Publications
Title | Abstract | Year Filter | PMID(sorted ascending) Filter |
---|
rna-protein interactions in alfalfa mosaic virus. | particles of the bottom component of alfalfa mosaic virus have a compact bacilliform structure at neutral ph. when the ph is raised to 8.3 the structure unfolds. since the particle weight does not change it is concluded that the protein subunits remain attached to the rna. the particle weight of the spheroidal top component a of the virus is halved when the particles unfold at ph 8.3. this can be explained by the fact that these particles contain two rna molecules of identical size. free rna mol ... | 1976 | 5938 |
use of cross-linking in studying the structure of rna tumour viruses. | treatment of intact avian myeloblastosis virus (amv) with dimethyl suberimidate dihydrochloride (dms), a cross-linking agent specific for amino groups, was found to result in progressive cross-linking among viral proteins, as revealed by polyacrylamide gel electrophoresis (page) in the presence of sodium dodecyl sulphate (sds). free viral proteins were not cross-linked. the cross-linked protein complex with an apparent molecular weight of 50,000 daltons was studied in detail. | 1976 | 9823 |
a study of the states of aggregation of alfalfa mosaic virus protein. | the states of aggregation of alfalfa mosaic virus (amv) protein have been characterized by sedimentation velocity experiments and electron microscopy. the main association product is a spherical particle with an s value of about 30s. it is highly likely that the assembly of this particle starts with dimers of the 25000 molecular mass unit resulting in an icosahedral particle made of 30 dimers. no intermediate aggregation products have been detected. the clustering pattern of the protein in the c ... | 1976 | 13424 |
alfalfa mosaic virus protein polymerization. | 1977 | 18611 | |
transmission of alfalfa mosaic virus through nicandra physaloides seeds and its localization in embryo cotyledons. | alfalfa mosaic virus (amv) was found to be transmitted through seeds of nicandra physaloids l. the average seed transmission rate of the amv isolates t6, lmbg-4 and st amounted to 23, 4 and 0 per cent, repectively. in the cytoplasm of parenchyma cells of embryo cotyledons of seeds from plants infected with the t6 isolate, electron microscopy revealed amv aggregates of type 2a and aggregations of irregularly viral particles with a tendency to subparallel alignment, representing early stages of ty ... | 1977 | 20770 |
properties of solubilized rna-dependent rna polymerase from alfalfa mosaic virus-infected and healthy tobacco plants. | 1978 | 33485 | |
studies on reverse transcriptase of rna tumor viruses iii. properties of purified moloney murine leukemia virus dna polymerase and associated rnase h. | dna polymerase was purified from a cloned isolate of moloney murine leukemia virus (m-mulv). purified m-mulv dna polymerase, upon analysis by polyacrylamide gel electrophoresis, showed one major polypeptide of mol wt 80,000. estimation of molecular weight from the sedimentation rate of the purifed enzyme in a glycerol gradient was consistent with a structure containing one polypeptide. m-mulv dna polymerase could transcribe ribopolymers, deoxyribopolymers, and heteropolymers as efficiently as di ... | 1975 | 46925 |
properties of oncornavirus rna-directed dna polymerase, the rna template, and the intracellular products formed early during infection and cell transformation. | we have investigated three aspects of rna turmor virus replication and cell transformation: (1) the properties of the purified avian and mammalian viral rna-directed dna polumerase, (2) some characteristics of the viral 60-70s rna genome, 30-40s rna subunits and intracellular viral rna species, and (3) the interaction of the viral dna polymerase with its rna template early during infection and cell transformation by the murine sarcoma-leukemia virus (msv[mlv]). avian myeloblastosis virus (amv) c ... | 1975 | 50902 |
sequences related to the rna tumor viruses in the rna and dna of human leukemias and lymphomas. | dna-rna hybridization was used to explore whether human neoplasias contain rna molecules having sequence homologies to those of the rna tumor viruses known to cause similar diseases in animals. the pattern of specific rnas found in the human tumors showed a remarkable concordance with the predictions deducible from the animal systems. thus human breast cancer contains rna homologous only to that of the murine mammary tumor virus (mmtv). human leukemias, sarcomas, and lymphomas (including hodgkin ... | 1975 | 51626 |
mechanism of interaction of avian myeloblastosis virus reverse transcriptase with avian myeloblastosis virus rna. | the synthesis of dna on avian myeloblastosis virus (amv) rna as the primer-template using amv reverse transcriptase in vitro has been examined as a function of the concentrations of these components, as well as a function of the ionic strenth of the assay medium. the results are consistent with the hypothesis that two types of sites exist on the amv rna: inactive "dead-end" sites that merely bind the enzyme, and active binding sites that lead to dna synthesis. velocity sedimentation studies of r ... | 1976 | 56463 |
evidence for circularization of the avian oncornavirus rna genome during proviral dna synthesis from studies of reverse transcription in vitro. | the rna-directed dna polymerase (deoxynucleosidetriphosphate:dna deoxynucleotidyltransferase ec 2.7.7.7) of avian oncornavirus requires a tryptophan trna (trnatrp) primer molecule located close to the 5' end of the viral rna genome for the initiation of dna synthesis in vitro. in this communication we demonstrate that the dna product, transcribed from avian myeloblastosis virus (amv) 35s rna containing only trnatrp as primer, is located also at the 5' end of the rna genome. more importantly, we ... | 1976 | 57620 |
mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus dna polymerase. | storage of the dimeric (alphabeta) form of avian myeloblastosis virus (amv) dna polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. this reduction appears to be the result of cleavages introduced by traces o ... | 1976 | 58080 |
stepwise dissociation of high molecular weight avian myeloblastosis virus rna: 30-40s rna subunits--the best natural template-primer for viral reverse transcriptase. | controlled disruption of 60s amv rna with formamide was used to prepare 50-55s and 30-40s rnas. when the activities of these rnas as templates for amv reverse transcriptase were compared it was found that 50-55s rna was 1-5 times and 30-40s rna 2 to 3 times more active than 60s rna. the 30-40s rna produced by heating, instead of formamide disruption, was inactive as a template but activity was restored by addition of oligo(dt). 40% of the 4s rna initially associated with the 60s rna remained ass ... | 1976 | 59791 |
