was replaced by trimethoprim (tm), another folate antagonist, this depressive effect was abolished. it wa ...	1975	1091854
transcription of azotobacter phage deoxyribonucleic acid. salt-dependent equilibrium between steps in initiation.	the transcription of azotobacter phage a21 dna by escherichia coli or azotobacter vinelandii rna polymerase differs from that of some other dnas in its inhibition by moderate concentrations of kcl. this characteristic results in an apparent low template activity for this dna as compared with t4 dna under standard assay conditions. from an analysis of the dependence of the various steps in initiation on kcl it is concluded that the effect is exerted on an equilibrium between an inactive polymeras ...	1975	1091643
transcription of bacteriophage deoxyribonucleic acid. comparison of escherichia coli and azotobacter vinelandii sigma subunits.	the effect of the sigma subunit of rna polymerase on the rate and asymmetry of the in vitro transcription of escherichia coli and azotobacter vinelandii phage dnas has been studied with purified e. coli and a. vinelandii rna polymerases and hybrid enzymes containing the core subunits of one enzyme and sigma from the other. the effect of sigma on the rate of transcription is characteristic of the template and not of the enzyme and depends on ionic strength. the rate of transcription of a. vinelan ...	1975	1091642
isolation and partial characterization of three escherichia coli mutants with altered transfer ribonucleic acid methylases.	seven transfer ribonucleic acid (trna) methylase mutants were isolated from escherichia coli k-12 by examining the ability of rna prepared from clones of unselected mutagenized cells to accept methyl groups from s-adenosylmethionine catalyzed by crude enzymes from wild-type cells. five of the mutants had an altered uracil-trna methylase; consequently their trna's lacked ribothymidine. one mutant had trna deficient in 7-methylguanosine, and one mutant contained trna lacking 2-thio-5-methylaminome ...	1975	1091626
influence of salt on transcription by t4 core rna polymerase.		1975	1091510
two-dimensional polyacrylamide-gel electrophoresis for purification of small rnas specified by virulent coliphages t4, t5, t7 and bf23.	rnas synthesized in escherichia coli infected with virulent phages t4, t5, t7 and bf23 were labelled with 32po4 3- after phage infection. [32p]rnas of low molecular weight were separated by two-dimensional polyacrylamide gel electrophoresis, in which electrophoresis was carried out in two dimensions at different concentrations of acrylamide. the fractionated rnas were characterized by rna-fingerprint patterns made after t1 ribonuclease digestion. the two-dimensional gel of 10% yields 20% acrylam ...	1975	1091484
excision of pyrimidine dimers in normal and t4-infected escherichia coli: effect of pola and other mutations.	strains carrying both pola1 and recbts1 mutations, which are defective in dna polymerase i and have thermolabile exonuclease v (the recbc enzyme), are viable at 30 degrees c but not at 42 degrees c. these mutants exhibit almost normal rate of dimer excision in vivo even at the restrictive temperature. similar results were obtained with other pola minus strains. we have also investigated effect of host and phage mutations on excision of dimers in t4-infected cells. only a small amount of dimer is ...	1975	1091300
action of exonuclease v (the recbc enzyme) on ultraviolet-irradiated dna.	exonuclease v (the recbc enzyme) of escherichia coli can release pyrimidine dimers from ultraviolet-irradiated linear duplex dna though it acts more slowly on irradiated dna than on non-irradiated dan. however, close circular lambda-dv dna or phi x174 replicative form i dna is not attacked by exonuclease v even though the dna has been irradiated and treated with t4 endonuclease v to produce single-stranded breaks at the 5'-side of pyrimidine dimers. when irradiated circular dna, previously nicke ...	1975	1091299
transcription of bacteriophage t4 genome in vitro. heterogeneity of rna polymerase in crude extracts of normal and t4-infected escherichia coli b.	in order to obtain rna polymerase preparations carrying the necessary specificity determinants to transcribe the delayed-early genes of bacteriophage t4, crude extracts of uninfected and t4-infected escherichia coli were fractionated in glycerol gradients of low ionic strength. in contrast to the reported sedimentation behavior of the purified enzyme, the rna polymerase activity in crude extracts of normal and infected cells sedimented heterogeneously over a wide range of sedimentation coefficie ...	1975	1091288
comparison of the effects of bacteriophage t4 infection and n-ethylmaleimide on the translational specificity of escherichia coli ribosomes.		1975	1091211
