Publications
| Title | Abstract | Year Filter | PMID(sorted descending) Filter |
|---|
| stress, loneliness, and changes in herpesvirus latency. | this study used a prospective design to examine the influence of examination stress and loneliness on herpesvirus latency as measured by changes in antibody levels to three herpesviruses, epstein-barr virus (ebv), herpes simplex type i (hsv-1), and cytomegalovirus (cmv). three blood samples were obtained from 49 first-year medical students, with the first sample drawn 1 month before final examinations, the second on the first day of final examinations, and the third during the first week after t ... | 1985 | 3003360 |
| synergistic interaction between interferon-alpha and acyclovir in the treatment of herpes simplex virus type 1 infection in mice. | hairless mice were infected intracutaneously with hsv-1 and treated with rhuifn-alpha a/d, a recombinant dna-derived hybrid human interferon-alpha that is active on mouse cells in vitro and in vivo. when given alone (1 or 2 x 10(5) units/dose) at times soon after infection, interferon showed some efficacy, reducing disease severity by 20-30% compared to control. oral acyclovir was also effective in reducing disease severity in a dose-dependent manner, even when treatment was begun 72 h post-infe ... | 1985 | 3002258 |
| herpes simplex virus expressing epstein-barr virus nuclear antigen 1. | dna fragments containing an open reading frame known to encode most or all of the ebna1 protein of epstein-barr virus (ebv) were fused in the proper transcriptional orientation to the promoter regulatory domain, capping site, and a portion of the 5' transcribed noncoding sequences of the hsv-1 alpha 4 gene of herpes simplex virus 1 (hsv-1). in these constructs 20, 130, or 385 bp of ebv dna and 28 bp of hsv-1 dna separated the alpha 4 cap site from a putative initiator codon of the ebna1 gene. th ... | 1986 | 3002038 |
| recovery of herpesviruses from cerebrospinal fluid of immunodeficient homosexual men. | over a one-year period the cerebrospinal fluid (csf) obtained from a series of homosexual men immunocompromised with either hodgkin's disease or acquired immune deficiency syndrome (aids) was cultured to assess the frequency with which infectious viruses could be recovered. of 58 patients examined, 4 (6.9%) had csf cultures that showed a cytopathology consistent with a virus infection. all isolates proved to be herpesviruses. cytomegalovirus (cmv) and varicella-zoster virus were isolated from cs ... | 1985 | 3000285 |
| inhibition of herpes simplex virus type 1-induced interferon synthesis by monoclonal antibodies against viral glycoprotein d and by lysosomotropic drugs. | components of herpes simplex virus remained bound to the diploid cell membrane after nucleocapsid penetration into the cytosol. these components enabled the infected cells to induce interferon-alpha (ifn-alpha) in peripheral blood mononuclear cells even when the infected cells were fixed by glutaraldehyde. monoclonal antibodies directed against the major viral glycoprotein d could neutralize their ifn-alpha-inducing capacity. thus, the process of ifn induction does not require uptake and penetra ... | 1985 | 2999320 |
| effect of herpes simplex virus type 1 on cellular pools of oligosaccharide-lipid. | incorporation of [3h]mannose into cellular pools of mannosylphosphoryl dolichol (man-p-dol), oligosaccharide-lipid, and glycoprotein was measured and compared in herpes simplex virus type 1 (hsv-1)-infected cells and -uninfected cells. while mannose incorporation into the monosaccharide-dolichol fraction was similar in infected or uninfected vero cells, incorporation into the oligosaccharide-lipid fraction was markedly reduced in hsv-1-infected cells (64% of control levels). in contrast, mannose ... | 1985 | 2998058 |
| inhibition of herpes simplex virus replication in vitro by human cytotoxic t cell clones and natural killer cell clones. | the abilities of human cytotoxic t cell (ctl) clones and natural killer (nk) cell clones to inhibit the replication of herpes simplex virus (hsv) in vitro were shown. the specificities of clones inhibiting hsv replication were the same as those of cytotoxicity in hsv type specificity and hla restriction, i.e. hsv type 1 (hsv-1) and hsv type 2 (hsv-2) common ctl clones inhibited the replication of both hsv-1 and hsv-2 in autologous cells, but not in allogeneic cells. hsv-1-specific ctl clones inh ... | 1985 | 2995557 |
| herpes simplex virus 1 mutant deleted in the alpha 22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. | r325-beta tk+, a herpes simplex virus 1 mutant carrying a 500-base-pair deletion in the alpha 22 gene and the wild-type (beta) thymidine kinase (tk) gene, was previously shown to grow efficiently in hep-2 and vero cell lines. we report that in rodent cell lines exemplified by the rat-1 line, plating efficiency was reduced and growth was multiplicity dependent. a similar multiplicity dependence for growth and lack of virus spread at low multiplicity was seen in resting, confluent human embryonic ... | 1985 | 2991560 |
| cell-specific selection of mutants of a herpes simplex virus recombinant carrying deletions. | herpes simplex virus 1 (hsv-1) recombinant r316 was constructed so as to convert the thymidine kinase (tk), a beta gene, into an alpha-regulated gene by insertion of the bamhi n fragment in the proper transcriptional orientation into the bglii cleavage site of the tk gene (l. e. post, s. mackem, and b. roizman, cell 24, 555-565 (1981).) the bamhi n fragment contains the promoter and regulatory domains of the alpha 4 gene in addition to an origin of viral dna synthesis and the complete domain of ... | 1985 | 2990098 |
| [genetic transformation of somatic cells. iii. an analysis of the status of the plasmid nucleotide sequences in the extrachromosomal dna of transformant clone cells and the rescue of extrachromosomal molecules of the plasmid dna]. | extrachromosomal dnas from tk+ transformant clones of a238 chinese hamster cells isolated after the treatment with plasmid pst826 containing thymidine kinase gene (tk-gene) of herpes simplex virus (hsv1) and 1.8 kb insert of human satellite iii dna (hsiii) were studied by hybridization technique. in two tk+-clones (2t301 and 2t16) large quantities of rearranged plasmid dna molecules were found. electron microscopy show in clone 2t301 the presence of circular dnas with average length being 4.64 + ... | 1985 | 2990075 |
| vaccinia virus recombinant expressing herpes simplex virus type 1 glycoprotein d prevents latent herpes in mice. | in humans, herpes simplex virus causes a primary infection and then often a latent ganglionic infection that persists for life. because these latent infections can recur periodically, vaccines are needed that can protect against both primary and latent herpes simplex infections. infectious vaccinia virus recombinants that contain the herpes simplex virus type 1 (hsv-1) glycoprotein d gene under control of defined early or late vaccinia virus promoters were constructed. tissue culture cells infec ... | 1985 | 2986288 |
| fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus dna. | a strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (vzv) dna was found to be due to an insertion or deletion of dna sequences at a single site. dna sequence analysis showed that the nucleotide sequence ccgccgatggggagggggcgcggtacc is tandemly duplicated a variable number of times in different vzv strains and is responsible for the observed variation in mobilities of restriction fragments from this region of vzv dna. the variable ... | 1985 | 2985828 |