on the association of reverse transcriptase with polynucleotide templates during catalysis. | the association of avian myeloblastosis virus (amv) dna polymerase with polynucleotide templates during catalysis has been studied. during the course of polymerization, different template-primer complexes were added and the ability of the enzyme to switch from one polynucleotide template to another was determined. at 37 degrees c as well as at 4 degrees c, the polymerase is able to switch from certain template-primer complexes to others. for example, the addition of poly(a)-oligo(dt) during the ... | 1976 | 60129 |
poly 2'-o-ethylcytidylate, an inhibitor and poor template for amv reverse transcriptase. | poly(2'-o-ethylcytidylate) is a poor template-primer for purified avian myeloblastosis virus reverse transcriptase; the relative activities of the template-primers poly(c)-oligo(dg), poly(cm)-oligo(dg) and poly(ce)-oligo(dg) are 23:16:1. a mixture of poly(ce) and poly(di) is inactive as template-primer, in agreement with the observed inability of these to form a helical complex. by contrast the inactivity of poly(ce)-poly(i) is shown to be due to the influence of the 2'-o-ethyl residue. poly(ce) ... | 1976 | 60742 |
rna-dependent dna polymerase activity of rna tumor virus. vi. processive mode of action of avian myeloblastosis virus polymerase. | purified avian myeloblastosis virus (amv) polymerase consisting of alpha,beta subunits has been shown to act processively in catalyzing dna synthesis primed with 34s amv rna oligo(dt), poly(a)-poly(dt), and poly(i)-poly(dc). dna transcripts prepared with 34s amv rna-oligo(dt)14 and amv polymerase (alphabeta) have been shown to have a molecular weight of 1.05 x 10(6), or approximately one-third the size of the 34s rna genome. polymerase subunit alpha acts nonprocessively with the above templates. | 1976 | 61286 |
influence of phosphate on activity and stability of reverse transcriptase from avian myeloblastosis virus. | activity of rna-dependent dna polymerase (rddp) from avian myeloblastosis virus (amv), either in purified form or in virus lysates, was increased by phosphorylation. stability of rddp in lysates buffered with phosphate was much greater (no loss of activity in 48 hours at 4 degrees) than that in lysates buffered with tris-cl (76% loss). activity lost in the tris-buffered extracts was completely restored by phosphorylation. the findings suggested that amv rddp activity is influenced by the degree ... | 1976 | 61581 |
detection by immunofluorescence of avian myeloblastosis virus reverse transcriptase. | peripheral blood cells of avian myeloblastosis virus (amv-(infected chickens were examined at various intervals post infection by immunofluorescence. amv revertase was identified in pro- and myeloblasts; it was localized mainly in the perinuclear zone or throughout the cytoplasm. no revertase was found in erythrocytes or granulocytes. blood cells from uninfected chickens of man contained no revertase. | 1976 | 61720 |
translation products of the alfalfa mosaic virus ribonuclei acids in wheat-germ cell-free system and in oocytes from xenopus laevis. | 1976 | 64215 | |
bovine leukemia virus: an exogenous rna oncogenic virus? | short term cultures of bovine leukemic lymphocytes release virus particles with biochemical properties of rna oncogenic viruses. these particles, tentatively called bovine leukemia virus (blv) have a high molecular weight-reverse transcriptase complex and a density averaging 1.155 g/ml in sucrose solutions. molecular hybridizations between blv-3h cdna and several viral rnas show that blv is not related to mason-pfizer monkey virus (mpmv) simian sarcoma associated virus (ssv-1) feline leukemia vi ... | 1976 | 64382 |
[presence in immunostimulated cells of an rna molecule utilizable as template for reverse transcriptase of avian myeloblastosis virus (amv)]. | cytoplasmic rna extracted from antigen stimulated immunocompetant cells is transcribed in vitro into dna by the rna directed dna polymerase from avian myeloblastosis virus, in the absence of any added primer. cytoplasmic rna from other organs of the same animal, from non-stimulated immunocompetent cells, or from cells in tissue culture is not transcribed in the absence of exogenous primer. | 1977 | 65233 |
immunological distinction between ribonuclease h activity of alpha and alph beta forms of avian myeloblastosis virus (amv) dna polymerase. | 1977 | 65831 | |
the effect of magnesium and manganese ions on the structure and template activity for reverse transcriptase of polyribocytidylate and its 2'-0-methyl derivative. | the secondary structure of the hydrogen bonded hybrids polycytidylate-oligodeoxguanylate (poly(rc)-(dg)12-18 and poly (2'-ome) cytidylate-oligodeoxyguanylate (poly (rcm)-(dg)12-18 was studied at several magnesium and manganese ion concentrations. these hybrids are effective template-primer complexes for the synthesis of poly(dg) by avian myeloblastosis virus (amv) dna polymerase under disparate ionic conditions. circular dichroism spectra and thermal melting data were obtained as a function of i ... | 1977 | 73165 |
reverse transcriptase of foamy virus. purification of the enzymes and immunological identification. | reverse transcriptase from foamy virus, strain h4188 was estimated and purified. the enzyme has the following characteristics: 1. the reaction utilized preferentially oligo (dt) poly (ra) as a primer-template; however, the synthetic primer-template oligo (dt) poly (da) could also be used to some extent. 2. the reaction utilized oligo (dg) poly (rc) as a primer-template with very low efficiency. 3. the crude virus preparation had a detectable endogenous reaction using the four deoxyribonucleotide ... | 1977 | 74244 |
virus-coded origin of a 32,000-dalton protein from avian retrovirus cores: structural relatedness of p32 and the beta polypeptide of the avian retrovirus dna polymerase. | a 32,000-dalton protein (p32) located in avian retrovirus cores was immunoprecipitated from [35s]methionine-labeled avian myeloblastosis virus (amv) propagated in cultured chicken embryo fibroblast cells by an antiserum preparation (sarc iii) derived from tumor-bearing hamsters injected with cloned and passaged cells from an avian sarcoma virus-induced primary hamster tumor. since sarc iii serum apparently contained antibodies only to virus-coded proteins and not to chicken cellular proteins, th ... | 1978 | 81316 |