t4-induced rna ligase joins single-stranded oligoribonucleotides.	rna ligase isolated from escherichia coli infected with bacteriophage t4 will catalyze the formation of an intermolecular 3' leads to 5' phosphodiester linkage between an oligoribonucleotide with a free 3'-hydroxyl and another oligoribonucleotide with a 5'-phosphate. upon reaction with (ap)5c, nearly quantitative conversion of the hexamer [5'-32p]p(up)5u to the dodecamer (ap)5c[3' leads to 5'-32p]p(up)5u was observed. the product was identified by its mobility on rpc-5 column chromatography, its ...	1975	1090929
characterization of new regulatory mutants of bacteriophage t4. ii. new class of mutants.	new mutants of bacteriophage t4 that overproduce the enzyme dihydrofolate reductase were investigated. unlike previously described overproducers of this enzyme (johnson and hall, 1974), these mutants did not overproduce deoxycytidylate deaminase. overproduction of dihydrofolate reductase by the new mutants occurred because enzymatic activity continued to increase for a longer period of time in cells infected by the mutants than in cells infected by wild-type phage. this continued increase occurr ...	1975	1090753
isolation of mutants of bacteriophage t4 unable to induce thymidine kinase activity. ii. location of the structural gene for thymidine kinase.	amber mutants of bacteriophage t4 have been isolated that induce thymidine kinase activity only after infection of a strain of escherichia coli carrying a suppressor mutation. the activity induced when one of these mutants infected this suppressor strain is much more heat sensitive than the activity induced by wild-type t4. this indicates that this amber mutation lies within the structural gene for thymidine kinase. this gene is between fi and v on the standard t4 genetic map. a mutant of tt4 th ...	1975	1090751
bacteriophage-host interaction and restriction of nonglucosylated t6.	nonglucosylated t6 phage (t6gtam 16am30, hereafter called t6alpha gt-) were found to have two structural anomalies when compared with wild-type t6. the dna of t6alpha gt- phage contains single-strand interruptions. these can be seen both during infection, in the pool of replicating dna, and in dna extracted from purified phage. in addition, the sodium dodecyl sulfate-polyacrylamide gel pattern of t6alpha gt- phage structural proteins reveals a protein band not found in t6. the altered protein ha ...	1975	1090750
cleavage of nonglucosylated bacteriophage t4 deoxyribonucleic acid by restriction endonuclease eco ri.	dnas lacking the glucosyl modification (glc-) and additionally lacking the 6-methylaminopurine (n6-methyladenine) modification (glc-, meade-) were prepared from appropriate t4 mutants. these dnas were cleaved by the purified restriction endonuclease eco ti from escherichia coli. normally modified dna (glc+, meade+) was not attached. the eco rii and the hemophilus enzymes hin dii and hin diii do not attack glc-, meade- t dna, possibly due to the presence of 6-hydroxymethylcytosine. eco ri produce ...	1975	1090619
construction of a colicin e1-r factor composite plasmid in vitro: means for amplification of deoxyribonucleic acid.	a composite plasmid has been constructed in vitro from colicin e1 factor (mass of 4.2 megadaltons [md]) and nontransmissible resistance factor rsf 1010 (mass, 5.5. md) deoxyribonucleic acids (dnas) by the sequential action of escherichia coli endonuclease (ri (eco ri) and t4 phage dna ligase on the covalently closed circular forms of the constituents. the composite plasmid was selected and amplified in vivo by sequential transformation of e. coli c600 with the ligated mixture and selection of tr ...	1975	1090574
effects of disintegration of incorporated 35s on mutation frequency.	the reverse mutation to the wild type of lambda sus 9 and t4 am b17 bacteriophages, grown in bacteria prelabeled with 35s and stored at--196 degrees, was studied. no mutagenic effect of 35s was observed in both, lambda and t4 bacteriophages. it is suggested that there is no influence of 35s disintegrations on the properties of dna polymerase to which the mutagenic activity could be attributed.	1975	1090113
biological activity of t4 dna synthesized in toluene-treated escherichia coli cells.	t4 dna synthesized in a toluene-treated cell system can act as the genetic donor in a dna transformation assay. this material transforms a variety of markers at high efficiency. we present evidence that the genetic activity is due to newly synthesized, double-stranded dna.	1975	1089805
canavanine-mediated depletion of polyamine pools in escherichia coli: effect of head morphogenesis and dna synthesis.	we have found that l-canavanine inhibited the synthesis of polyamines in t4-infected escherichia coli. these polyamines are known to be required for t4 dna synthesis and may be involved in phage morphogenesis. the new data indicate that the inhibition of polyamine synthesis is not primarily responsible for the l-conavanine-mediated inhibition of dna synthesis nor does it seem to be involved in the induction of lollipops. l-canavanine does influence the relative amounts of putrescine and spermidi ...	1975	1089803
