Publications

TitleAbstractYear
Filter
PMID(sorted ascending)
Filter
comparison of g-, q- and em-banding patterns exhibited by the chromosome complement of the indian muntjac, muntiacus muntjak, with reference to nuclear dna content and chromatin ultrastructure.when the chromosomes of the indian muntjac, muntiacus muntjak, were compared following treatment with two presently used banding methods, trypsin-giemsa (g) and quinacrine-hydrochloride (q) with structural bands as seen in the electron microscope, definite correlations were observed with respect to the numbers and positions of individual bands. - weights obtained for the individual chromosomes were: no. 1, 9.98 pg; no. 2, 4.10 pg; no. 3, 4.43 pg; no. 3-x, 5.05 pg; and y, 0.55 pg. average diamete ...197548452
a reliable method of quantifying g-band position in chromosomes.the locations of chromosomal bands in the muntajac (muntiacus muntjak, zimmerman) are shown to be constant, that is the bands occupy the same relative position regardless of the state of contraction of the chormosome. each band can thus be assigned a precise location. different banding techniques produce bands at identical locations and thus precisely similar patterns, with one notable exception in which certain bands disappear. it it proposed that this more exact procedure be used to identify c ...197550164
visualization of nucleolar organizer regions im mammalian chromosomes using silver staining.a simple ammoniacal silver staining procedure, designated ag-as, differentially stains the chromosomal locations of ribosomal dna in certain mammalian species. this was critically demonstrated by ag-as staining of the nucleolus organizer regions in karyotypes of the same species and cell lines used for locating the ribosomal cistrons by dna/rna in situ hybridization. with ag-as, silver stained nors (ag-nors) are visualized as black spherical bodies on yellow-brown chromosome arms. ag-nors were v ...197553131
transformation of indian muntjac cells by murine and avian sarcoma viruses.indian muntjac cells were efficiently transformed by murine sarcoma virus (msv) and avian sarcoma viruses (asv). when colony formation of the infected cells was examined in soft agar, many colonies were formed by the asv-injected cells but no colony was seen in the msv-infected cells. the asv-transformed cell clones differed among the clones in morphology, presence of inducible asv genome, and karyotypes.1978208907
establishment and characterization of indian muntjak cell lines transformed with simian virus 40.kidney cells of an indian muntjak were transformed with simian virus 40 (sv40). the transformation efficiency of the tertiary cultures was very high when estimated by the agar suspension culture method. the efficiency was about 0.015% when infected at an input multiplicity of 0.4 p.f.u./cell. clonal cell lines were established from the colonies in soft agar medium. most of the cell lines and their subclones produced a small amount of infectious sv40. the sv40 virion antigen-positive cells in a c ...1979217958
microsurgically-extracted metaphase chromosomes of the indian muntjac examined with phase contrast and scanning electron microscopy. 1978340241
visualization of the interphase chromosomes of ornithogalum virens and muntiacus muntjak.a technique for visualizing "interphase chromosomes" was applied to nuclei of the angio-spermous plant, ornithogalum virens (2 n = 6), and the male mammal, muntiacus munjak (2 n = 7), in an attempt to correlate the numbers of "chromosomes" visible during interphase with the respective diploid chromosome numbers. the alterations in chromosome structure observed during g1, s, and g2 periods were comparable to those previously reported in allium cepa and chinese hamster (cho line) cells [33], but f ...1979428620
tumorigenicity of indian muntjac diploid cells by the proviral integration of sarcoma gene of a mouse retrovirus.the transformed clonal isolates of indian muntjac diploid cells by a mouse sarcoma virus, 43-2xv, were tested for tumorigenicity in athymic nude mice. in spite of the indistinguishable transformed morphology, the tumorigenicity exhibited four different patterns: (a) no tumor formation; (b) slowly growing regressive tumor formation; (c) rapidly growing regressive tumor formation; and (d) rapidly growing progressive tumor formation. this demonstrates that the same diploid host cells transformed by ...1979501287