effects of benzo(a)pyrene adducts of dna synthesis in vitro. | two diol epoxides of benzo(a)pyrene (bp), and benzo(a)pyrene 4,5-oxide, have been used to make adducts in the homopolymers polyribocytidylic acid, (rc); polyriboadenylic acid (ra), polydeoxycytidylic acid (dc) and polydeoxyadenylic acid (da). with appropriate oligomers as primers these modified and unmodified polynucleotides were used as templates for dna synthesis with avian myeloblastosis virus dna polymerase (amv) or e. coli pol i dna polymerase. we have found that: (1) the size of the dna pr ... | 1978 | 82490 |
biochemical and immunological characterization of a reverse transcriptase from human melanoma tissue. | an rna-direct dna polymerase was purified from human melanoma tissue by successive column chromatography on deae-cellulose (de-23 and de-52) and phosphocellulose. the purified reverse transcriptase has a mol. wt. of 68,000, a ph optimum of 8.0, a mn2+ optimum of 0.6 mm, and a kcl optimum of 60 mm. the purified enzyme transcribes (ra)n - (dt)12, (rc)n - (dg)18, (ome-rc)n - (dg)18 and a 70s rna from rauscher leukemia virus (rlv), but failed to transcribe (da)n - (dt)12. this enzyme has no terminal ... | 1978 | 83188 |
endonuclease activity of purified rna-directed dna polymerase from avian myeloblastosis virus. | highly purified preparations of rna-directed dna polymerase from avian myeloblastosis virus (amv) contain a mn2+-activated endonuclease activity capable of nicking supercoiled dna. this endonuclease activity co-sediments in glycerol gradients with the alphabeta form of amv dna polymerase, and co-chromatographs with dna polymerase activity on deae-cellulose, phosphocellulose, and heparin-sepharose. it is also present in amv alphabeta-dna polymerase purified by electrophoresis through nondenaturin ... | 1979 | 83998 |
[immunologic aspects of preparation of antiserum to the reverse transcriptase from avian myeloblastosis virus]. | after immunization of rabbits the antiserum was prepared against purified reverse transcriptase (revertase) from avian myeloblastosis virus (amv). the antiserum demonstrated enzymeneutralizing antibody activity that was associated with ummunoglobulin g fraction but not with igm. the high antigenicity of amv revertase for rabbits was shown. the active antiserum was obtained after 4 immunizations of rabbit with approximately 20 microgram of the enzyme. non-specific revertase inhibitors were found ... | 1976 | 88006 |
a new method for the size estimation of the rna genome segments of influenza virus. | previous estimates of the size of the rna genome segments of influenza virus have been unreliable because of a lack of suitable rna species as size markers. we have attempted to overcome this problem by utilising the ability of amv reverse transcriptase to synthesise full length dna copies of rna molecules in the presence of a suitable primer. by comparing such dna copies of the rna segments of the influenza virus genome with sequenced restriction fragments from the e. coli plasmid pbr322, we ha ... | 1979 | 88039 |
problems with particle-associated dna polymerase assays in the diagnosis of plasma-suspended viruses. | the in vitro reaction results of virus-associated dna polymerases for the demonstration of plasma-suspended particles of avian leukemia virus (amv) and of hepatitis type b virus (hbv) were compared. amv particles could be identified by the transcription of the templates poly mc(dg)12-18, poly rat10, and poly d(at) using standardized reaction mixtures. with comparable test conditions, no dna polymerase activity was found in human plasma containing hbv. these findings and the results of a systemat ... | 1979 | 92114 |
phosphonoformate inhibits reverse transcriptase. | the new antiviral substance phosphonoformate (pfa) has been tested in a cell-free system for its effect on reverse transcriptases from an avian retrovirus (avian myeloblastosis virus, amv) and from mammalian retroviruses (rauscher leukaemia virus, rmulv; bovine leukaemia virus; baboon endogenous virus; simian sarcoma virus; visna virus). the observed inhibitory effect of pfa has been compared with that of a structurally related substance, phosphonoacetate (paa). phosphonoformate, at a concentrat ... | 1979 | 94344 |
coat protein binds to the 3'-terminal part of rna 4 of alfalfa mosaic virus. | all four rnas of alfalfa mosaic virus contain a limited number of sites with a high affinity for coat protein [van boxsel, j. a. m. (1976), ph.d. thesis, university of leiden]. in order to localize these sites in the viral rnas, rna 4 tthe subgenomic messenger for coat protein) was subjected to a very mild digestion with ribonucleast t1. the ten major fragments, apparently resulting from five preferential hits, were separated and tested for messenger activity in a wheat germ cell-free system, as ... | 1978 | 99164 |
3'-terminal nucleotide sequence of alfalfa mosaic virus rna 4. | the sequence of the 3'-terminal 91 nucleotides of alfalfa mosaic virus rna 4, the messenger for the viral coat protein, has been elucidated. a fragment containing the 3' terminus of the rna was obtained by mild digestion with rnase t1. the primary structure of the fragment was deduced by labeling it in vitro at its 5' terminus and application of rna sequencing techniques. the sequence is completely extracistronic and is believed to contain the binding sites for the viral coat protein and replica ... | 1979 | 108677 |
formation of ribosome-rna initiation complexes with alfalfa mosaic virus rna 4 and rna 3. | rna 4 of alfalfa mosaic virus (amv) is a monocistronic messenger for the coat protein. we have determined the sequence of the 40 +/- 2 nucleotides in rna 4 that were protected in the initiation complex formed with wheat germ 80 s ribosomes from digestion by t1 or pancreatic ribonucleases. the aug coat protein initiation codon was near the middle of this protected region. we have found two ribosome-binding sites in rna 3. the principal one, near the 5' end, is the initiation site for the major tr ... | 1979 | 114984 |
purification of viral proteins from avian sarcoma virus qv2. | a procedure was established whereby most of the major viral proteins were isolated to apparent homogeneity in biologically and immunologically active forms from a single batch of avian sarcoma virus qv2. for the initial step of purification, gently disrupted virions were fractionated by cscl centrifugation into envelope proteins, rna-dependent dna polymerase, and viral core proteins. further purification of envelope glycoproteins and dna polymerase was performed by affinity chromatography on aga ... | 1979 | 115857 |