| purification of epstein-barr virus dna polymerase from p3hr-1 cells. | the epstein-barr virus dna polymerase was purified from extracts of p3hr-1 cells treated with n-butyrate for induction of the viral cycle. sequential chromatography on dna cellulose, phosphocellulose, and blue sepharose yielded an enzyme preparation purified more than 1,300-fold. the purified enzyme was distinct from cellular enzymes but resembled the viral dna polymerase in cells infected with herpes simplex virus type 1 or 2. the active enzyme had an apparent molecular weight of 185,000 as est ... | 1985 | 2985818 |
| an unusual spliced herpes simplex virus type 1 transcript with sequence homology to epstein-barr virus dna. | high-resolution transcription mapping localized a spliced 2.7-kilobase herpes simplex virus type 1 mrna. the 4-kilobase intron of this transcript encodes a nested set of transcripts on the opposite dna strand. the nucleotide sequence of the dna encoding the left-hand and right-hand exons of the spliced transcript was determined, and the salient features are presented here. of major interest is that both exons contained regions within several hundred bases of the splice donor and acceptor sites w ... | 1985 | 2985801 |
| herpes simplex virus vaccines--where are we? | 1985 | 2985314 | |
| herpes simplex virus type 1 infection of endothelial, epithelial, and fibroblast cells induces a receptor for c3b. | we recently demonstrated that herpes simplex virus type 1 (hsv 1) induces a receptor on human umbilical vein endothelial cells for complement component c3b (c3br). we assigned this receptor function to hsv 1 viral glycoprotein c (gc) based on several observations: tunicamycin, which prevents glycosylation and expression of n-linked glycoproteins on the surface of infected cells, markedly reduced expression of the c3br; monoclonal antibodies to hsv 1 gc blocked detection of the c3br, whereas mono ... | 1985 | 2982950 |
| binding site and subclass specificity of the herpes simplex virus type 1-induced fc receptor. | immunoglobulin fc-binding activity was detected by indirect immunofluorescence employing fluorochrome conjugated f(ab')2 antibody fragments on acetone-fixed cell cultures infected with herpes simplex virus type 1 (hsv-1). using this method the fc receptor-like activity seemed to be restricted to the igg class of human immunoglobulins. while igg1, igg2, and igg4 myeloma proteins bind to this putative fc gamma receptor at a concentration of 0.002 mg/ml, igg3 myeloma proteins were without activity ... | 1985 | 2982735 |
| membrane markers, target cell specificity, and sensitivity to biological response modifiers distinguish human natural cytotoxic from human natural killer cells. | in the present report, we provide evidence for the distinct existence of a human natural cytotoxic (hnc) cell. this hnc cell can be identified by the monoclonal antibody hnc-1a3 and by the absence of the t10 antigen, other antigenic markers being shared, at least in part, with natural killer (nk) cells, t cells, or monocytes. in addition, the hnc cell preferentially kills the ma-160 target, the herpes simplex virus-1-infected ma-160 cell line, and the two human tumor cell lines hep-2 and hf-2. i ... | 1985 | 2932473 |
| mutational specificities of 1'-acetoxysafrole, n-benzoyloxy-n-methyl-4-aminoazobenzene, and ethyl methanesulfonate in human cells. | we have used an orip-tk shuttle vector to determine the types of mutations induced in human cells by ethyl methanesulfonate (ems), 1'-acetoxysafrole (acos), and n-benzoyloxy-n-methyl-4-aminoazobenzene (bzomab). plasmid dna was treated in vitro with mutagen and electroporated into human lymphoblastoid cells. after replication of the vector in human cells, plasmids were analyzed for mutations in the herpes simplex virus type 1 thymidine kinase gene. ethyl methanesulfonate induced predominantly gc- ... | 1989 | 2927421 |
| identification and nucleotide sequence of the glycoprotein gb gene of equine herpesvirus 4. | the nucleotide sequence of the glycoprotein gb gene of equine herpesvirus 4 (ehv-4) was determined. the gene was located within a bamhi genomic library by a combination of southern and dot-blot hybridization with probes derived from the herpes simplex virus type 1 (hsv-1) gb dna sequence. the predominant portion of the coding sequences was mapped to a 2.95-kilobase bamhi-ecori subfragment at the left-hand end of bamhi-c. potential tata box, cat box, and mrna start site sequences and the translat ... | 1989 | 2915378 |
| induction of chromosomal aberrations in human cells by a temperature-sensitive mutant of herpes simplex virus type 2 and its revertants. | the induction of chromosomal aberrations by a temperature-sensitive (ts) mutant of herpes simplex virus type 2 (hsv-2) strain hg52 (ts 13), its revertants 4-8 and 5-8 and by etalon strains hsv-1 17 syn+ and hsv-2 hg52 was studied in human fibroblast and lymphocyte cultures. the effect on chromosomes of the revertants was tested at permissive (31 degrees c) and non-permissive (38 degrees c) temperatures. at 38 degrees c the revertants could not induce dnase activity. the present results contribut ... | 1986 | 2874732 |
| organization of cytoskeleton elements during herpes simplex virus type 1 infection of human fibroblasts: an immunofluorescence study. | cultured human fibroblasts showed a typical fibrillar organization of microtubules in immunofluorescence, including the vimentin type of intermediate filament as well as actin-containing microfilaments. during infection with herpes simplex virus type 1 (hsv-1), the vimentin organization was maintained whereas actin, myosin and tubulin showed a progressive association with the viral glycoproteins within juxtanuclear structures. these structures could also be revealed with fluorochrome-coupled whe ... | 1986 | 2868069 |
| molecular analysis of mutations induced in human cells by n-ethyl-n-nitrosourea. | mutational activation of cellular proto-oncogenes is an important event in the pathogenesis of chemically induced tumors. we have used the ori p-tk shuttle vector, phet, to analyze the types of dna sequence changes induced after treating mammalian cells with the carcinogen n-ethyl-n-nitrosourea (enu). this shuttle vector contains the putative replication origin of the epstein-barr virus (ebv) and is stably maintained as a plasmid in ebv-transformed human lymphoblastoid cells. populations of plas ... | 1988 | 2855602 |
| antiherpesvirus activity and mechanism of action of indolo-(2,3-b)quinoxaline and analogs. | the antiherpesvirus activity of 14 derivatives of indoloquinoxaline was tested. the most active was 2,3-dimethyl(dimethylaminoethyl)5h-indolo-(2,3-b)quinoxaline, also called b-220. the antiherpesvirus mechanism of b-220 was sought. the compound inhibited replication of herpes simplex virus type 1, cytomegalovirus, and varicella-zoster virus in tissue culture at concentrations of 1 to 5 microm, depending on the cell type used for assay and the amount of virus. cellular toxicity was seen at a conc ... | 1988 | 2855298 |
| antibody to cloned hsv glycoproteins b and d plus adult human leukocytes protect neonatal mice from lethal hsv infection. | antisera produced by hsv infection or following vaccination of guinea pigs with the cloned herpes simplex virus (hsv) glycoproteins gb and gd were compared for in vitro antibody-dependent cellular cytotoxicity (adcc) activity and for in vivo protection. antibody from guinea pigs was able to participate in adcc with human mononuclear cells in vitro, anti-gbgd serum being equivalent to hsv convalescent sera. in vivo, each of the guinea pig sera was able to protect neonatal mice from a fatal hsv-1 ... | 1988 | 2854958 |
| differences in the mechanism of induction of interferon-alpha by herpes simplex virus and herpes simplex virus-infected cells. | the cellular source of ifn alpha after induction with herpes simplex virus type-1 (hsv) and hsv-infected fibroblasts was investigated by using human peripheral blood mononuclear cell (pbmc) populations, purified according to conventional procedures, and which included t- and b-lymphocytes as well as monocytes. it appears that the cells responding to hsv virions are monocytes, whereas the pbmc population induced by hsv-infected cells is represented by b-lymphocytes. furthermore, by using monoclon ... | 1988 | 2850784 |