structural organization of chromosomes of the indian muntjac (muntiacus muntjak).the identification, morphology, and banding pattern of the chromosomes of the indian muntjac (muntiacus muntjak) are described. a diagrammatic representation of the banding pattern as revealed by various techniques is presented following the nomenclature suggested by paris conference (1971) for human chromosomes. the y2 chromosome and the neck of the x chromosome are late replicating based on observations made with the use of a bromodeoxuridine plus giemsa technique. most of the g-bands are earl ...1979509990
preferential occurrence of sister chromatid exchanges at heterochromatin-euchromatin junctions in the wallaby and hamster chromosomes.chromosomes of two mammalian species, the white-throated wallaby and the rat-like hamster, possessed large amounts of constitutive heterochromatin which is detectable as c bands. by making use of this character the frequency of sister chromatid exchanges (sces) was determined for the c band and the euchromatic regions of the chromosome. in both species, the distribution of sces in the euchromatin of chromosomes was found to be proportional to its metaphase length, while the number of sces locali ...1979510085
anthramycin-induced sister-chromatid exchange and caffeine potentiation in the chromosomes of indian muntjac.cell-cycle kinetics, sister-chromatid exchange (sce) and chromosome aberrations have been studied from the skin fibroblasts of the indian muntjac after treatment with 100 micrograms/ml of caffeine and 0.05 microgram/ml of anthramycin. the cultures were incubated for a period which was sufficient for the completion of two consecutive cell cycles and both the drugs appeared to produce a slight inhibitory effect. when anthramycin-treated cells were however post-treated with caffeine, the cells did ...2004522873
the distribution of mitomycin c-induced sister chromatid exchanges in the euchromatin and heterochromatin of the indian muntjac.the frequency of sister chromatid exchanges (sces) induced by mitomycin c (mmc) in indian muntjac chromosomes was determined by the fluorescence plus giemsa (fpg) technique. using scanning cytophotometry the relative dna content of each chromosome was measured with and without acid or alkali pretreatments for c-banding. during acid and alkali treatments, euchromatin lost 20 to 30% of its dna, while heterochromatin lost less than 5%; an intermediate dna loss was observed for the short arm of the ...1977562739
euploid somatic recombinants with two active x or xy (1)y(i) chromosomes isolated from cultured male indian muntjac cells after hvj virus fusion, and their use for gene assignment.four diploid somatic recombinants were isolated from hybrids either between or within two diploid cell lines of a male indian muntjac after hvj virus-mediated cell fusion. both parental lines had a normal male karyotype, 7,x,y1,y2, in which the largest autosomal pair was heteromorphic with respect to the size of the secondary constriction (1h+/1h-), c bands, and nucleolar organizers. of the four recombinants, three showed a 6,xx,1h+/1h+ or 1h+/1h- karyotype, the remaining one a 7,xy1y2,1h+/1h+. ...1978567383
random arrangement of mitotic chromosomes in radial metaphases of the indian muntjac.the positioning of metaphase chromosomes of the indian muntjac (muntiacus muntjak) in the radial metaphase array was investigated using two methods for examining cells. large numbers of radial metaphase figures were obtained by mitotic shake-off. treatment with hypotonic solution, fixation, and spreading onto glass slides did not disrupt the radial metaphase configuration of a proportion of the cells. analysis of 567 cells for the arrangement of six of the seven muntjac chromosomes revealed a ra ...1977611003
preferential late replication of one of the two morphologically distinguishable x-chromosomes in a female muntjac.in a female barking deer, muntiacus muntjak, whose 2 x-chromosomes are mutually distinguishable from each other, one x has been found to be late replicating in 57.8% cells compared to the other which is late replicating in 42.2% cells. these data are suggestive of preferential inactivation of one x-chromosome. these findings have been discussed in the light of lyon's hypothesis of random x-inactivation in eutherian mammals.1977891854
distribution of 18+28s ribosomal genes in mammalian genomes.in situ hybridization with 3h 18s and 28s ribosomal rna from xenopus laevis has been used to study the distribution of dna sequences coding for these rnas (the nucleolus organizing regions) in the genomes of six mammals. several patterns of distribution have been found: 1) a single major site (rat kangaroo, seba's fruit bat), 2) two major sites (indian muntjac), 3) multiple sites in centromeric heterochromatin (field vole), 4) multiple sites in heterochromatic short arms (peromyscus eremicus), 5 ...19751104290