host dna degradation after infection of escherichia coli with bacteriophage t4: dependence of the alternate pathway of degradation which occurs in the absence of both t4 endonuclease ii and nuclear disruption on t4 endonuclease iv.	escherichia coli cells infected with t4 phage which are deficient in both nuclear disruption and endonuclease ii exhibit a pathway of host dna degradation which does not occur in cells infected with phage deficient only in endonuclease ii. this alternate pathway of host dna degradation requires t4 endonuclease iv.	1975	1089802
initiation and transcription of a set of transfer ribonucleic acid genes in vitro.	using rna polymerase purified from escherichia coli, dna isolated from the bacteriophage t4, and a bacterial supernatant fraction containing the necessary processing enzymes, a set of transfer rnas can be formed in vitro. to characterize the site or sites of initiation of this trna transcription, rifampicin-resistant complexes of rna polymerase, dna, and either atp (utp and ctp) or gtp (utp and ctp) were formed, and trna was transcribed from these stabilized sites. it is concluded that transcrip ...	1975	1089654
fossa posterior measurements: significance of sella to floor of 4th ventricle measurements (normal position of floor of 4th ventricle).	two proportional methods are introduced to determine the normal position of the floor of the 4th ventricle expressed by two preventricular ratios: (see article); where ds = dorsum sellae, ts = tuberculum sellae and tw = twining's line. t4 is the intersection between tw and the floor of the 4th ventricle. the methods give information of the position of the 4th ventricle, the diameter of pons and the a-p diameter of the pituitary fossa.	1976	1087713
immunospecific labeling of mouse lymphocytes in the scanning electron microscope.	bone marrow-derived (b) and thymus-derived (t) balb/c mouse lymphocytes were identified in the scanning electron microscope (sem) by the immunospecific attachment of one of several kinds of large-molecular-weight markers distinguishable in sem. these markers (tobacco mosaic virus, keyhole limpet hemocyanin, bushy stunt virus, and bacteriophage t4) could be modified with hapten groups and linked with anti-hapten antibody, in an indirect (sandwich) scheme, to hapten-modified anti-cell-surface anti ...	1976	1087366
thyroxine (by competitive protein binding analysis) in human and cow milk and in infant formulas.	in 45 mothers of full term infants the level of thyroxine (t4) in serum (45 samples) and unskimmed milk (92 samples) was estimated with the aid of competitive protein binding analysis. on the 3rd day after delivery the t4 level in serum was found to be 11.1 +/- 0.4 mug/100 ml, while that in milk was 1.3 +/- 0.3 mug/100 ml. during following days of lactation the t4 concentration in sera decreased. in contrast, however, a gradual increase of the t4 content in milk was observed. the serum and milk ...	1976	1086202
effect of azathioprine on in vitro antibody response. differential effect on b cells involved in thymus-dependent and independent responses.	the effect of azathioprine (az) on the primary in vitro antibody response of mouse spleen cell cultures has been studied. the response towards t cell-dependent antigens is suppressed by low az concentrations (50% inhibition by 10(-2) mug/ml and 100% suppression by 10(-1) mug/ml). the same pattern is observed when az addition is delayed until day 2, but the suppression is absent or partial when az is added on day 3. in the early period (day 0 to day 1) the effect of az is reversible upon addition ...	1975	1082392
binding of thyroxine and triiodothyronine by nuclei of isolated tadpole liver cells.	the binding of l-triiodothyronine (t3) and l-thyroxine (t4) to cytoplasm and nuclei has been studied in isolated rana catesbeiana tadpole liver cells. nuclear binding for both thyroid hormones occurred more slowly at 4 c than at 25 c, but reached the same level as at 25 s. scatchard analyses suggest high affinity, saturable binding sites for both hormones in the nuclear but not in the cytoplasmic fraction. apparent equilibrium dissociation constants were 6.8 x 10(-10)m and 4.6 x 10(-10)m for t3 ...	1975	1081451
binding by thyroid hormones by nuclei of cells from bullfrog tadpole tail fins.	the regression of the tadpole tail is under the direct control of the thyroid hormones and offers a unique system for the study of the action of these hormones. we have examined the binding of l-triiodothyronine (t3) and l-thyroxine (t4) in vitro using tail fin bricks which included epidermal and connective cells. the binding of 125i-labeled hormones was followed in both nuclear and extranuclear fractions. high affinity and limited capacity sites for t3 and t4 were observed only for the nuclear ...	1975	1081450
further studies of dna damage and lethality from the decay of iodine-125 in bacteriophages.	the dna of coliphages t4 and t1 was labelled with 125i-iododeoxyuridine. 125i decay is known to cause severe molecular damage via vacancy cascades (the auger effect). we have compared the induction of both single- and double-strand breaks (ssbs and dsbs) in 125i-labelled t4 dna stored at - 196 degrees c during decay, either as intact phage or as free dna. these comparative experiments indicate that, in addition to one dsb which apparently results directly from the auger effect, each decay in an ...	1975	1081081