| interaction of herpes simplex virus type 2 with a rat glioma cell line. | the interaction between herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) and two neural cell lines, mouse neuroblastoma (n1e-115) and rat glioma (c6-bu-1), was investigated. n1e-115 cells were permissive to both types of hsv. in c6-bu-1 cells, on the other hand, all the hsv-1 strains tested so far showed persistent infection, and the infectious virus of hsv-2 strains disappeared spontaneously. the hsv-2-infected c6-bu-1 cells were positive for hsv-2-specific dna sequences, virus-specific r ... | 1988 | 2850449 |
| interferon inhibits herpes simplex virus-specific translation: a reinvestigation. | reports on the arrest of herpes simplex virus type 1 (hsv-1) replication by interferon (ifn) are inconsistent. by the use of immunofluorescence and immunoblot assays with monoclonal and polyclonal antibodies, effective arrest of viral translation by human ifn-alpha in human fibroblasts was detected for the hsv-1 strains kos and mcintyre. in hela cells which are less sensitive to ifn inhibition and in 444 cells, a hela-fibroblast hybrid cell line, the inhibition was less pronounced. these results ... | 1988 | 2848929 |
| antiviral activities of guanosine analogs in guinea pig embryonic fibroblasts. | previous research has shown that certain antiherpes substances which are activated by thymidine kinase are substantially more active in human fibroblasts than in green monkey kidney cells. the difference has been attributed to the presence of large amounts of intracellular thymidine in the latter cell type. antiviral guanosine analogs but not thymidine analogs show decreased antiviral activity when used in herpes simplex virus type 1-infected guinea pig fibroblasts. we report the intracellular p ... | 1988 | 2847633 |
| enhanced thrombin generation and platelet binding on herpes simplex virus-infected endothelium. | atherosclerotic lesions have been reported to contain herpes simplex virus 1 (hsv-1) genomic material. this, and other previous evidence, suggests that latent viral infection may be an atherogenic trigger. moreover, active hsv-1 lesions manifest marked fibrin deposition in microvessels. in this report we show that very early infection of human endothelial cells with hsv-1 appears to alter surface conformation as detected by merocyanine 540 staining. concomitantly, the efficiency of prothrombinas ... | 1988 | 2847155 |
| activation of the human immunodeficiency virus long terminal repeat by herpes simplex virus type 1 is associated with induction of a nuclear factor that binds to the nf-kappa b/core enhancer sequence. | it has been previously shown that herpes simplex virus type 1 (hsv-1) infection of hela cells results in augmentation of gene expression directed by the human immunodeficiency virus (hiv) long terminal repeat (ltr). this effect is presumably mediated by protein interactions with the ltr. we have used two different assays of dna-protein interactions to study the hsv-induced activation of the hiv ltr. activation of the hiv ltr is associated with increased protein binding to ltr sequences in a regi ... | 1988 | 2845125 |
| detection of herpes simplex virus type 1 in herpetic ocular diseases by dna-dna hybridization using a biotinylated dna probe. | a diagnostic hybridization assay for detecting herpes simplex virus type 1 (hsv-1) in ocular specimens was developed using cloned viral dna as a probe. this hybridization assay is based on visualizing a biotinylated probe that is hybridized to the target dna by a streptavidin/alkaline phosphatase system. the time required for performing this assay system is only two days. this assay system could detect a probe which had been hybridized to as little as 1 pg of homologous dna and did not cross-rea ... | 1988 | 2844977 |
| absence of induction of enhanced reactivation of herpes simplex virus in cells from xeroderma pigmentosum patients without skin cancer. | the time course of appearance of enhanced reactivation (er) and enhanced mutagenesis (em) of herpes simplex virus type 1 were studied in uv-irradiated stationary cultures of xeroderma pigmentosum (xp) fibroblasts. in some of the xp cells em followed similar kinetics of appearance as er. maximal activities occurred when infection was delayed 1 or 2 days after cell treatment. however, in certain xp cells only induction of the em response was observed, whereas er was absent. interestingly, the latt ... | 1988 | 2844398 |
| genomic location of bovid herpesvirus type 2 nucleotide sequences homologous to five herpes simplex virus type 1 genes. | the location of nucleotide sequences within the bovid herpesvirus 1 (bhv-2) genome homologous to herpes simplex virus 1 (hsv-1) dna were investigated. bhv-2 dna was digested with restriction endonucleases and blotted to nitrocellulose paper. the blots were then probed with plasmids containing hsv-1 genes for thymidine kinase (tk), the major dna binding protein (icp8), the major capsid protein (vp5) and genes for hsv-1 glycoproteins gb, gd, and gc. except for hsv-1 gc, each hsv-1 gene tested hybr ... | 1988 | 2842979 |
| mutational dissection of the hsv-1 immediate-early protein vmw175 involved in transcriptional transactivation and repression. | vmw175 is one of five immediate-early (ie) proteins encoded by herpes simplex virus type-1 (hsv-1). it is required for the transcription of later classes of genes and for the accompanying repression of ie expression. vmw175 has been shown to be a transactivator of transcription and also to autoregulate its own synthesis. we have made a large number of small, in-frame, insertion and deletion mutants of a plasmid-borne copy of the gene encoding vmw175. study of the activity of the resultant mutant ... | 1988 | 2842944 |
| antigenic analysis of a major neutralization site of herpes simplex virus glycoprotein d, using deletion mutants and monoclonal antibody-resistant mutants. | herpes simplex virus glycoprotein d is a component of the virion envelope and appears to be involved in attachment, penetration, and cell fusion. monoclonal antibodies against this protein can be arranged in groups on the basis of a number of biological and biochemical properties. group i antibodies are type common, have high complement-independent neutralization titers, and recognize discontinuous (conformational) epitopes; they are currently being used in several laboratories to study the func ... | 1988 | 2841479 |
| synthesis and antiviral activity of certain 4-substituted and 2,4-disubstituted 7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidines. | treatment of the sodium salt of 4-chloro-2-(methylthio)pyrrolo[2,3-d]pyrimidine (2) with (2-acetoxyethoxy)methyl bromide (3) has provided 4-chloro-2-(methylthio)-7[(2-acetoxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (4). ammonolysis of 4 at room temperature gave 4-chloro-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (5). however, ammonolysis of 5 at 130 degrees c furnished 4-amino-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]-pyrrolo[2,3- d]pyrimidine (6), which on desulfurizati ... | 1988 | 2840500 |
| methyl gallate, methyl-3,4,5-trihydoxybenzoate, is a potent and highly specific inhibitor of herpes simplex virus in vitro. ii. antiviral activity of methyl gallate and its derivatives. | methyl gallate (mg), methyl-3,4,5-trihydroxybenzoate, was highly active against herpes viruses as determined by plaque reduction assay. herpes simplex virus type 2, ms strain, was sensitive to mg at a mean 50% inhibitory concentration (ic50) of 0.224 micrograms/ml in monkey kidney cells. mg was specific for herpes viruses with the relative sensitivity hsv-2 greater than hsv-1 greater than cmv. two rna viruses tested were significantly less sensitive to mg. the structural components of mg which m ... | 1988 | 2840133 |