locations of 18s and 28s ribosomal genes on the chromosomes of the indian muntjac.the locations of genes coding for 18s and 28s ribosomal rna have been mapped on metaphase chromosomes of the indian muntjac m. muntjak by in situ hybridization with (3h)rrna from the toad x. laevis. the results show that, in the muntjac, rdna clusters are associated with the prominent secondary constrictions on the x and the y1 chromos. in addition a cluster of rdna is found near the tip of one arm on the longest pair of autosomes. the autosomal cluster of rdnas usually does not express as a sec ...19751109234
actinomycin d effects on mitosis and chromosomes: sticky chromatids and localized lesions.when indian muntjac and chinese hamster cells in culture were treated with actinomycin d (1 micron/ml) for 1-2 hours, the sister chromatids, especially the distal segments, appeared to have difficulty separating in anaphase. the separated proximal segments progressively became stretched. the nucleolus organizer regions seemed to be most susceptible to stretching, and breaks in these regions were frequently observed. electron microscopic observations showed that the sticky chromatids (and less fr ...19751132285
evidence suggesting chromosome continuity during the s phase of indian muntjac cells. 19751141015
a simple statistical analysis of indian muntjac giemsa band patterns.indian muntiacus muntjac g-banded chromosomes were used for computerized analysis for standardized karyotype generation. individual chromosomes on high-contrast photographic negatives were scanned densitometrically. alignment of each chromosome for analysis was achieved by locating predominant peaks as well as the centromere. this provided better alignment that the use of the chromosome-end locations. the standardized set was obtained by determing the root-mean-square average density along 10-20 ...19751192843
distribution of sister chromatid exchanges in the euchromatin and heterochromatin of the indian muntjac.the frequency of sister chromatid exchanges (sces) was determined for the chromosomes (except y2) of the indian muntjac stained by the fluorescence plus giemsa (fpg) or harlequin chromosome technique. the relative dna content of each of the chromosomes was also measured by scanning cytophotometry. after growth in bromodeoxyuridine (brdu) for two dna replication cycles. sces were distributed according to the poisson formula in each of the chromosomes. the frequency of sce in each of the chromosom ...19751212902
random distribution of centromere regions at mitosis in cultured cells of muntiacus muntjak.the manner in which centromere regions of mitotic chromosomes are distributed with respect to the age of their dna was studied. cells of the indian deer muntiacus muntjak, were grown in the presence of bromodeoxyuridine (brdu) for two generations and stained with the fluorescent dye hoechst 33258. chromatids containing "granddaughter dna" appear dim when compared with those containing "grandparental dna". the frequencies of the various anaphase patterns of bright and dim centromere regions were ...19761253648
purification of the chromosomes of the indian muntjac by flow sorting.metaphase chromosomes were isolated from a male indian muntjac cell line, were stained with ethidium bromide and were analyzed by flow microfluorometry to establish a deoxyribonucleic acid (dna)-based karyotype. five major peaks were evident on the chromosomal dna distribution corresponding to the five chromosome types in this species. the amount of dna in each chromosome was confirmed by cytophotometric measurements of intact metaphase spreads. the five chromosome types were separated by flow s ...19761254929
characterisation and correction of a mammalian cell mutant defective in late step of base excision repair.an indian muntjac cell line, svm, is unusually sensitive to cell killing induced by a range of alkylating agents. cells transfected with the escherichia coli ada gene or human genomic dna have allowed the response of svm to alkylating agents to be dissociated into two distinct components. thus, in svm, which expresses very low levels of alkyltransferase (at), o6-alkylguanine appears to be the major cytotoxic, clastogenic, and recombinogenic lesion following exposure to agents such as methylnitro ...19921287851