hydrodynamic diameters of rna tumor viruses. studies by laser beat frequency light scattering spectroscopy of avian myeloblastosis and rauscher murine leukemia viruses. | the diffusion constants of avian myeloblastosis virus (amv) and murine leukemia virus (mulv) (rauscher) suspensions in buffer and in 30% sucrose were determined by laser beat frequency light scattering spectroscopy at a series of temperatures ranging rom 5 to 25 degrees. by the use of the stokes-einstein equation, the following hydrodynamic diameters are calculated at 20 degrees: mulv, 154 plus or minus 3 nm in sucrose and 145 plus or minus 7 nm in buffer; amv, 144 plus or minus 3 nm in sucrose ... | 1975 | 162827 |
inhibition of rna-dependent dna polymerase reaction by 6-(p-hydroxyphenylazo)-uracil: a result of drug induced dithiothreitol oxidation. | 6-(p-hydroxyphenylazo)-uracil (hpura) reduced by dithiothreitol inhibited amv or rlv virion associated exogenous rna-dependent dna polymerase reactions. however, the inhibition was variable from experiment to experiment and was not consistent with the base specificity of hpura seen for inhibition of gram positive dna-dependent dna polymerases. increasing the concentration of dithiothreitol reversed the inhibition. furthermore, at non-toxic concentrations, hpura did not influence the plating effi ... | 1975 | 166420 |
studies on characterization of the integration sites of avian rna tumor virus-specific dna. | a sequential hybridization procedure is described which allows the integration sites of viral-specific dna to be characterized according to their reassociation kinetics. in addition, this approach enables us to estimate the size of the integrated viral dna. endogenous virus sequences in normal cells appear to be associated with cell sequences reiterated 1200 times, and each integration unit is approximately equal to one 35s rna subunit. in amv-infected cells, the additional amv-specific dna sequ ... | 1975 | 169002 |
amv rna transcription in cell-free systems and properties of in vitro chromatin-directed rna synthesis. | in this report we have presented evidence that viral sequences in the genome of amv-infected myeloblasts can be transcribed in vitro. the rna products synthesized in either nuclei isolated from these cells or by eukaryotic rna polymerase b from the isolated chromatin contained approximately 1% virus-specific sequences. this result, which is in agreement with the fraction of viral rna in infected cells (garapin et al. 1971), is higher than expected from a random transcription of the genome, and t ... | 1975 | 169005 |
polypeptides isolated from ribosome-like structures occluded in avian myeloblastosis virus (amv). | the protein composititon of ribosome-like particles isolated from amv was determined by acrylamide gel electrophoresis and by immunological methods. it was established that the protein spectrum of ribosome-like particles differed significantly form the total protein spectrum of amv. the most characteristic protein components of ribosome-like particles had a molecular weight in the range of 70 000--110 000. apart from these proteins, the viral ribosomal particles contained a small amount of prot ... | 1975 | 169489 |
quantitative and qualitative differences in dna complementary to avian myeloblastosis virus between normal and leukemic chicken cells. | hybridization of avian myeloblastosis virus (amv) rna with dna immobilized on filters or in liquid with a vast dna excess was used to measure the viral specific dna sequences in chicken cells. newly synthesized viral dna (v-dna) appears within an hour after infection of chicken embryo fibroblasts (cef) with avian oncornaviruses. a fraction of newly synthesized v-dna becomes integrated into the cellular genome and the remainder gradually disappears. a covalent linkage between v-dna and cellular d ... | 1975 | 169823 |
acquisition of viral dna sequences in target organs of chickens infected with avian myeloblastosis virus. | the distribution of oncornavirus dna sequences in various tissues of normal chickens and of chickens with leukemia or kidney tumors induced by avian myeloblastosis virus (amv) was analyzed by dna-rna hybridization using 35s amv rna as a probe. all the tissues from normal chickens which were tested contained the same average cellular concentration of endogenous oncornavirus dna. in contrast, different tissues from lekemic chickens and from chickens bearing kidney tumors contained different concen ... | 1975 | 170415 |
electrophoretic mobilities of rna tumor viruses. studies by doppler-shifted light scattering spectroscopy. | we have used laser beat frequency light scattering spectroscopy to measure, at several ph values, the electrophoretic mobilities of purified avian myeloblastosis (amv), murine leukemia (mulv), murine mammary tumor (mumtv), and feline leukemia (felv) viruses. the mobilities of these viruses are similar at ph greater than or equal to7 (-2.7 to -3.2 x 10(-4) (cm/sec)/(v/cm). the isoelectric points of mulv and amv are apparently less than ph 3, whereas for felv the data could be interpreted to indic ... | 1975 | 170961 |
homology between avian oncornavirus rnas and dna from several avian species. | 3h-labeled 35s rna from avian myeloblastosis virus (amv), rous associated virus (rav)-0, rav-60, rav-61, rav-2, or b-77(w) was hybridized with an excess of cellular dna from different avian species, i.e., normal or leukemic chickens, normal pheasants, turkeys, japanese quails, or ducks. approximately two to three copies of endogenous viral dna were estimated to be present per diploid of normal chicken cell genome. in leukemic chicken myeloblasts induced by amv, the number of viral sequences appe ... | 1975 | 172655 |
trna's associated with the 70s rna of avian myeloblastosis virus. | the distribtuion of various amino acid trna's in the 4s rna components of avian myeloblastosis virus (amv) and in 4s rna prepared from chicken cmbryo cells, chicken myeloblasts, and chicken livers was determined. this was done by aminoacylating the 4s rna samples with a mixture of 17 radioactive amino acids and subsequently identifying the trna-accepted amino acids on an amino acid analyzer after deacylation. in embryo cells, myeloblasts, and liver, trna's accepting all 1m amino acids were demon ... | 1975 | 172660 |
ribonucleotide sequence homology among avian oncornaviruses. | rna sequence relatedness among avian rna tumor virus genomes was analyzed by inhibition of dna-rna hybrid formation between 3h-labeled 35s viral rna and an excess of leukemic or normal chicken cell dna with increasing concentrations of unlabeled 35s viral rna. the avian viruses tested were rous associated virus (rav)-3, avian myeloblastosis virus (amv), rav-60, rav-61, and b-77 sarcoma virus. hybridization of 3h-labeled 35s amv rna with dna from normal chicken cells was inhibited by unlabeled 35 ... | 1975 | 173876 |