| the human mhc-restricted cellular response to herpes simplex virus type 1 is mediated by cd4+, cd8- t cells and is restricted to the dr region of the mhc complex. | the nature of the in vitro human cytotoxic t-cell responder population to hsv type 1 (hsv-1) was studied. in 5-day hsv-1-stimulated cultures that contained mhc-restricted activity, two phenotypically distinct populations of cells were present that were capable of lysing hsv-1-infected b cell lines in a 5-h 51cr-release assay. the first was cd4+, cd8-, cd16- cell typical of class ii-restricted t cells, whereas the other population bore a cd4-, cd8-, cd16+ nk-cell phenotype. elimination of the nk ... | 1988 | 2834445 |
| comparative study on o-linked oligosaccharides of glycoprotein d of herpes simplex virus types 1 and 2. | glycoproteins d1 (gd1) and d2 (gd2) of herpes simplex virus type 1 and type 2, respectively, were purified from infected hep-2 cells labelled with [3h]glucosamine for 14 h followed by a 3 h chase using hd1 monoclonal antibody linked to sepharose. o-linked oligosaccharides were found to be present in both glycoproteins. the identification of n-acetyl [3h]galactosaminitol as the major labelled component in the oligosaccharides generated by mild alkaline borohydride treatment demonstrated that thes ... | 1988 | 2833570 |
| effects of herpesvirus infections on the chemiluminescence induced by zymosan phagocytosis in mouse peritoneal macrophages. | the chemiluminescence (cl) induced by zymosan phagocytosis was tested in mouse peritoneal macrophages infected with three different types of herpes viruses: herpes simplex type-1 (hsv-1), human cytomegalovirus (hcmv) and murine cytomegalovirus (mcmv). the intensity of cl was tested in various intervals of virus infections. in the first eight hours zymosan induced chemiluminescence decreased in all the three systems. by the 24th hour, the macrophages infected with hcmv had almost completely recov ... | 1987 | 2830762 |
| regulated expression of stably transfected herpes simplex virus thymidine kinase genes in continuous cell lines expressing a temperature-sensitive mutant form of the immediate-early protein icp4. | we stably transfected the herpes simplex virus type 1 thymidine kinase gene into a continuous cell line expressing a temperature-sensitive form of the viral immediate-early protein icp4. in these cells, expression of the thymidine kinase gene was regulated in a temperature-sensitive manner, partially reproducing the controls that operate during a viral infection. | 1988 | 2829431 |
| photodynamic therapy of viral contaminants with potential for blood banking applications. | a photodynamic method has been evaluated as a means of eradicating viral contaminants with the potential for rendering blood safe for transfusion. herpes simplex virus type 1 (hsv-1) was tested under flowing conditions in culture media or in blood supplemented with the virus. hematoporphyrin derivative was used as the sensitizer and was photoactivated with visible light at 630 nm and 5 j/cm2. hsv-1 in suspension both in culture medium as well as in blood was shown to be killed. the human immunod ... | 1988 | 2829396 |
| synthesis and biological activities of 4-o-(difluoromethyl)-5-substituted-uracil nucleoside analogues. | various 4-o-difluoromethyl analogues of 5-substituted uridine (urd), 2'-deoxyuridine (durd), and arabinofuranosyluracil (arau) nucleosides were prepared via a cf2-insertion reaction into 4-o-silylated nucleosides and evaluated for activity against herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) and cytotoxicity in human embryonic lung fibroblast (helf) cell cultures. the introduction of the 4-substituent led to a strong reduction of antiviral activity for durd but not for arau analogues. ... | 1988 | 2828623 |
| antibodies against synthetic peptides of herpes simplex virus type 1 glycoprotein d and their capability to neutralize viral infectivity in vitro. | peptides corresponding to residues 1-13, 9-21, 18-30, 82-93, 137-150, 181-197, 232-243, 235-243, 267-281, 271-281 and 302-315 of glycoprotein d of herpes simplex virus type 1 (hsv-1) were chemically synthesized. these peptides were coupled to carrier proteins, and the resulting conjugates were used to immunize rabbits. an enzyme-linked immunosorbent assay was used to determine antipeptide antibody titers in serum collected after immunization. all peptides appeared to be immunogenic in rabbits. w ... | 1988 | 2826811 |
| ribonucleotide reductase induced by varicella zoster virus. characterization, and potentiation of acyclovir by its inhibition. | an enzyme that catalyzes the conversion of cdp to 2'-dcdp in the presence of dithiothreitol (dtt) was detected in ammonium sulfate fractionated-extracts of varicella zoster virus (vzv)-infected cells. this ribonucleotide reductase was antigenically distinguishable from the isofunctional eucaryotic enzyme as well as the ribonucleotide reductases induced by herpes simplex virus types 1 and 2 (hsv-1 and hsv-2). the vzv-induced enzyme was purified to the extent that most of the contaminating enzymes ... | 1987 | 2825724 |
| latent herpes simplex virus in human trigeminal ganglia. detection of an immediate early gene "anti-sense" transcript by in situ hybridization. | we used in situ hybridization to study the expression of herpes simplex virus type 1 genes during latent infections of human sensory ganglia. trigeminal ganglia were recovered at autopsy from 24 subjects with no evidence of an active herpetic infection. these ganglia were hybridized to 35s-labeled single-stranded rna probes spanning 72 percent of the herpes simplex genome. in the ganglia of 16 subjects, 0.2 to 4.3 percent of the neuronal cells contained abundant nuclear signals for viral rna. ga ... | 1987 | 2825014 |
| [(e)-5-(2-bromovinyl)-2'-desoxyuridine--a new nucleoside analog with selective inhibitory action against herpesviruses. studies in cell culture and animal experiments]. | (e)-5-(2-bromovinyl)-2'-deoxyuridine (1; brvudr) inhibits the replication of herpes simplex virus type 1 (hsv-1) and of varicella-zoster virus (vzv) in vitro at concentrations of 0.01 to 0.23 mumol/l, whereas herpes simplex virus type 2 (hsv-2) is influenced only at 5.5 to 27 mumol/l. in comparison to some classical and newly developed antiherpetics, i. e. 5-iodo-2'-desoxyuridine (2; idoxuridine, idu), 9-beta-d-arabinofuranosyladenine (4; vidarabine ara-a), 9-(2-hydroxyethoxymethyl) guanine (5; ... | 1987 | 2823299 |
| protection against herpes simplex virus infection in mice by recombinant murine interferon-beta in combination with antibody. | a recombinant murine interferon -beta (rmuifn-beta) was used to suppress the development of skin lesions and death of mice after challenge with herpes simplex virus (hsv) type 1 (hsv-1). depilated female balb/c mice were inoculated intradermally with hsv-1, hayashida strain, and were administered various concentrations of interferon (ifn) intraperitoneally 3 h later. the treatment with ifn was given once a day for 10 successive days. under the conditions in which almost all control mice died aft ... | 1987 | 2821897 |
| reconstitution of cytotoxic t lymphocyte activity following allogeneic bone marrow transplantation in man. | longitudinal studies over an eight-month period have been performed to follow the t killer response restoration after allogeneic bone marrow transplantation (bmt). the capacity of the patient's peripheral blood mononuclear cells (pbm) to develop cytotoxic effector cells directed either against allogeneic cells or against epstein-barr virus (ebv) or herpes-simplex virus-1 (hsv-1)-infected syngeneic cells was tested monthly. the data suggest that in most cases the cytotoxic t lymphocyte (ctl) acti ... | 1987 | 2820090 |