mammalian cells share a common pathway for the relief of dna replication arrest by o6-alkyl guanine, incorporated 6-thioguanine and uv photoproducts.we previously reported the cloning of a mammalian gene that restores uv resistance to a postreplication recovery defective and mex- indian muntjac mutant cell line, svm, by improving daughter-strand dna replication on a uv-damaged template. the improved replication was, however, found to be error-prone, as judged by a hypermutable phenotype (bouffler et al. (1990) somatic cell mol. genet., 16, 507-516). we now report that this gene also increases the resistance of svm to the cytotoxic effects of ...19921380655
differences in sister-chromatid exchange frequency between homologous chromosomes in muntiacus muntjak.the frequency of sister-chromatid exchanges (sces) on homologous autosomes was studied in the peripheral blood lymphocytes of the indian muntjac. the homologous autosomes differed from one another with respect to the sce frequency on them.19921383788
[the effect of mycoplasma contamination on the karyotypic structure of a skin fibroblast cell line from the indian muntjac].the karyotypic variability has been studied in a low chromosomal cell line of the indian muntjak skin fibroblasts contaminated with mycoplasma arginini r-16 and acholeplasma laidlawii a. the mycoplasmal contamination exerted influence on the cell distribution for the chromosome number. the frequency of the modal class cells with 7 chromosomes, having the main structure variant of the karyotype (msvk) 2 + 2 + 1 + 1 + 1, was seen to decrease, while the frequency of the submodal class cells with 6 ...19921440934
comparative gene mapping in the species muntiacus muntjac.an extreme case of chromosomal evolution is presented by the two muntjac species muntiacus muntjac (indian muntjac, 2n = 6 [females], 7 [males]) and m. reevesi (chinese muntjac, 2n = 46). despite disparate karyotypes, these phenotypically similar species produce viable hybrid offspring, indicating a high degree of dna-level conservation and genetic relatedness. as a first step toward development of a comparative gene map, several indian muntjac homologs of known human type i anchor loci were map ...19921486805
centromere autoantigens are associated with the nucleolus.because of their importance as target antigens in scleroderma and since all other major autoantigens in scleroderma can be localized to the interphase nucleolus, we were interested in a further investigation of the potential relationship between interphase centromeres and the nucleolus. using human anticentromere autoantibodies (aca) from patients with the crest form of scleroderma as probes in indirect immunofluorescence microscopy, we observed nonrandom interphase "clumping" of centromeres in ...19921572401
abnormal sister-chromatid exchange induction by 3-aminobenzamide in an sv40-transformed indian muntjac cell line: relationships with dna maturation and dna-strand breakage.in svm cells, an sv40-transformed line of indian muntjac fibroblasts, levels of sister-chromatid exchanges are known to be abnormally high after uv-irradiation or alkylation. the svm line is also known to have a defect in the processing of dna-strand breaks. sister-chromatid exchange in other cells is known to be stimulated by the poly(adp-ribose) transferase inhibitor, 3-aminobenzamide, which also retards dna-break sealing. sister-chromatid exchanges in svm cells are found to be hypersensitive ...19911702517
harlequin banding and localisation of sister-chromatid exchanges.harlequin banding (hb) was standardised on indian muntjac chromosomes by superimposing harlequin staining or sister-chromatid differentiation and g-banding after incorporation of bromodeoxyuridine (brdu) or cholorodeoxyuridine (cldu), and after treatment with brdu plus mitomycin c (mmc). sces were localized on these chromosomes with the aid of the g-band map. there were more sces in g-bands than in r-bands in brdu-incorporated chromosomes. cldu-incorporated chromosomes, however, did not show a p ...19911717844
anti-kinetochore staining for single laser, bivariate flow sorting of indian muntjac chromosomes.flow cytometric chromosome sorting typically relies upon dual-laser, bivariate analysis after staining with two different base pair-specific dyes for resolution of chromosomes with similar dna content. the availability of fitc-conjugated antibodies offers the possibility of single-laser bivariate analysis when combined with propidium iodide (pi) dna staining, but requires exploitable antigenic differences between chromosomes of interest. a technique was developed for indirect immunofluorescent a ...19911724417