renal neoplastic response to leukosis virus strains bai a (avian myeloblastosis virus) and mc29. | previous reports described the induction of avian renal neoplasms by leukosis virus strains bai a [avian myeloblastosis virus (amv)] and mc29, and illustrated morphological characteristics of the tumors. continued studies in this work confirm evidence of the origin of the tumors from embryonal cells residual in the posthatched chick. the work further emphasizes differences in histopathology of the neoplasms caused by the two viruses and reveals differences in the histopathogenesis of the respect ... | 1976 | 177194 |
identification of dna in the core component of avian myeloblastosis virus. | avian myeloblastosis virus (amv) was found to contain dna associated with the virion. the viral envelope was removed by treating the virus with a nonionic detergent and the dna was found in the core fraction. these experiments indicate that the dna associated with tumor virus is not contaminant associated with the viral envelope and suggest that the dna is part of the internal core component. the dna from avian myeloblastosis virus has a density of 1.70 g/cm3. | 1976 | 178377 |
evidence for tandem integration of avian myeloblastosis virus dna with endogenous provirus in leukemic chicken cells. | the integration site of avian myeloblastosis virus (amv) proviral dna in dna from leukemia chicken myeloblasts has been studied by three sequential nucleic acid hybridizations that can localize the proviral dna according to the repetitiveness of the adjacent cellular dna regions. first, large denatured cellular dna fragments (2.1 x 10(6) daltons) were reassociated and fractionated according to sequence reiteration frequenct. next, dna remaining single-stranded in each fraction was immobilized on ... | 1976 | 179099 |
separation of time-defined avian myeloblastosis virus (amv) using column cultivation of leukaemic myeblasts. | a new technique is described of column cultivation of cells immobilized on sial glass cullet. the technique ensures a controlled and continuous production of time-defined young virus. during the column cultivation the morphological characteristics of tho immobilized cells remain essentially unchanged. | 1976 | 179904 |
stepwise transition of aggregate structure of high-molecular-weight avian myeloblastosis virus rna. mode of releasing of associated 4s rna. | mode of releasing of associated 4s rna species was studied during a controlled transition of aggregate structure of high-molecular-weight amv-rna. it has been found that associated 4s rna constitutes 2.5% of 60s amv-rna complex. approximately 60% of associated 4s rna is successively released during treatment of viral rna with increasing formamide concentration, concomitantly with the transition of 60s rna aggregate through 50--55s rna intermediate into the final 30--40s rna subunits. 40% of 4s r ... | 1976 | 180440 |
expression of viral proteins in mammalian cells transformed by avian sarcoma viruses. | the expression of viral proteins in nine lines of hamster and rat cells transformed by avian sarcoma viruses (asv) was studied by indirect immunofluorescence with monospecific antisera to purified gp85 and p27 of amv-b and a polyvalent antiserum to all the p proteins of this same virus. the lines of asv-transformed cells were either low virus producers (vp) or inducible or non-inducible non producers (np). cytoplasmic expression of p proteins was observed in all the cell lines except the least i ... | 1976 | 186419 |
nonspecific immunosuppression and expression of avian myeloblastosis virus (bai strain a). | chickens were treated with cyclophosphamide in order to induce nonspecific immunosuppression. treated and untreated animals were injected with avian myeloblastosis virus (amv) or myeloblasts at the age when a pronounced resistance to the disease is observed. chickens treated with cyclophosphamide and then challenged with amv developed acute myeloblastic leukemia in 70 percent. similarly treated chickens transplanted with fresh amv producing myeloblasts exhibited 30 percent incidence of myeloblas ... | 1976 | 187971 |
restricted addition of proviral dna in target tissues of chickens infected with avian myeloblastosis virus. | proviral dna is synthesized within an hour after infection of chicken cells with an avian oncornavirus and is integrated into nuclear cellular dna within a short time. the viral dna appears to be synthesized as double-stranded molecules of approximately 6 x 10(6) daltons some of which are converted into supercoiled cricles perhaps as a requisite for integration. the endogenous v-dna in normal chicken cells and both the endogenous and amv v-dna in leukemic chicken myeloblasts are covalently linke ... | 1976 | 188728 |
the oncornavirus maturation process: quantitative correlation between morphological changes and conversion of genomic virion rna. | avian myeloblastosis virus (amv) was harvested at different time intervals from chick leukemic myeloblasts, and the rate of the maturation process of amv was estimated on the basis of morphological changes in the virions and conversion of genomic viral rna. the change from immature virions characterized by the presence of an electronlucent center to the condensed mature form (with dense nucleoid) was accompanied by the conversion of 30-40s rna to 60s rna. both processes were quantitatively defin ... | 1976 | 188781 |
inactivation of avian myeloblastosis virus dna polymerase by specific binding of pyridoxal 5'-phosphate to deoxynucleoside triphosphate binding site. | avian myeloblastosis virus (amv) dna polymerase is inactivated by preincubation with pyridoxal 5'-phosphate. this inactivation is relatively specific since various pyridoxal-5'-p analogs cause no inactivation. this effect is reversible but can be made irreversible by reduction with sodium borohydride; the reduced pyridoxal-5'-p adduct exhibits a new absorbance maximum at 325 nm and a fluorescence emission at 392 nm when excited at 325 nm. the evidence presented suggests the formation of a schiff ... | 1977 | 190232 |
characterization of tumour virus proteins. i. radioimmunoassay of the p27 protein of avian viruses. | the major structural protein of avian oncornaviruses, a core component of about 27000 daltons, has been measured by radioimmunoassay. the purified protein was labelled with 125iodine by chloramine-t method. the immune serum titer was defined as the highest serum dilution able to precipitate 50% of the labelled antigen present in the system. standard competition curve was constructed in order to determine the equivalents of protein, in a system with limiting antibody concentration. in the experim ... | 1977 | 190652 |