| vinyl versus latex gloves as barriers to transmission of viruses in the health care setting. | one type of vinyl and seven types of latex gloves without visual defects were tested with respect to their barrier function against high concentrations of three viruses of varying size: herpes simplex virus type 1 (hsv-1, 180 nm), human immunodeficiency virus type 1 (hiv-1, 100 nm), and echovirus type 9 (echo 9, 25 nm). viral suspensions of hsv-1 (10(8) tcd50/ml), hiv-1 (10(5) tcd50/ml), and echovirus type 9 (10(7.5)tcd 50/ml) were placed in an inverted glove finger immersed in media and maintai ... | 1989 | 2703958 |
| antibody response to type-common and type-unique epitopes of herpes simplex virus polypeptides. | herpes simplex virus type 1 (hsv1) and type 2 (hsv2) polypeptides with type-common and type-unique epitopes were identified using cross-adsorbed hyperimmune rabbit sera and western blotting techniques. twelve hsv1 and fourteen hsv2 polypeptides with type-specific epitopes were identified. cross-adsorbed human sera reacted to a subset of the type-specific epitopes defined by rabbit sera. human sera with both hsv1- and hsv2-specific antibodies were identified by their reaction to hsv1-type-specifi ... | 1985 | 2580054 |
| [epidemiological evaluations of human immunodeficiency virus, herpes simplex virus type 1 and 2 and cytomegalovirus infections in drug addicts]. | eighty-eight drug addicts from the "ban center" in torre annunziata (naples) and 88 normal subjects pair-matched for age and sex were tested for igg to human immunodeficiency virus (hiv), herpes simplex virus (hsv) type 1 and 2 and cytomegalovirus (cmv). a high prevalence of subjects with antibodies to hsv-1 and cmv (80.7% and 65.9%) were recorded in the control group testifying to the high level of these infections in campania. prevalences were higher in drug addicts, and drug abuse was identif ... | 1989 | 2562004 |
| anti-herpesvirus activity of carbocyclic oxetanocin g in vitro. | a series of new compounds, carbocyclic oxetanocins, have been synthesized and their anti-herpesvirus activity determined. carbocyclic oxetanocin g (oxt-g) was most active against herpes simplex virus (hsv) and human cytomegalovirus (hcmv) among carbocyclic oxetanocins tested; the median effective concentrations (ec50) for hsv-1, -2, and hcmv were 0.23, 0.04 and 0.40 micrograms/ml, respectively. the ec50 value of carbocyclic oxt-g against hsv-2 was significantly lower than those of acyclovir, gan ... | 1989 | 2559911 |
| expression of herpes simplex virus 1 glycoprotein b in human cells and protection of mice against lethal herpes simplex virus 1 infection. | 1989 | 2559611 | |
| simian alphaherpesviruses and their relation to the human herpes simplex viruses. | biochemical and immunological properties of structural and non-structural polypeptides of the human simplex viruses (hsv1 and hsv2) and four related herpesviruses of non-human primates [herpesvirus simiae (b virus), h. cercopithicus (sa8), h. saimiri 1 (hvs 1), and h. ateles 1 (hva 1)] were compared. using a radioimmunoassay (ria), the presence of antigenic determinants shared among all six viruses was demonstrated. the relative degree of antigenic cross-reactivity among these viruses was furthe ... | 1989 | 2558632 |
| explants of human oral epithelium exposed to viruses and cancer chemotherapeutics. | cultures of proliferating epithelial cells were established from explants of normal human oral epithelium from healthy young volunteers. the epithelial cells were found permissive for herpes simplex virus type 1 and type 2, coxsackie virus a-4 and a-16, adenovirus type 5, measles vaccine, rubella and influenza type a virus-. medium from deae-pretreated epithelial cultures infected with two subtypes of human immunodeficiency virus-1 showed an increasing content of virusprotein with time by antige ... | 1989 | 2558179 |
| preinfection prophylaxis with herpes simplex virus glycoprotein immunogens: factors influencing efficacy. | using a guinea-pig model of genital herpes simplex virus (hsv) infection we explored the protection afforded by preinfection immunization with hsv glycoproteins. glycoprotein immunogens prepared by recombinant dna technology were found to be as effective as immunogens purified from hsv-infected cell cultures. immunized animals developed less severe primary disease and also experienced less frequent recurrent infections. protection was influenced by both adjuvant and route of administration. thes ... | 1989 | 2558156 |
| dystrophin in electric organ of torpedo californica homologous to that in human muscle. | we have found that dystrophin is highly concentrated at neuromuscular junctions and innervated membranes of the electric organ of torpedo californica. in acetylcholine receptor-rich torpedo membrane preparations dystrophin represents approximately 0.4% of total protein and can be extracted from these membranes by alkaline treatment in the absence of detergent, indicating that it is a peripheral membrane protein. polyclonal antibodies raised against electrophoretically isolated torpedo dystrophin ... | 1989 | 2556382 |
| influence of asparagine-linked oligosaccharides on antigenicity, processing, and cell surface expression of herpes simplex virus type 1 glycoprotein d. | glycoprotein d (gd) is an envelope component of herpes simplex virus types 1 and 2. gd-1 contains three sites for the addition of n-linked carbohydrate (n-cho), all of which are used. three mutants were constructed by site-directed mutagenesis, each of which altered one n-cho addition site from asn-x-thr/ser to asn-x-ala. a fourth mutant was altered at all three sites. the mutant genes were inserted into an expression vector, and the expressed protein was analyzed in transiently transfected cos- ... | 1989 | 2555549 |
| enumeration of viral antigen-reactive helper t lymphocytes in human peripheral blood by limiting dilution for analysis of viral antigen-reactive t-cell pools in virus-seropositive and virus-seronegative individuals. | a limiting-dilution analysis technique was developed which enumerates human t cells with the capacity to secrete t-cell growth factors such as interleukin 2 after contact with herpes simplex virus type 1 (hsv-1) or cytomegalovirus (cmv) antigens (operationally defined as virus-reactive helper t cells [htl]). by using this limiting-dilution analysis technique, the peripheral blood of hsv-seropositive individuals was analyzed for the frequency of hsv antigen-reactive htl and for the ability either ... | 1989 | 2555391 |
| molecular cloning of human uracil-dna glycosylase, a highly conserved dna repair enzyme. | uracil-dna glycosylase is the dna repair enzyme responsible for the removal of uracil from dna, and it is present in all organisms investigated. here we report on the cloning and sequencing of a cdna encoding the human uracil-dna glycosylase. the sequences of uracil-dna glycosylases from yeast, escherichia coli, herpes simplex virus type 1 and 2, and homologous genes from varicella-zoster and epstein-barr viruses are known. it is shown in this report that the predicted amino acid sequence of the ... | 1989 | 2555154 |
| thymidine kinase deficient human cells have increased uv sensitivity in their capacity to support herpes simplex virus but normal uv sensitivity for colony formation. | a thymidine kinase deficient (tk-) and two thymidine kinase proficient (tk+) human cell lines were compared for uv sensitivity using colony-forming ability as well as their capacity to support the plaque formation of herpes simplex type 1 (hsv-1). the tk- line (143 cells) was a derivative of one of the tk+ lines (r970-5), whereas the other tk+ line (ac4 cells) was a derivative of the 143 cells obtained by transfection with purified sheared hsv-2 dna encoding the viral tk gene. 143, r970-5 and ac ... | 1989 | 2554138 |