new evidence for tandem chromosome fusions in the karyotypic evolution of asian muntjacs.a clone of highly repetitive dna, designated c5, was isolated from dna of female chinese muntjac cells. the nucleotide sequence of this clone is 80%-85% homologous to that of the satellite ia clone and other highly repetitive dna clones previously obtained from the indian muntjac. using c5 as a probe for in situ hybridizations to chromosome preparations of cells of both the chinese and indian muntjacs, we were able to show that these repeated sequences occur in centromeric heterochromatin of the ...19911769270
characterisation of a tandem repetitive sequence cloned from the deer capreolus capreolus and its chromosomal localisation in two muntjac species.the isolation and characterisation of a highly repetitive dna sequence from the genome of the roe deer capreolus capreolus is reported. this sequence is characterised by tandem repetition and located within centric heterochromatin as demonstrated by non isotopic in situ hybridisation to the karyotypes of the indian and chinese muntjacs. amplification and/or clustering of these sequences during the drastic karyotype evolution of the genus muntiacus was noted in the large centromere of the x chrom ...19911774183
[the chromosome variability of the indian muntjac in somatic cell hybrids].hybrids were produced between the indian muntjak fibroblasts and rat jensen sarcoma cell line (jf1) auxotrophic for asparagine. they were selected without cloning under conditions providing survival of parental indian muntjak and hybrid cells. this allowed to compare the indian muntjak chromosome variability in the parental cells and hybrids under identical culture conditions. the frequency of muntjak chromosome aberrations proved to de higher in the hybrids (up to 47%) than in the parental cell ...19911821494
the centromere-kinetochore complex: a repeat subunit model.the three-dimensional structure of the kinetochore and the dna/protein composition of the centromere-kinetochore region was investigated using two novel techniques, caffeine-induced detachment of unreplicated kinetochores and stretching of kinetochores by hypotonic and/or shear forces generated in a cytocentrifuge. kinetochore detachment was confirmed by em and immunostaining with crest autoantibodies. electron microscopic analyses of serial sections demonstrated that detached kinetochores repre ...20061828250
autoantibodies to chromosomal domains in rheumatic diseases.autoantibodies to chromosomal proteins are frequently found in the sera of certain patients with rheumatic diseases. in patients with scleroderma, especially in those with the crest syndrome, autoantibodies to a specific chromosomal domain (centromere) have been found as a common feature. in this report we describe the results of a study that utilized chromosomes prepared from fibroblasts of an asiatic deer, the indian muntjac (im). this substrate is sensitive and allows a more precise localizat ...19901967042
cadmium-induced multistep transformation of cultured indian muntjac skin fibroblasts.during the past five years we have made a series of cadmium-transformed and resistant fibroblast cell lines by continuous low-level exposure to cadmium. in the present paper we describe the use of four of these lines with varying degrees of transformation to investigate the multistep nature of cadmium carcinogenesis. these include: (a) m cell, an immortal but nontransformed muntjac skin fibroblast line; (b) ccr5, a morphologically transformed and cadmium-resistant line derived from m cells after ...19902073461
ciliary microtubule capping structures contain a mammalian kinetochore antigen.structures that cap the plus ends of microtubules may be involved in the regulation of their assembly and disassembly. growing and disassembling microtubules in the mitotic apparatus are capped by kinetochores and ciliary and flagellar microtubules are capped by the central microtubule cap and distal filaments. to compare the ciliary caps with kinetochores, isolated tetrahymena cilia were stained with crest (calcinosis/phenomenon esophageal dysmotility, sclerodactyly, telangiectasia) antisera kn ...19902106524
structure of dna polymerase alpha-primase complexes from mammalian cells analyzed by using monoclonal antibodies.the molecular masses of two of the four dna polymerase alpha-primase complex subunit peptides from various mammalian cells have been compared through the use of specific monoclonal antibodies. one monoclonal antibody (e4) binds to 77-kda peptide from hela cells and cognate peptides from other mammalian cells (monkey, mouse, bovine, indian muntjac, and hamster). another monoclonal antibody (a5) binds the 180-kda type peptide and its degradation product (160-kda peptide) of the mammalian dna polym ...19902113520