homogeneity and complexity of avian oncornavirus proviral dna determined by molecular hybridization. | the homogeneity of dna complementary to the 35s rna subunit of avian myeloblastosis virus (amv) has been demonstrated by single or multistep hybridization. for multistep hybridizations, 35s amv rna was preselected for its ability to hybridize either to unfractionated leukemic dna or to leukemic dna enriched for unique or for reiterated sequences. these experiments indicate that the viral genome is complementary to dna sequences with a low reiteration frequency. competition experiments confirm th ... | 1977 | 191654 |
preparation of antisera to group-specific antigens of avian leukosis-sarcoma viruses: an alternate approach. | immunization of rabbits with a pooled preparation of chromato-graphically purified avian myeloblastosis virus (amv) group-specific (gs) antigens produced relatively large volumes of antiserum that was as broadly reactive in complement-fixation (cf) tests as antiserum produced in hamsters with tumors induced by rous sarcoma virus. this alternate procedure should be of value for routine preparation of leukosis virus gs antiserum. other antisera prepared against disrupted amv had spurious reactivit ... | 1977 | 194573 |
search for virus specific dna sequences and viral particles in mitochondria of avian leukemic myeloblasts. | the intracellular localization of the avian myeloblastosis virus (amv) genome was studied. nuclear and mitochondrial dnas from myeloblasts were examined by hybridization with 32p labeled amv-rna of high molecular weight for the presence of virus specific dna sequences. nuclear dna (ndna) from myeloblasts specifically hybridized with viral rna, whereas purified closed circular mitochondrial dna (mtdna) did not hybridize with viral rna. it was therefore concluded that viral genome was present in n ... | 1977 | 197796 |
avian myeloblastosis virus rna is terminally redundant: implications for the mechanism of retrovirus replication. | we have determined the terminal heteropolymeric sequences of amv rna by the following procedures: first, rna sequence determination on the 5' terminal and the poly(a)-linked 3' terminal t1 oligonucleotides, and second, analysis by the maxam and gilbert (1977) method of amv strong stop dna and of dna complementary to the poly(a)-linked t1 oligonucleotide, synthesized with reverse transcriptase and (pdt)13 as primer. the structure deduced for the 5' terminal region is (5')7mgpppgmccauucuaccucucacc ... | 1977 | 198142 |
single-stranded dna from oncornavirus-infected cells enriched in virus-specific dna sequences. | we previously found that a minor fraction of single-stranded dna (ss-dna) isolated from native nuclear dna of normal chicken embryonic cells and cells of other species hybridized with bulk nuclear dna or cellular rna in great excess. at least one-third of ss-dna belonging to the nonrepetitious part of the cell genome could be hybridized to homologous rnas. in the present work, similar results were obtained with ss-dna from cells of chickens infected by avian myeloblastosis virus (amv). to invest ... | 1977 | 198800 |
cyclophosphamide induced sensitivity against avian rna myeloblastosis virus in age-resistant hosts. | the effect of cyclophosphamide administration on survival of 4- to 7-week-old chickens as well as on induction of leukemia after avian myeloblastosis virus (amv) injection was studied. the drug treatment alone did not cause any neoplastic effect in the birds during 4 months of observation. immediate application of amv to cyclophosphamide-pretreated age-resistant chickens induced acute myeloblastic leukemia in about 80 per cent of test animals. the sensitivity of chickens against amv, induced by ... | 1977 | 201874 |
size and secondary structure of avian myeloblastosis virus associated ribosomal rna: comparison with cellular and precursor ribosomal rna. | ribosomal rna isolated from ribosomes present inside avian myeloblastosis virus (amv) was characterized by electron microscopy using the formamide-urea spreading technique. the molecular weight and the secondary structures were compared with those of r-rna and precursor r-na isolated from host cells, the leukemic myeloblasts. the molecular weight of viral r-rna (1.62 +/- 0.18 x 10(6) and 0.69 +/- 0.10 x 10(6)) and the molecular weight of cellular r-rna (1.63 +/- 0.18 x 10(6) and 0.67 +/- 0.09 x ... | 1978 | 205195 |
complete sequences of the ribosome recognition sites in vesicular stomatitis virus mrnas: recognition by the 40s and 80s complexes. | nucleotide sequences of the ribosome-protected translation initiation sites from the vesicular stomatitis virus (vsv) m and l protein mrnas have been determined, completing the sequences of the sites from all the vsv mrnas. a low level of protection at two internal aug-containing sites in the n mrna is also described. small homologies are evident among some of the sites, but there are no obvious features common to all the sites other than a single aug codon. in contrast, a large homology between ... | 1978 | 208778 |
specific effect of zinc ions on dna polymerase activity of avian myeloblastosis virus. | the effect of selected cations on dna synthesis by dna-polymerase of avian myeloblastosis virus (amv) was studied. zinc ions at low concentration (0.2mm) in the assay system enhanced the activity about 2 x fold and at higher concentration (2.0 mm) inhibited the activity completely. in contrast, addition of lithium and potassium salts produced inhibitory effects in this ionic concentration range. replacement of k+ ion had an inhibitory effect on the activity. | 1978 | 214695 |
translation of alfalfa-mosaic-virus rna 1 in the mrna-dependent translation system from rabbit reticulocyte lysates. | translation of alfalfa mosaic virus (amv) rnas in the mrna-dependent rabbit reticulocyte cell-free system was examined using different rna concentrations. the pattern of products synthesized under the direction of amv rna 2, 3 and 4 was not or almost not influenced by their concentration. however, depending on the rna 1 concentration either a very large protein of mr 115,000 or a mixture of two smaller proteins, mr 58,000 and 62,000 respectively, was formed. these three proteins represent overla ... | 1979 | 217681 |
response of hemopoietic cells to avian acute leukemia viruses: effects on the differentiation of the target cells. | chicken bone marrow cells were infected with three avian acute leukemia viruses (alv)--avian myeloblastosis virus (amv), myelocytomatosis virus strain mc29 and mill hill 2 virus (mh2)--and then cultured in agar in the presence of conditioned medium. under these conditions, it was found that very few cells served as target cells for these three viruses. density gradient separation showed that alv target cells were found primarily in the light density fractions and might be represented by cells co ... | 1979 | 222465 |