thyroid state and brain monoamine metabolism.	the rates at which rat brain synthesizes catecholamines and serotonin were estimated by measuring the accumulation of dopa and 5-hydroxytryptophan (5-htp) 45 min after ip administration of the decarboxylase inhibitor ro4-4602 (800 mg/kg bw). following thyroparathy-roidectomy, hypothyroid rats showed a decreased accumulation of both precursor amino acids. on the other hand, hyperthyroidism (caused by administering 15 mug t4/100 g bw for 25 days) accelerated the accumulation of catecholamines and ...	1975	1081048
[spino-thalamic cordotomy in cancerous pain. results of a series of 124 patients operated on by the direct posterior approach].	the authors -- about a series of 124 cancerous patients treated during the 12 last years with open spino-thalamic cordotomy for intractable pain -- have tried to evaluate effectiveness of the operation with regard to its levels in relation to the site of pain. patients suffering median or bilateral perineo-pelvic pain, isolated or associated with algias in one or both legs (group i: 50%) underwent a bilateral c8-c6 cordotomy in one stage. patients with the same perineo-pelvic cancers but sufferi ...	1976	1071136
protein cleavage during virus assembly: a novel specificity of assembly dependent cleavage in bacteriophage t4.	cleavage of precursor proteins occurs during assembly of numerous viruses. seven bacteriophage t4 head-related proteins areknown to be cleaved during morphogenesis. sequences surrounding the cleavage sites in t4 head precursors p23 and ipiii are reported here. we previously determined the sequences of precursor and processed forms of ipii and ipi. cleavage occurs at a glutamyl-alanyl bond in each protein. by comparison of sequences around five cleaved and four uncleaved glu-ala bonds in head pre ...	1976	1069310
heat mutagenesis in bacteriophage t4: the transversion pathway.	heat induces transversions (as well as transitions) at g-c base pairs in bacteriophage t4. the target base for transversions is guanine,which is converted to a product which is sometimes replicated and transcribed as a pyrimidine.a model for this process is proposed in which the deoxyguanosine glycosidic bond migrates from n9 to n2: the resulting deoxyneoguanosine may pair with normal guanine to produce g-c leads to c-g transversions.	1976	1069305
a gene of bacteriophage t4 whose product prevents true late transcription on cytosine-containing t4 dna.	t-even coliphages have 5-hydroxymethylcytosine in their dna instead of cytosine. in some t4 mutants, the replicated dna contains cytosine, but then no late gene products are made. we show that the inability to make late gene products with cytosine-containing t4 dna is due to a t4 gene products. this gene product, while probably nonessential under normal conditions, interacts with an essential part of the transcription apparatus. mutations in this gene allow viable t4 particles to be made whose d ...	1976	1067605
[normal levels of total t3 and t4 in the 1st week of life determined by radioimmunoassay].		1976	1065336
simultaneous initiation of synthesis of bacteriophage t4 dna and of deoxyribonucleotides.	in earlier reports we have suggested that bacteriophate t4 dna replication occurs in a complex composed of the proteins required for polymerization and the system of enzymes synthesizing the deoxyribonucleoside triphosphate precursors of dna. t4-induced dcmp hydroxymethylase and dtmp synthetase, though demonstrable in extracts soon after infection, are not active in vivo until about 5 min. the in vivo activities increase exponentially for approximately 15 min and then become constant. we have su ...	1976	1062786
t4 thyrotoxicosis with normal or low serum t3 concentration.	eight patients are described with elevated plasma thyroxine (t4) concentrations, but normal or low plasma triiodothyronine (t3) concentrations by radioimmunoassay. all were suffering also from non-thyroidal illness, which in six cases was severe, and in two fatal. the two patients in reasonable general health were acromegalic. it is possible that in sick thyrotoxic patients there is an impairment of peripheral conversion of t4 to t3, similar to that occurring in sick euthyroid patients. however, ...	1975	1061545
reconstruction of bacteriophage t4 dna replication apparatus from purified components: rolling circle replication following de novo chain initiation on a single-stranded circular dna template.	the protein products of t4 bacteriophage genes 41, 43, 45, 44, and 62 have been purified to near homogeneity using an assay which measures their stimulation of dna synthesis in a crude lysate of escherichia coli cells in fected by an appropriate mutant phage. when all of these proteins and t4 gene 32 protein are incubated in the presence of deoxyribonucleoside and ribonucleoside triphosphates, extensive dna synthesis occurs on both single and double-stranded dna templates. analysis of this in vi ...	1975	1061070