action of caffeine on dna replication after ultraviolet irradiation in indian muntjac cells: no connection with action on cell cycle delay.indian muntjac fibroblasts of the sv40-transformed line svm are hypersensitivity to uv, and after uv irradiation have defective post-replication recovery and a high level of sister chromatid exchanges and chromosome aberrations. the lethal and clastogenic effects of uv on svm have elsewhere been shown to be aggravated by caffeine, which overcomes the block to cycle traverse imposed by dna damage; however, in dm cells, an indian muntjac line of normal uv sensitivity, caffeine has no effect on cyc ...19902157503
regional differences in immunostainability of isolated metaphase chromosomes of indian muntjac with anti-z-dna antibody.the distribution of z-form dna along the length of metaphase chromosomes of indian muntjac was studied by indirect immunofluorescence procedures using an antibody specific to the z-dna conformation. several fixation conditions were compared for reproducible detection of z-dna in isolated metaphase chromosomes. fixation of chromosomes with 45% acetic acid alone gave reproducible reactivity with the antibody. when fixation was done either with carnoy's solution (3:1 methanol:acetic acid) or with 7 ...19902168826
multiple pathways of dna double-strand break processing in a mutant indian muntjac cell line.dna break processing is compared in the indian muntjac cell lines, svm and dm. the initial frequencies and resealing of x-ray generated single- and double-strand breaks are similar in the two cell lines. inhibiting the repair of uv damage leads to greater double-strand breakage in svm than in dm, and some of these breaks are not repaired; however, repair-associated single-strand breakage and resealing are normal. dimethylsulfate also induces excess double-strand breakage in svm, and these breaks ...19902173153
[the effect of cryopreservation on the cytogenetic characteristics of a cell subline of skin fibroblasts from the indian muntjac].after thawing cells, previously cryopreserved in the presence of dimethyl sulfoxide (dmso), a decrease in their viability and increase in unscheduled dna synthesis was observed. in 7 days, these parameters restored to the control level. cryopreservation without dmso resulted in the decrease in both cell viability and replicative and unscheduled dna synthesis. in 14 days, these characteristics were seen to return to the normal level. cryopreservation of cells without dmso and their preservation i ...19902219449
chromosomal evolution in cervidae.on the basis of chromosome data obtained on 30 species and 20 subspecies of cervidae, a report is submitted on the karyosystematics of this family. the primitive karyotype of cervidae may be inferred to be composed of 35 acrocentric pairs (2n = 70 fn = 70). during the phyletic evolution of this family different types of chromosome rearrangements were probably selected and the group may have differentiated karyologically into three branches: (1) the cervinae that fixed a centric fusion resulting ...19902249009
molecular cloning of a mammalian gene involved in the fixation of uv-induced mutations.a mammalian dna damage tolerance gene has been isolated by dna transfection and cosmid rescue. following cotransfection of mouse genomic dna and psv2neo into svm, the uv hypersensitive mutant indian muntjac cell line, clones with a 1.7 to 2.0-fold greater d37 value for uv killing were isolated. this trait was carried through three rounds of transfection. a neo gene and flanking sequences from a tertiary transfectant were cloned by cosmid rescue. the cosmid clone confers uv resistance to svm and ...19902267625
p34cdc2 kinase is localized to distinct domains within the mitotic apparatus.antibodies to both the c-terminal and the n-terminal regions of the 34 kd serine-threonine specific protein kinase, p34cdc2, were used to study the distribution of this protein in dividing cells and isolated chromosomes of the indian muntjac. p34cdc2 was found to be present throughout the cytoplasm of dividing cells. in addition, a portion of cellular p34cdc2 was localized to the centrosome, kinetochore, and intercellular bridge and along kinetochore-to-pole microtubules during cell division. tu ...19902268875