an enzyme-linked immunosorbent assay for detecting avian leukosis-sarcoma viruses. | immunoglobulins from antiserum raised against chromatographically purified avian myeloblastosis virus (amv) group-specific (gs) antigens were used in enzyme-linked immunosorbent assay (elisa). readily discernible color was produced with 2--3 ng of amv protein in microplate wells coated with 4 micrograms of salt-precipitated immunoglobulins. when a biological assay, i.e., phenotypic mixing (pm), was the criterion for the infectious status of specimens, the elisa consistently identified a greater ... | 1979 | 230808 |
purification and characterization of the dna polymerase of human breast cancer particles. | previous studies have identified human breast tumor particles possessing many of the features characteristic of rna tumor viruses. in addition to the expected size (600 s) and density (1.16 g/ml) these include possession of an outer membrane and an inner one surrounding a "core" containing a dna polymerase and a large-molecular-weight (70s) rna possessing detectable homology to the rnas of the mouse mammary tumor virus (mmtv) and of the mason-pfizer monkey virus (mpmv). we report here the purifi ... | 1977 | 265540 |
nucleotide sequence of 5' terminus of alfalfa mosaic virus rna 4 leading into coat protein cistron. | the sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus rna 4, the mrna for the viral coat protein, has been deduced by using various new techniques for labeling the rna at the 5' end with 32p and for sequencing the 5'-32p-labeled rna. the sequence is npppguuuuuauuuuuaauuuucuuucaaauacuuccaucaugaguucuucacaaaagaaagcuggugggaaagcugg. the aug initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat p ... | 1977 | 271973 |
cell surface labelling of mononuclear cells with antisera associated to turnip yellow mosaic virus of alphalpha mosaic virus particles. a freeze-etch study. | turnip yellow mosaic virus (tymv) and alphalpha mosaic virus (amv) were used as immuno-electron microscopical markers to detect cell surface receptors on mononuclear cells in freeze-etch replicas. tymv particles were conjugated with vacuum-distilled glutaraldehyde to rabbit igg anti-mouse immunoglobulins (tymv-ramig conjugate) or to rabbit igg anti-mouse theta antigen (tymv-ramth conjugate). b-lymphocytes incubated with tymv-ramig conjugate showed either randomly distributed particles or patches ... | 1977 | 301135 |
initiation of polypeptide synthesis with various nh2-blocked aminoacyl-trnas under the direction of alfalfa mosaic virus rna 4. | initiation of polypeptide synthesis in a cell-free system of escherichia coli directed by alfalfa mosaic virus rna 4 was studied by using either fmet-trna or ac-phe-trna as initiator trna. initiation with fmet-trna yielded a product that was identical to the authentic viral coat protein except that the nh2-terminal serine was preceded by fmet instead of being acetylated. when ac-phe-trna was used as initiator, the biosynthetic product was 10-12 amino acid residues longer, the extra amino acids b ... | 1977 | 341161 |
translation by escherichia coli ribosomes of alfalfa mosaic virus rna 4 can be initiated at two sites on the monocistronic message. | substantial evidence is provided to corroborate our previous finding that escherichia coli ribosomes recognize two binding sites on the 5' end of alfalfa mosaic virus (amv) rna 4 [for a preliminary report see castel, a., kraal, b., kerklaan, p. r. m., klok, j., and bosch, l. (1977) proc. natl acad. sci. u.s.a. 74, 5509--5513]. translation can start at either site using acphe-trna or fmet-rna as initiator and takes place in the same reading frame along the monocistronic mrna. the size and composi ... | 1979 | 389629 |
influence of a few coat protein subunits on the base-paired structure of 3'-terminal fragments of rna 4 of alfalfa mosaic virus. | in contrast to expectation (srinivasan, s. and jaspars, e.m.j. (1978) biochim. biophys. acta 520, 237-241) differentiated thermal melting profiles and fluorescence measurements show that the coat protein of alfalfa mosaic virus has a negligible effect on the base-paired structure of isolated 3'-terminal fragments (length about 90 nucleotides) of the coat protein messenger rna (rna 4) of this virus. | 1979 | 427173 |
energetics of the thermal transitions of rna 1 and rna 4 of alfalfa-mosaic virus in the presence and absence of coat protein. | 1979 | 456342 | |
sequence homology at the 3'-ends of alfalfa mosaic virus rnas. | 1979 | 499559 | |
the primary structure of the coat protein of alfalfa mosaic virus strain vru. a hypothesis on the occurrence of two conformations in the assembly of the protein shell. | the complete primary structure of the coat protein of strain vru of alfalfa mosaic virus (amv) is reported. the strain is morphologically different from all other amv strains as it contains large amounts of unusually long virus particles. this is caused by structural differences in the coat protein chain. the amino acid sequence has mainly been established by the characterization of peptides obtained after cleavage with cyanogen bromide and digestion with trypsin, chymotrypsin, thermolysin or st ... | 1979 | 520317 |
nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus rna 4 and its homology with the genomic rnas. | a 226-nucleotide fragment was derived from alfalfa mosaic virus rna 4 (almv rna 4), the subgenomic messenger for viral coat protein, and its sequence was deduced by in vitro labeling with polynucleotide kinase and application of rna sequencing techniques. the fragment contains the 3'-terminal 45 nucleotides of the coat protein cistron and the complete 3'-noncoding region of 182 nucleotides. the total length of rna 4 was calculated to be 881 nucleotides. almv rnas 1, 2 and 3 were elongated with a ... | 1979 | 537914 |
virus diseases of berry crops in the soviet far east i. identification of some mechanically transmitted viruses, detected in primorye territory. | in primorye territory, ussr, cucumber mosaic virus (cmv-i), arabis mosaic virus (amv), raspberry, ringspot virus (rrsv), and tomato ringspot virus (trsv) were identified on berry crops (currant, raspberry, honeysuckel). with respect to indicator plants and physico-chemical and serological properties, the isolates obtained do not differ from other isolates of these viruses, reported on berry crops in europe and north america. | 1977 | 610231 |
sedimentation of multicomponent viruses: evaluation of sedimentation coefficient ratios. | ratios of the sedimentation coefficients for alfalfa mosaic virus components are shown to be independent of the virus concentration and the density of the solvent. different numbers of components are observed in solvents of different density. this implies that in sedimentation velocity experiments an estimate of the number of components of a multicomponent virus should involve centrifugation in solvents of different density. for some viruses, estimates of the sedimentation coefficients of indivi ... | 1978 | 621136 |