use of gene 32 protein staining of single-strand polynucleotides for gene mapping by electron microscopy: application to the phi80d3ilvsu+7 system.	a method for visualizing rna-dna duplex regions along a single strand of dna in the electron microscope is described. a preparation of rna molecules is hybridized to a long dna strand containing the coding sequences (genes) for some of the rnas. t4 gene 32 protein, which binds selectively and cooperatively only to the single-strand regions, is added, followed by glutaraldehyde. the resulting nucleic acid-gene 32 complex is adsorbed to the surface of an electron microscope grid in the presence of ...	1975	1060131
characterization of dna condensates induced by poly(ethylene oxide) and polylysine.	high-molecular-weight dna is known to collapse into very compact particles in a salt solution containing polymers like poly(ethylene oxide) [(eo)n] or polyacrylate. the biological relevance of this phenomenon is suggested by our recent finding that high concentrations of the highly acidic internal peptides found in the mature t4 bacteriophage head, as well as poly(glutamic acid) and poly(aspartic acid), can collapse dna in a similar manner. the structure of dnas collapsed by various methods has ...	1975	1060108
mutants of t7 bacteriophage inhibited by lambda prophage.	mutants in gene 20, a new t7 gene, cannot grow on rex+ lambda lysogens. gene 20-- mutants suppress in double mutants the phenotype of t7 ligase negative mutations, but not vice versa. amber 20- mutants have been obtained. there are differences between these t7 mutations and the similar t4 rii mutations. there are host mutations which permit t7 20- mutants to grow on lambda+ lysogens. t7 dna synthesis on normal lambda+ lysogens infected with 20- mutants is essentially normal, but the dna is not p ...	1975	1059155
thylakoid membrane polypeptides of chlamydomonas reinhardtii: wild-type and mutant strains deficient in photosystem ii reaction center.	unstacked thylakoid membrane vesicles were obtained from a homogenate of chlamydomonas reinhardtii by flotation in a 1.8 m sucrose layer containing 5 mm hepes (n-2-hydroxyethylpiperazine-n-2-ethanesulfonic acid)-10 mm edta (ph 7.5). sodium dodecyl sulfate-gradient gel electrophoresis showed that the wildtype membranes have a total of at least 33 polypeptides ranging in molecular weights from 68,000 to less than 10,000. the wild-type and three non-photosynthetic mutant strains were studied with r ...	1975	1056023
genetic evidence for an additional function of phage t4 gene 32 protein: interaction with ligase.	gene 32 of bacteriophage t4 is essential for dna replication, recombination, and repair. in an attempt to clarify the role of the corresponding gene product, we have looked for mutations that specifically inactivate one but not all of its functions and for compensating suppressor mutations in other genes. here we describe a gene 32 ts mutant that does not produce progeny, but in contrast to an am mutant investigated by others, is capable of some primary and secondary dna replication and of formi ...	1975	1055398
physico-chemical and biological study of excision-repair of uv--irradiated phix174 rf dna in vitro.	we have studied excision-repair of uv-irradiated phix174 rfi dna in vitro with uv-specific endonuclease from micrococcus luteus (uv-endo), dna polymerase i from escherichia coli and dna ligase from phage t4 infected e. coli. excision-repair was measured a) by physico-chemical methods, i.e. by determination of the conversion of rf i dna into rf ii dna by uv-endo and by the subsequent conversion of rf ii dna ligase, b) by biological methods i. e. by measuring the ability of the reaction product to ...	1975	1052535
[advantages, disadvantages and selection methods of thyroxine measurement--comparison of cpba and ria].	although recent progress in radioimmunoassay (ria) permitted direct ria for thyroxine (t4), there appeared few reports evaluating clinical applicability of t4 ria as routine method. the authors evaluated advantage, disadvantage of methods for t4 measurement in comparison between cpba (competitive protein binding analysis) and ria, and tried to discuss about selection of methods for t4 measurement. res-o-mat t4 was chosen as cpba, and riamat-t4(st) and t4-riakit(sp) were chosen as rias. detailed ...	1976	1037403
[basic and clinical evaluation of thyroxine radioimmunoassay kit. ii: riamat t4 kit (author's transl)].		1976	1037320
dynamic study of post-natal thyroid function in the rat.	the thyroid function in development was investigated in post-natal rats. the thyroid iodine content rapidly increased from birth (137 +/- 26 ng iodine/mg thyroid) up to day 10 (338 +/- 42 ng iodine/mg thyroid) then increased more slowly up to day 30 (425 +/- 34 ng iodine/mg thyroid). the maximal plasma concentration of thyroxine was observed on day 16 (56.9 +/- 3.5 ng t4/ml) and of iodide on day 10 (110.2 +/- 12.6 ng i-/ml). the turnover rate constant of extrathyroidal thyroxine was higher at bi ...	1976	1036648