localization of cloned, repetitive dna sequences in deer species and its implications for maintenance of gene territory.the deer family shows the largest variation in chromosome number known in mammals (2n = 6 to 2n = 70). the drastic rearrangement of the chromosomes allows to test the prediction, based on the chromosome field theory, according to which dna sequences tend to occupy specific territories within the eukaryotic chromosome. nuclear dnas were isolated from eight deer and two bovidae species. these dnas were cleaved with the restriction enzymes eco ri and alu i. following eco ri digestion highly repetit ...19902361878
localization of the repetitive telomeric sequence (ttaggg)n in two muntjac species and implications for their karyotypic evolution.it has been suggested that the chromosome set of the indian muntjac, muntiacus muntjak vaginalis (female, 2n = 6; male, 2n = 7), evolved from small acrocentric chromosomes, such as those found in the complement of the chinese muntjac, m. reevesi (2n = 46), by a series of tandem fusions and other rearrangements. the location of the highly conserved human telomeric sequence (ttaggg)n in the metaphase chromosomes of m.m. vaginalis and its close relative, m. reevesi, was investigated by non-radioact ...19902369836
in situ localization of a mammalian protamine gene: parameters affecting specificity of hybridization.southern hybridization analysis of indian muntjac genomic dna with the eco-taq bovine genomic protamine probe revealed a simple banding pattern. the pattern of hybridization was identical with that previously observed in the genus bos. this suggested that the bovine probe specifically hybridized to the indian muntjac protamine gene. the opportunity was thus provided to assign the chromosomal location of the protamine gene in a comparatively simple system. accordingly, this probe and the correspo ...19902384210
expression of heterochromatin by restriction endonuclease treatment and distamycin a/dapi staining of indian muntjac (muntiacus muntjak) chromosomes.the constitutive heterochromatin of the indian muntjac (muntiacus muntjak) was examined following digestion with various restriction endonucleases (alui, haeiii, hinfi, and mboi), as well as by selective fluorescence staining with distamycin a plus 4'-6-diamidino-2-phenylindole. distinct areas within the c-bands were found to have characteristic staining patterns which were more conspicuous in the sex chromosomes. two dot-like structures resistant to alui were found in the x and y1 chromosomes i ...19862420537
the activity of bleomycin and modifiers of its clastogenic effect on the interphase chromatin of indian muntjak fibroblasts.premature chromosome condensation was induced in indian muntjak fibroblasts after exposure of the cells to bleomycin. further experiments were devoted to the interaction of anticlastogens and a repair inhibitor, streptovitacin a. chromosomal aberrations due to bleomycin treatment were s-phase-independently visible in the g1 and g2 phase of the cell cycle. for premature chromosome condensation experiments, a 100-fold lower concentration of the mutagen produced a similar extent of chromosome damag ...19892465811
molecular mechanisms of alkylation sensitivity in indian muntjac cell lines.the responses of two indian muntjac cell lines to two monofunctional alkylating agents were investigated. an sv40-transformed line (svm) had an increased sensitivity to cell killing when compared to the other, euploid line (dm) after exposure both to methyl nitrosourea (mnu) and to dimethylsulphate (dms) and also exhibited higher frequencies of sister chromatid exchanges (sces) following alkylation. the hypersensitivity of svm to dms correlates with the defective repair of single-strand breaks t ...19892544312
reversible extinction of insulin gene expression in insulinoma x fibroblast somatic cell hybrids.to investigate for the presence of regulator(s) repressing the expression of insulin gene in cells other than pancreatic beta cells, rat insulinoma (rin) cells secreting insulin were hybridized with fibroblasts from various species. in rin x l mouse fibroblast hybrids, which maintained most of the parental chromosomes, no insulin transcripts were detected. in three rin x indian muntjac fibroblast hybrids and one rin x human fibroblast hybrid which had lost dna from the fibroblast parent through ...19892553459
evolution of compound centromeres. a new phenomenon.a new type of centromere aberration in a transformed cell line of rat cerebral endothelial origin is described. these cells exhibit normal monocentric, dicentric, and multicentric chromosomes. the centromeres in dicentrics and multicentrics express variable locations along the chromosome. the centromeres in some of the multicentrics are located next to each other, with small intervening noncentromeric chromatin. in others, the centromeres appear to be in the immediate vicinity of each other with ...19892790749