| the influence of different adjuvants on the immune response to a synthetic peptide comprising amino acid residues 9-21 of herpes simplex virus type 1 glycoprotein d. | the immuno-modulating properties of different adjuvant systems on the murine humoral and cellular immune response to a synthetic peptide comprising amino acid residues 9-21 of glycoprotein d of herpes simplex virus type 1 (hsv-1) were investigated. for immunization, the peptide was conjugated to ovalbumin or bovine serum albumin by glutaraldehyde and the adjuvants used in this study were freund's complete adjuvant (fca), aluminium hydroxide, the ribi adjuvant system (ras) and two non-ionic block ... | 1989 | 2553820 |
| isolation of glycoprotein d from herpes simplex virus type 1 by gel filtration high performance liquid chromatography. | rabbit kidney (rk-13) and human jejunum and ileum (i-407) cells infected with herpes simplex virus type 1, strain f, were radiolabelled with [14c]glucosamine or [35s]methionine for 24 h. the cells were extracted with 1% triton x-100 and the extracts were separated by gel filtration high performance liquid chromatography. monoclonal antibody immunoprecipitation of the fractions collected from the column revealed a monomeric glycoprotein d (gd) of 52 - 56,000 molecular weight from rk-13 cells and ... | 1989 | 2553170 |
| herpes simplex virus type 1 icp0 plays a critical role in the de novo synthesis of infectious virus following transfection of viral dna. | as a first step in identifying the functions and intramolecular functional domains of herpes simplex virus type 1 infected cell protein 0 (icp0) in productive infection and latency, a series of mutant plasmids specifying varying amounts of the icp0 primary amino acid sequence were constructed. in transient expression assays with mutant and wild-type plasmids, the n-terminal half of the icp0 molecule was found to be sufficient to transactivate a variety of viral promoters. although promoters repr ... | 1989 | 2552142 |
| a novel function of the herpes simplex virus type 1 fc receptor: participation in bipolar bridging of antiviral immunoglobulin g. | we describe a novel function of the fc receptor of herpes simplex virus type 1 (hsv-1), its ability to participate in antibody bipolar bridging. this refers to the binding of a single immunoglobulin g (igg) molecule by its fab end to its antigenic target and by its fc end to an fc receptor (fcr). we demonstrate that various immune igg antibodies, including polyclonal rabbit antibodies to hsv-1 glycoproteins gc1 and gd1 and monoclonal human antibody to gd1 blocked rosetting of igg-coated erythroc ... | 1989 | 2552134 |
| expression of human hprt mrna in brains of mice infected with a recombinant herpes simplex virus-1 vector. | complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (hprt) results in a devastating neurological disease, the lesch-nyhan syndrome. this disorder has been identified as a candidate for initial attempts at somatic cell gene therapy. we have previously reported the construction of a recombinant herpes simplex virus type 1 (hsv-1) vector containing human hprt cdna sequences under the regulatory control of the viral thymidine kinase gene (tk) [palella et a ... | 1989 | 2551779 |
| lack of correlation between hla-b35 resistance against herpes labialis and antibody titers to hsv-1. | to investigate whether genetic factors linked to the human leukocyte antigens (hla) might influence individual resistance to recurrent herpes labialis (rhl), we studied the frequencies of hla-a, -b, and -c antigens in a sample of sicilian population. the frequency of hla-b35 was significantly decreased in the patient group (p corrected = 0.018). consequently, the relative risk of development of rhl in a subject positive for hla-b35 was 20 times smaller than in a subject who does not bear b35. fu ... | 1989 | 2550869 |
| [studies on the anti-virus effect of glycyrrhiza uralensis fish. polysaccharide]. | the anti-virus activity of gps has been investigated in vitro using l-929 and fl cell line infected with 7 kinds of dna or rna virus, and the mechanism by which gps exhibits the anti-virus activity has been studied. the results show that gps may inhibit the growth of vsv, adviii, hsv-1 or vv and cpe is also suppressed by gps for protecting culture cell from virus infection. | 1989 | 2550028 |
| [intranasal infection of icr mice with herpes simplex virus type 1]. | intranasal inoculation of mice with herpes simplex virus (hsv) provides a model of human herpetic infection through a natural route of inoculation. five-week-old male icr mice were infected intranasally with various strains of herpes simplex virus type 1 (hsv-1), and the fundamental aspects of the pathogenicity of this virus were studied. six virus strains examined showed variance in their virulence determined by lethal dose 50 (ld50) for mice. four of the strains were revealed to be virulent, a ... | 1989 | 2549226 |
| use of a glucocorticoid-inducible promoter for expression of herpes simplex virus type 1 glycoprotein gc1, a cytotoxic protein in mammalian cells. | abundant expression of herpes simplex virus type 1 glycoprotein gc (gc1) in transfected mammalian cells has not previously been achieved, possibly because gc1 protein is toxic to cells. to approach this problem, the gc1 coding sequence was placed under the control of the weak but inducible glucocorticoid-responsive promoter from the mouse mammary tumor virus (mmtv) long terminal repeat (ltr). as controls to evaluate for gc1 cytotoxicity, the mmtv ltr promoter was used to express glycoprotein gd1 ... | 1989 | 2548078 |
| (e)-5-(2-bromovinyl)uridine requires phosphorylation by the herpes simplex virus (type 1)-induced thymidine kinase to express its antiviral activity. | (e)-5-(2-bromovinyl)uridine (bvurd), the riboside counterpart of (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdurd), effected a dose-dependent inhibition of viral progeny formation and viral dna synthesis in herpes simplex virus type 1 (hsv-1, strain kos)-infected human (e6sm) diploid fibroblast cells. bvurd was directly phosphorylated in hsv-1-infected cells, presumably by the virus-encoded thymidine kinase (tk), since (i) bvurd was not phosphorylated by extracts of cells infected with a hsv-1 strai ... | 1989 | 2545207 |
| synthesis and antiviral activity of the nucleotide analogue (s)-1-[3-hydroxy-2-(phosphonylmethoxy)propyl]cytosine. | the acyclic nucleotide analogue (s)-1-[3-hydroxy-2-(phosphonylmethoxy)propyl] cytosine (2, hpmpc) was prepared on a multigram scale in 18% overall yield starting from (r)-2,3-o-isopropylideneglycerol. the key step in the nine-step synthetic route is coupling of cytosine with the side-chain derivative 8 which bears a protected phosphonylmethyl ether group. in vitro data showed that hpmpc has good activity against herpes simplex virus types 1 and 2, although it was 10-fold less potent than acyclov ... | 1989 | 2544723 |
| a case of simultaneous bilateral herpetic epithelial keratitis. | the patient, a 56-year-old man, presented with dendritic keratitis in the right eye and geographic keratitis in the left, with decreased corneal sensation in both eyes. the virus isolated from both eyes was identified as herpes simplex virus (hsv-1) by the indirect immunofluorescent method using anti-hsv-1 monoclonal antibody. antibody tests of paired sera suggested that the epithelial lesions were not primary but recurrent. no significant difference was observed in dna cleavage patterns between ... | 1989 | 2543856 |
| the central segment of herpes simplex virus type 1 glycoprotein c (gc) is not involved in c3b binding: demonstration by using monoclonal antibodies and recombinant gc expressed in escherichia coli. | three monoclonal antibodies (mabs) have been raised against cell membrane-derived herpes simplex virus type 1 glycoprotein c (gc-1). by using different dna constructs of gc-1 expressed in escherichia coli the sites recognized by these antibodies could be assigned to a peptide in the more hydrophobic and probably non-glycosylated middle third of the gc-1 molecule. this peptide segment corresponds to a 571 bp segment on the gc-1 gene located between the ncoi and the nrui restriction sites. none of ... | 1989 | 2543790 |