thyroid hormone response to varying doses of tsh.	fifty-five normal subjects were studied following intravenous injection of increasing doses of bovine thyrotropin (b-tsh) from 0.5 to 250 mu/kg. serum triiodothyronine (t3) and thyroxine (t4) were measured 1, 2, 3 and 4 h after the tsh injection. dose-related increments in serum t3 and t4 were demonstrated with doses of b-tsh = 2.5 mu/kg and a maximum response was obtained after approximately 100 mu/kg. the fractional increase in serum t3 was greater than in serum t4, but the ratio between the i ...	1976	1036647
[serum thyroxine determination with t4 ria kit].		1976	1034531
[distinction in clinical application of various thyroid hormone tests (t4, t3, t3 absorption test, and free t4 index)].		1976	1034522
diagnosis of prolactin-secreting pituitary microadenoma.	four women with secondary amenorrhea associated with hyperprolactinemia were studied. baseline hormonal evaluation, including serum fsh, serum lh, tsh, t3, t4, and plasma cortisols were normal. plain sella turcia x-rays were also normal. prolactin-secreting pituitary microadenomas were found in all of the patients only after further diagnostic studies were done. these studies included polytomography of the sella turcia, dynamic pituitary testing of growth hormone reserve, acth reserve, gonadotro ...	1976	1033671
neuroendocrine and electroencephalographic sleep changes due to acute amphetamine ingestion in human beings.	amphetamine, a clinically used sympathomimetic central-acting drug, was administered in spansule capsules in a blind schedule to 8 normal obse volunteers in a daily (8 a.m.) single 15 dose for 7 days. the study, conducted in the metabolic ward, included two 7 day placebo periods (pre- and post-drug). during the 1st placebo period, all subjects exhibited within the 1st 2 h of sleep a clear and significant nocturnal increase of growth hormone (gh) closely related with sleep stages 3 and 4. thyrotr ...	1976	1030786
[connections between inspiratory medullary neurons and phrenic or intercostal motoneurones (author's transl)].	10 the activity of 107 medullary inspiratory neurones has been recorded extracellularly in anesthetized cats (urethane-chloralose). according to their localization in the medulla and to their axonal pathways (tested by antidromic activation), these neurones were classified as: bulbo-spinal neurones (nbsi) which send their axons to the spinal cord; they are located in the dorsal or the ventral respiratory nucleus; propriobulbar neurons (npbi) whose axons are probably entirely located within the m ...	1976	1030738
a rational approach to "in vitro" thyroid function testing.	a system of "in vitro" thyroid function testing is proposed whereby laboratory staff select the most appropriate screening test depending on the information supplied by the clinician. total serum triiodothyronine (t3) or thyroxine (t4) are used for screening as appropriate. in borderline cases, secondary tests are performed automatically according to a flow chart. this system improves efficiency and is cost effective, saving approximately 1,800 pounds annually in a laboratory handling about 5,00 ...	1976	1030665
[comparison of the diagnostic efficacy of various in vitro tests for the study of thyroid performance (author's transl)].	discriminating analysis was employed in an evaluation of the diagnostic efficacy of individual in vitro tests of thyroid performance (t3 resin uptake, t4, fti, etr) and pb131i determination, and their combinations, when used for the differentiation of euthyroid, basedow hyperthyroid, hyperfunctioning autonomous adenoma, and hypothyroid cases. the results are discussed with reference to optimization of the data: radiation dose ratio.	1976	1027046
clinical study on early changes in thyroid function of hyperthyroidism treated with propylthiouracil and a relatively small dose of iodide.	in order to compare the acute effects of three kinds of antithyroid agents of iodide (i-), propylthiouracil (ptu) and ptu combined with iodide (ptu+i-) on thyroid function in hyperthyroid patients with diffuse goiter, serum concentrations of thyroxine (t4), triiodothyronine (t3), t3-resin sponge uptake (t3-ru) and free thyroxine index (ft4i) were employed as thyroid function parameters. in the group given iodine (1 mg/day) as iodinated-lecithine, the initial values of t4, t3, t3-ru and ft4i were ...	1976	1024041
dna replication and head assembly in bacteriophage t4.	phage dna was accumulated in cells of e. coli b, infected with the phage t4dtslb3 (gene 42), without the synthesis of late proteins (in the presence of chloramphenicol). then (stage ii), chloramphenicol was removed and further replication of the phage dna suppressed with hydroxyurea and by simultaneously raising the temperature to 40 degrees. the media m9 or m9 with 1% amino acid were used; the times of addition of chloramphenicol and the hydroxyurea concentration were also varied. it was also s ...	1976	1023049