characterization of alfalfa-mosaic-virus protein polymerization in the presence of nucleic acid. | the polymerization of alfalfa mosaic virus (amv) protein in the presence of homologous nucleic acids and a number of other natural and synthetic nucleic acids was studied. the conditions for optimal assembly were found to be ph 6.0 and low ionic strength (i = 0.1 m) at room temperature, irrespective of the type of nucleic acid. the resulting nucleoprotein particles exhibited the same structural characteristics as the virus. this information emerged from optical diffraction and computer filtering ... | 1978 | 624280 |
isolation of viral double-stranded rnas using a licl fractionation procedure. | a general procedure for the isolation of virus-specific double-stranded rna (ds-rna) is discribed. the procedure is based on the differential solubility of different types of nucleic acids in licl. principal advantages over conventional methods are simplicity, avoidance of enzymatic treatment, and relatively good yields of undegraded ds-rna while permitting separation of several main groups of cellular and viral nucleic acids from the same batch of tissue. the method has been successfully applie ... | 1978 | 643823 |
influence of a few coat protein subunits on the base-paired structure of the rna species of alfalfa mosaic virus. | differentiated thermal melting profiles were made of all the three rna species (rnas 1, 2 and 3), constituting the genome of alfalfa mosaic virus and of the subgenomic coat protein messenger rna (rna 4) of this virus. whereas all profiles showed multiphasicity the profile of rna 4 was most clearly subdivided showing three clear transitions with tm values of 25.5, 35.5 and 53 degrees c. the first transition disappeared upon addition of 6 coat protein molecules per molecule of rna 4. the effect of ... | 1978 | 698231 |
coat protein polymerization of alfalfa mosaic virus strain vru. | 1978 | 712854 | |
alfalfa mosaic virus rna. determination of the sequence homology between the four rna species and a comparison with the four rna species of cucumber mosaic virus. | the method of taylor et al. [taylor, j. m., illmensee, r & summers, j. (1976) biochim. biophys. acta, 442, 324--330 and gould and symons (1977) nucleic acids res. 4, 3787--3802] has been used to transcribe complementary dna probes from the four major rnas of alfalfa mosaic virus (amv). analysis of the kinetics of hybridization of these probes in homologous and heterologous complementary dna . rna hybridization reactions has shown that the sequence of the smallest rna (rna 4), which contains the ... | 1978 | 720343 |
synthesis of dna complementary to the mrnas for milk proteins by e. coli dna polymerase i. | e.coli dna polymerase i (klenow subfragment) was used for the synthesis of complementary dna with the mrnas for rabbit milk proteins as templates. the cdna formed, contained 200 nucleotides and represented about 20% of the mrna template. the cdna was hybridized specifically to the mrna templates. the klenow subfragment of the e.coli dna polymerase i was as efficient as the avian myeloblastosis virus reverse transcriptase in the synthesis of cdna. the mean size of the cdna fragments obtained with ... | 1976 | 775441 |
structural studies on the coat protein of alfalfa mosaic virus. the complete primary structure. | the complete amino acid sequence of the coat protein of alfalfa mosaic virus (strain 425) is reported. sequence determinations were mainly performed on peptides obtained from fragmentation by cyanogen bromide and trypsin. both manual and automatic sequence methods were used. some refinements of the solid-phase edman degradation were introduced. the final alignment of the peptides was established by means of alternative cleavage methods, such as limited tryptic digestion of intact virus particles ... | 1977 | 836394 |
monocistronic translation of alfalfa mosaic virus rnas. | the four alfalfa mosaic virus rnas (respectively 24 s, 20 s, 17 s and 12 s) have been used separately as messengers in two in vitro protein synthesizing systems: wheat germ and rabbit reticulocyte lysate. in both systems a polypeptide corresponding to the translation of the entire length of the rna can be found for rnas 24 s, 20 s and 12 s, but not for 17 s rna, the translation product of which is only 35,000 daltons. the number of initiation sites has been determined for each rna by analyzing t ... | 1977 | 866193 |
[spontaneous hosts of broad bean wilt virus. communication]. | of 110 plant species, grown from seeds in the vicinity of sources of broad bean wilt virus (bbwv) in 1974, exactly 50% proved to be infected by the mentioned virus within one vegetation period. obviously 54 of the species are previously unknown hosts of bbwv. they belong to the following 21 families: amaranthaceae, boraginaceae, campanulaceae, caryophyllaceae, chenopodiaceae, commelinaceae, compositae, cruciferae, euphorbiaceae, hydrophyllaceae, labiatae, leguminosae, loasaceae, papaveraceae, po ... | 1977 | 878706 |
[determination of the primary structure of alfalfa mosaic virus (strain s) coat protein. i. determination of the molecular weight of the protein, its amino acid composition and studies on its n- and c-terminals (author's transl)]. | 1977 | 884128 | |
[determination of the primary structure of alfalfa mosaic virus (strain s) coat protein. ii. complete sequence of the protein (author's transl)]. | the alfalfa mosaic virus protein was submitted to the action of cyanogen bromide. four peptides were isolated. study of these peptides allowed us to determine the order. then protein was submitted, after s-carboxymethylation or s-aminoethylation, to the action of different proteolytic enzymes: trypsin, chymotrypsin, thermolysin and papain. the peptides issued from these different hydrolysis were separated on dowex 50 x4 and dowex 1 x2, and their amino acid composition was determined. the use of ... | 1977 | 884129 |
calorimetric studies on the interaction of rna and coat protein of alfalfa mosaic virus. | 1977 | 891980 | |
rna-dependent rna polymerases in uninfected and in alfalfa mosaic virus-infected tobacco plants. | 1977 | 898679 | |
molecular weights of particles and rnas of alfalfa mosaic virus. number of subunits in protein capsids. | 1977 | 911783 | |
analysis of alfalfa mosaic virus 17 s rna translational products. | 1976 | 945638 | |
the primary structure of the coat protein of alfalfa mosaic virus (strain 425). | 1976 | 982817 | |
primary structure of alfalfa mosaic virus coat protein (strain s). | 1976 | 982818 | |
genetic analysis of alfalfa mosaic virus mutants. | 1976 | 982837 |