| lithium chloride restores host protein synthesis in herpes simplex virus-infected endothelial cells. | in previous studies we have shown that herpes simplex virus type 1 (hsv-1) infection suppresses host-cell protein synthesis in human endothelial cells (ec). it has been demonstrated that lithium salts prevent viral replication in hsv-1 infected cells. in the present study, we have measured host-cell protein synthesis in hsv-1 infected ec in the presence or absence of 20 and 30 mm licl. although licl restored synthesis of almost all host-cell proteins, [35s]methionine incorporation was most prono ... | 1989 | 2543386 |
| herpes simplex virus alpha protein icp27 can inhibit or augment viral gene transactivation. | three of the five alpha (immediate early) gene products of herpes simplex virus, infected cell proteins (icps) 4, 0, and 27 play a role in the control of expression of viral beta (delayed-early) and gamma (late) genes. we report here that icp27 can inhibit or augment the individual or combined abilities of icp4 and icp0 to stimulate expression of chimeric genes containing viral gene promoters in a transient expression system. the specific effect of icp27 was dependent on the viral gene promoter ... | 1989 | 2543126 |
| antigen-presenting liposomes are effective in treatment of recurrent herpes simplex virus genitalis in guinea pigs. | the therapeutic and immunologic effects of a liposome preparation containing both a macrophage activator, muramyl-tripeptide-phosphatidylethanolamine, and a recombinant antigen, glycoprotein d of herpes simplex virus type 1, have been investigated. this preparation was tested in vitro for the ability to stimulate peripheral blood lymphocytes and in vivo for the control of recurrent herpes genitalis in guinea pigs. our results show that the liposome-antigen-adjuvant preparation is capable of enha ... | 1989 | 2542605 |
| icp4-binding sites in the promoter and coding regions of the herpes simplex virus gd gene contribute to activation of in vitro transcription by icp4. | the herpes simplex virus immediate-early gene product icp4 activates the transcription of viral early and late genes. we characterized the dna sequence elements of the early glycoprotein d (gd) gene that play a role in the response to icp4 in vitro. using gel mobility shift assays and dnase i footprinting, we identified three icp4-binding sites, two 5' to the mrna start site and a third within the coding region. site ii, which gave a footprint between nucleotides -75 and -111 relative to the rna ... | 1989 | 2542568 |
| establishment of latent ganglionic infection with herpes simplex virus via maxillary gingiva and viral re-activation in vivo after trauma. | herpes simplex virus can remain latent for months or years in sensory and automatic ganglia of animals and man, and can be re-activated in vivo by several procedures such as neurectomy, irritation of epithelial surfaces, and administration of immunosuppressive agents. the objective of this study was to determine whether dental stimuli can cause re-activation of the latent herpes simplex virus. homogenization and explanation of ganglia from mice showed that herpes simplex virus (type 1) traveled ... | 1989 | 2537858 |
| herpes simplex virus type 1 icp27 deletion mutants exhibit altered patterns of transcription and are dna deficient. | infected cell polypeptide 27 (icp27, alpha 27, ie63) is the 63-kilodalton product of an immediate-early gene of herpes simplex virus. functional analysis of temperature-sensitive mutants in herpes simplex virus type 1 icp27 demonstrated that this protein plays an essential role in virus replication (w. r. sacks, c. c. greene, d. p. aschman, and p. a. schaffer, j. virol. 55:796-805, 1985). because the temperature-sensitive forms of icp27 induced by the mutants affected gene expression to differin ... | 1989 | 2535723 |
| relatedness of glycoproteins expressed on the surface of simian herpes-virus virions and infected cells to specific hsv glycoproteins. | the antigenic relatedness of the surface glycoprotein antigens of six herpesviruses indigenous to human and nonhuman primates was examined. binding of anti-viral sera to viral antigens expressed on the surface of infected cells demonstrated that the surface antigens of herpes simplex virus type 1 (hsv 1), hsv 2, simian agent 8 (sa8), and herpesvirus simiae (b virus) exhibit extensive cross-reactivity. surface antigens of two viruses isolated from south american primates, h. saimiri 1 (hvs 1) and ... | 1989 | 2482016 |
| simultaneous triple-immunogold staining of virus and host cell antigens with monoclonal antibodies of virus and host cell antigens in ultrathin cryosections. | the mechanism of intracellular maturation and sorting of herpes simplex virus type i glycoproteins is not known in details. to elucidate the intracellular sorting of viral glycoproteins and their possible interaction with the cytoskeleton, a method for simultaneous immunogold staining of three antigens in ultrathin cryosections is described. each antigen is stained by an indirect technique using mouse monoclonal igg as first layer, rabbit anti-mouse igg as second and gold-conjugated goat anti-ra ... | 1989 | 2475475 |
| transcriptional activity of the herpes simplex virus genome during establishment, maintenance, and reactivation of in vitro virus latency. | we previously have described a model of in vitro herpes simplex virus (hsv) latency in which latent infection was (i) established with human leukocyte interferon (ifn-alpha) in combination with (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) or 9-[(2-hydroxyethoxy)methyl]guanine (acyclovir); (ii) maintained after termination of combined inhibitor treatment by incubation at 40.5 degrees, and (iii) reactivated by either reducing the incubation temperature to 37 degrees or by superinfecting at the elev ... | 1989 | 2473963 |
| topological distribution of virus-specific and cross-reactive antigenic determinants on the gb glycoprotein of the herpes simplex viruses. | the antigenic properties and relations between the herpes simplex virus type 1 and 2 (hsv1, hsv2) gb glycoproteins were investigated. using several assay systems to analyze the virus-specific reactivity of polyclonal monospecific rabbit anti-gb sera, it was demonstrated that most of the antigenic determinants of the gb glycoproteins exposed at the surface of both virions and infected cells are virus-specific rather than cross-reactive. comparative examination of the reactivity of human immune se ... | 1989 | 2470853 |
| inhibition of transcription of herpes simplex virus immediate early genes in interferon-treated human cells. | the effect of interferon (ifn) treatment on the early stages of herpes simplex virus type 1 (hsv-1) replication in three types of human cells was investigated. interferon pretreatment was shown to reduce the steady state levels of both total and polysomebound hsv-1 immediate early alpha mrnas. using the nuclear run-off transcription assay, we showed that ifn selectively inhibited transcription of the hsv-1 genes, with no effect on transcription of total cellular rna or that of the beta-tubulin r ... | 1988 | 2455018 |
| expression of herpes simplex virus type 1 glycoprotein d deletion mutants in mammalian cells. | glycoprotein d (gd) is a viron envelope component of herpes simplex virus types 1 and 2. we have previously defined seven monoclonal antibody (mab) groups which recognize distinct epitopes on the mature gd-1 protein of 369 amino acids. mab groups vii, ii, and v recognize continuous epitopes at residues 11-19, 272-279, and 340-356, respectively. mab groups i, iii, iv, and vi recognize discontinuous epitopes. recent studies have focused on epitopes i, iii, and vi. using truncated forms of gd gener ... | 1988 | 2452897 |