influence of antibodies against dna on the renaturation of dna.	the treatment of denatured t4 phage dna with antiserum for the dna of this phage, containing antibodies against glucosylated 5-hydroxymethylcytosine, decreases the ability of dna for renaturation. the greatest inhibiting activity is possessed by antiserum for t4 phage dna irradiated with uv light, which contains antibodies not only against glucosylated 5-hydroxymethylcytosine, but also against the usual nitrogen bases. antiserum against e. coli dna, containing antibodies to the usual nitrogen ba ...	1976	1023048
electron-microscopic study of the serological affinity between the antigenic components of phages t4 and ddvi.	in an investigation of the antigenic fine structure of phages t4 and ddvi with the use of the neutralization reaction and electron-microscopic observation of the phage-antibody complexes, it has been possible to establish that the head of phage t4 consists of proteins which have antigenic determinants of two types: the first type is identical to the antigens of the head of phage ddvi, and the second type is apparently absent in phage ddvi. the phage ddvi head contains mostly determinants which a ...	1976	1023046
[in vitro thyroid diagnosis in surgery of the thyroid].	after a brief outline of the physiology of the thyroid hormones and the laboratory tests measuring thyroid function, the dosage of normalised t4 (t4n) in patients suffering from various thyroid diseases and subjected to surgical operation is discussed. as the fundamental presupposition of thyroid surgery is that the operation is made in conditions of euthyroidism, the use of a quick and reliable preoperative test giving an exact evaluation of the patient's thyrometabolic conditions is necessary. ...	1976	1021298
[new method of solid phase radioimmunologic determination of total serum thyroxine compared with the competitive technic (t4-test)].		1976	1017126
an increase of liver uptake of thyroxine, an initial step of an increased fecal loss of thyroxine in response to propylthiouracil in rats.	propylthiouracil augmented fecal loss of thyroxine (t4), but methimazole was without effect in this respect in rats. in vitro uptake of labeled t4 by the liver was significantly enhanced by a small amount of propylthiouracil in the presence of dilute rat plasma. methimazole was without effect under comparable conditions. in contrast, propylthiouracil and methimazole failed to affect in vitro uptake of labeled t4 by the kidney and diaphragm in the presence of dilute rat plasma. since deiodination ...	1976	1015911
blood levels of 3,5,3'-triiodothyronine and thyroxine: differences between children, adults, and elderly subjects.	the serum levels of 3,5,3'-triiodothyronine (t3) and thyroxine (t4) in children, adolescents, adults, and elderly subjects have been measured by radioimmunoassays. it was found that while the t4 levels were essentially equal in all age groups examined, the t3 levels were markedly different. in children and adolescents (1-15 years), high values were recorded; indeed, they exceeded the upper normal limit in adults (20-80 years). from the age of 20, the t3 levels remained unaltered until the age of ...	1976	1015359
roentgen findings in fractures of the vertebral column in childhood examination of 35 patients and its results.	in the past 10 years we examined 35 children with fractures of the spine. the most important cause was an injury by a fall from a tree or a climbing stage (23 cases). traffic accidents or other direct trauma was the cause in 10 patients. two children had tetanus, the ages of the children range from 2 to 12 years. clinical symptoms may be diagnostic of vertebral trauma, but quite often symptoms are insignificant or atypical. we detected fractures in every vertebra of the thoracic and lumbar part ...	1976	1012792
effect of neighboring nucleotide sequences on suppression efficiency in amber mutants of t4 phage lysozyme.	variations in suppression efficiency were observed among nonsense mutations at different locations within the lysozyme gene (e) of t4 phage. the present experiments using three amber mutants in lysozyme gene indicate such variations presumably depend upon the base sequences neighboring to the nonsense mutations.	1976	1012265
screening thyrometabolic disorders using total serum thyroxine level.	the results of in-vitro thyroid function tests and clinical details of 1,517 patients are reviewed, and the total serum thyroxine levels and the free thyroxine indices are compared in terms of their diagnostic value. only 3-7% of the patients investigated had a total serum thyroxine level (t4) that did not correlate with the free thyroxine index. we believe that the evidence is strong enough to suggest that estimation of the t4 is an adequate screening test for thyrometabolic disease, and that p ...	1976	1012127
[twice daily fractioning : application in the irradiation of severe skin neoplasms (author's tranls)].	14 very extensive skin cancer (t4) were treated with twice daily x-ray therapy (5 days per week, total dose 6,000 to 8,000 rads). 13 successful results were seen with follow-up for more than 14 months.	1976	1011190