| helper activity in antigen-specific antibody production mediated by cd4+ human cytotoxic t cell clones directed against herpes simplex virus. | three hsv type 1 (hsv-1) and hsv type 2 (hsv-2) common ("hsv-type common") and three hsv-1 specific ctl clones, which were cd3+, cd4+, cd8-, 4b4+, and 2h4-, were established. these clones proliferated in response to stimulation with hsv in the presence of autologous apc. the hsv type specificity of the proliferative response was identical with that of the cytotoxic activity of the clones. the cytotoxic activity and the proliferative response were both inhibited by addition of anti-hla-dr mab to ... | 1988 | 2452188 |
| rna complementary to herpes simplex virus type 1 icp0 gene demonstrated in neurons of human trigeminal ganglia. | recent studies with mice have demonstrated abundant rna transcripts which are complementary (antisense) to the herpes alpha gene icp0 in latently infected ganglia. we investigated the situation in unselected human trigeminal ganglia. strand-specific 2.7-kilobase herpes simplex virus type 1 (hsv-1) icp0 rna probes were prepared, and their sense was determined in productively infected cells. although in situ hybridization demonstrated icp0 antisense rna transcripts in the nuclei of neurons in 46% ... | 1988 | 2451758 |
| neutralizing monoclonal antibodies specific for herpes simplex virus glycoprotein d inhibit virus penetration. | nine monoclonal antibodies specific for glycoprotein d (gd) of herpes simplex virus type 1 were selected for their ability to neutralize virus in the presence of complement. four of these antibodies exhibited significant neutralization titers in the absence of complement, suggesting that their epitope specificities are localized to site(s) which contribute to the role of gd in virus infectivity. each of these antibodies was shown to effectively neutralize virus after virion adsorption to cell su ... | 1987 | 2444713 |
| a cultured human oligodendroglioma cell line and herpes simplex virus-infected cells share antigenic determinants. | cell cultures derived from 60 different human brain tumors were screened for the presence of hsv infected cell antigens by indirect immunofluorescence using a polyclonal rabbit antiserum reacting with herpes simplex virus (hsv), 3 monoclonal antibodies recognising different hsv-specified proteins, and one monoclonal antibody t181 reacting with a dna binding protein present in hsv-infected cells. only one tumor (in/157), derived from an oligodendroglioma, stained with the polyclonal antiserum. t1 ... | 1987 | 2437255 |
| hybridization between a repeated region of herpes simplex virus type 1 dna containing the sequence [ggc]n and heterodisperse cellular dna and rna. | a small dna fragment containing the simple sequence [ggc]10 from the long repeat of herpes simplex virus type 1 (hsv-1) dna hybridized to cellular dna and polyadenylated rna from different mammalian species. the number and intensity of blot hybridization signals were increased in human compared with rodent and simian nucleic acids. the hybridization was blocked specifically by human 28s ribosomal dna, which shares only the ggc repeats with the herpes simplex virus dna. these data indicate that g ... | 1987 | 2436393 |
| nucleotide sequence of the most abundantly transcribed early gene of human cytomegalovirus strain ad169. | cytoplasmic poly(a+)rna was isolated from human embryo fibroblast cells during the early phase of an infection with human cytomegalovirus strain ad169. these preparations contained a single abundant transcript of 2.7 kb which was derived from each of the repeat sequences flanking the long unique region of the virus genome. the gene was unspliced and poly(a+)rna derived from it continued to accumulate in the cytoplasm of cells during the later stages of infection. this gene and the surrounding re ... | 1987 | 2436392 |
| herpes simplex virus-induced changes of the keratin type intermediate filament in rat epithelial cells. | herpes simplex virus type 1 (hsv-1) infection of human fibroblast cells grown in culture induces reorganization of the cytoskeleton fibrillar structures. normal transport and insertion of hsv glycoproteins into the plasma membrane of the cells depend on the integrity of the microtubules. the natural host cells for hsv are epithelial cells, and an epithelial cell line established from rat palate was used in the present study. the effect of virus on the structure of the intermediate filaments and ... | 1987 | 2434610 |
| trans-activation of the human immunodeficiency virus long terminal repeat sequence by dna viruses. | to investigate whether dna viruses can augment gene expression of the human immunodeficiency virus (hiv), cotransfection experiments were carried out in which a recombinant plasmid containing the hiv long terminal repeat (ltr) linked to the chloramphenicol acetyltransferase (cat) gene was transfected into cultured cells along with plasmids containing dna from various distinct classes of dna viruses. molecular clones containing jc virus, bk virus, lymphotropic papovavirus, bovine papilloma virus, ... | 1986 | 2432602 |
| 1h-nmr assignment and secondary structure of a herpes simplex virus glycoprotein d-1 antigenic domain. | the peptide alpha ahx-met-ala-asp-pro-asn-arg-phe-arg-gly-lys-asp-leu-pro-val-leu- asp-gln-leu-thr-asp-pro-pro-alpha ahx (epsilon ahx = 6-aminohexanoyl), the antigenic sequence 11-32 from herpes simplex virus glycoprotein d-1, has been synthesised. its 1h-nmr spectrum has been assigned by a combination of two-dimensional techniques in h2o and 2h2o. its secondary structure has been defined by nuclear overhauser effects and amide proton exchange rates, and also to some extent chemical shifts, coup ... | 1986 | 2426110 |
| human antibody response to herpes simplex virus-specific polypeptides after primary and recurrent infection. | human antibody responses to specific polypeptides of herpes simplex virus types 1 and 2 (hsv-1 and hsv-2, respectively) were assessed in serial serum specimens from 18 infected patients by immunoblot technology. nine patients had hsv-1 infections (six genital and three oral) and nine had hsv-2 genital infections. antibodies to homologous and heterologous hsv antigens were studied and correlated with total microneutralization and enzyme-linked immunosorbent assay antibodies as well as correlated ... | 1986 | 2422204 |
| induction of neutralizing antibody against varicella-zoster virus (vzv) by vzv gp3 and cross-reactivity between vzv gp3 and herpes simplex viruses gb. | glycoprotein gp3 (64k) is one of the major proteins specified by varicella-zoster virus (vzv). this glycoprotein was purified on an immunoadsorbent consisting of monoclonal antibody (clone 8) against gp3 linked to protein a-sepharose. rabbits were then immunized with the purified antigen to obtain monospecific antisera against gp3. the monospecific antisera and monoclonal antibody immunoprecipitated polypeptides with the same molecular weights of approximately 64,000 (64k), 106k, and 116k from a ... | 1986 | 2418583 |
| experimental keratitis in rabbits by human hsv-1 variants: prevention and treatment. | the efficacy of different therapies and vaccine preparations was assessed for treating or preventing herpetic ocular keratitis induced by experimental inoculation in rabbits with two hsv-1 variants that display different pathogenetic potential. early administration of acyclovir (acv) promoted fast healing and prevented neurologic involvements: alpha-interferon (alpha-ifn) was less efficient than acv; combined therapy with both drugs increased the antiviral effects. in an attempt to prevent the d ... | 1990 | 2177779 |