[need of thyroxine in chronic effects of growth hormone (gh) on phosphorus and calcium metabolism of female adult rat (author's transl)].	the object of the present work was to determine the part played by thyroxine (t4) in chronic effects of gh on phosphocalcium metabolism. therefore, we used hypophysectomized-thyroparathyroidectomized female rats. the results were that: 1. repeated daily administration of gh to female rats which had been operated on was not followed by the hyperphosphatemia classically observed in normal animals. gh always decreased urinary calcium and phosphorus excretion, indicating a direct renal effect of thi ...	1976	1011167
[simultaneous radioimmunassay for urinary thyroxine (t4) and triioldothyronine (t3) (author's transl)].	a radioimmunoassay for the determination of thyroxine (t4) and triiodothyronine (t3) in urine was developed. the extraction of a sample, the incubations with t3-und subsequently t4-antibody and the elutions of the respective bound fractions are performed all on the same sephadex column. this principle can be applied to as many as 120 simultaneous determinations. the interassay coefficients of variation were 20.1% for t3 and 10.6% for t4, respectively. the recovery of standards added to urine was ...	1976	1010989
assessment of thyroid hormone assays.	four techniques for estimating serum t4 and three for estimating serum t3 have been investigated and found to be satisfactory in routine use. normal ranges for each techniques have been established. estimation of serum t3 by the commerical kits tested appears to have a high discriminant value in the diagnosis of hyperthyroidism, although the diagnostic definition used inevitably enhances the apparent sensitivity of these techniques. estimation of serum t4 will identify the majority of patients w ...	1976	1010875
rice embryo cell-free system for the synthesis of t4 phage proteins.		1976	1010575
[new lambdoid phages of escherichia coli. ii. comparison of several genetic characteristics with lambda phages].	functions of some newly isolated lambdoid phages and phage lambda genes were compared by their ability to interact with unrelated phages and the product of the bacterial gene gro p. 19 of 23 lambdoid phages studied interfere with prophage p2, that points out the presence of functionally active genes, essential for spi+ phenotype in their genomes. the development of 4 lambdoid phages with spi- phenotype is independent on the prophage p2 presence. most of lambdoid phages show the reduced growth ab ...	1976	1010327
urinary thyroxine in rats fed various diets and in renal calcium stone-forming patients.	in rats fed with various diets as regard contents of magnesium, cholesterin, neutral fat, carbohydrates and proteins, urinary thyroxine (u-t4) appears low in general when compared with control chow, whereas renal calcifications and stones are absent only with the latter and the carbohydrate-rich diet. normalization of u-t4 is hampered by differences in urinary creatinine excretion and in individual weight gain. in male renal calcium stone patients (20--40 years) u-t4 also is lower than in age-ma ...	1976	1009977
measurement of serum 3,3',5'-(reverse) t3, with comments on its derivation.	a radioimmunoassay for the measurement of l-3,3',5'-triiodothyronine (reverse to, rt3) has been developed for use with unextracted serum. the highly specific antiserum showed no cross-reactivity with l-3,3'5-triiodothyronine (t3) or tetradiodothyroacetic acid (t4a) and cross-reaction with l-thyroxine (t4) was low enough to be discounted for routine assay purposes. if a normal amount of rt3 was added to serum t4 cross-reactivity decreased considerably. serial dilutions of hyperthyroid sera gave d ...	1976	1009677
the radioimmunoassay of 3,3',5' - triiodothyronine (reverse t3) in unextracted human serum.	a specific, sensitive and simple double antibody radioimmunoassay for total serum 3,3',5'-triiodothyronine (reverse t3, rt3) in small volumes of unextracted human serum is described. high titre antisera were raised in rabbits using dl=rt3 or l-rt3 conjugated to bovine serum albumin. the selected antisera cross reacted less than 0-003% with triiodothyronine (t3) and 0-14% with thyroxine (t4). a stable high activity rt3 tracer was prepared by iodination of 3,3"-diiodo-l-thyronine by the chloramine ...	1976	1009675
inhibition of conversion of thyroxine to triiodothyronine in patients with severe chronic illness.	many clinically euthyroid patients with severe, chronic, non-throidal illnesses (i.e. sick euthyroid patients) have very low circulating concentrations of total and absolute free triiodothyronine (t3), low-normal concentrations of total thyroxine (t4), elevated concentrations of absolute free t4, and circulating concentrations of thyrotrophin (tsh) that are either normal or subnormal. this study was undertaken to elucidate the mechanism of the low circulating t3 concentrations. the disappearance ...	1976	1009671