[the effect of culturing conditions on the karyotypic structure of two cell sublines of indian muntjak skin fibroblasts].the "therapeutic" doses of antibiotics, routinely applied to prevent microbial contamination in cultured cells, decrease the frequency of modal class cells and increase that of cells of other classes in sublines of indian muntjak skin fibroblasts. in mt-subline, with 9 chromosomes in the modal class, the loss of cells with some large chromosomes occurred almost frequently. in terms of the formula of the karyotype main structural variant, this change is described as (-1-0-1-1). in m-subline, with ...19892815339
disassembly of the mammalian metaphase chromosome into its subunits: studies with ultraviolet light and repair synthesis inhibitors.metaphase chromosomes of a simian virus-transformed indian muntjac cell line have been examined by scanning electron microscopy of material in which the fully packed metaphase structure is progressively relaxed. such chromosomes are seen in standard, spread preparations of ultraviolet light-irradiated, metaphase-arrested cells, which have been incubated in the presence of inhibitors of dna synthesis; they are processed for electron microscopy by trypsinization, further fixation and osmium impreg ...19872822738
kinetochore structure: electron spectroscopic imaging of the kinetochore.the structure of the kinetochore in thin section has been studied in the indian muntjac by an electron spectroscopic imaging technique. this procedures allows the analysis of the distribution of phosphorus within the layers of the kinetochore. the results indicate that this element is a major component of both the inner and outer plates whereas it is largely absent in the middle plate and fibrous corona. the majority of the phosphorus is localized to a 30-nm fiber(s) that is woven through the la ...19892925783
defective post-replication recovery and u.v. sensitivity in a simian virus 40-transformed indian muntjac cell line.the responses to u.v. of two cell lines derived from the indian muntjac are described. the u.v. sensitivity of the diploid cell falls within the range of most normal mammalian cells while the other, a heteroploid cell, transformed by sv40, is much more sensitive to killing. this hypersensitivity cannot be explained by defective excision repair: the two cell types are indistinguishable in this activity as judged by inhibitor-associated dna break accumulation and unscheduled dna synthesis. rather, ...19863013792
studies on muntiacus muntjak cells infected with poliovirus. 19863015504
localization and characterization of recombinant dna clones derived from the highly repetitive dna sequences in the indian muntjac cells: their presence in the chinese muntjac.a total of seven, highly repeated, dna recombinant m13 mp8 clones derived from a hpa ii digest of cultured cells of the indian muntjac (muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and dna sequencing. two of the clones, b1 and b8, contain satellite dna inserts which are 80% homologous in their dna sequences. b1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. this consensus sequence, tccctgacgcaactcgagaggaatcctg ...19863015505
dna cloning and hybridization in deer species supporting the chromosome field theory.the cervidae show the largest variation in chromosome number found within any mammalian family. the eight species of deer which are the subject of this study vary in chromosome number from 2n = 70 to 2n = 6. three species of bovidae are also included since they belong to a closely related family. digestion of nuclear dnas with the restriction endonucleases hae iii, hpa ii, msp i, eco ri, xba i, pst i and bam hi reveals that there is a series of highly repetitive sequences forming similar band pa ...19863022841
excessive chromosome fragility and abundance of sister-chromatid exchanges induced by uv in an indian muntjac cell line defective in postreplication (daughter strand) repair.two uv-hypersensitive animal cell mutants defective in postreplication recovery (daughter strand synthesis) display quite different patterns of induced sister-chromatid exchange (sce). one, an sv40-transformed indian muntjac cell (svm), shows extremely high frequencies of sce after uv; induced exchanges can be measured after uv doses as low as 0.01 j/m2. this cell also displays exaggerated levels of induced and spontaneous chromosome aberrations. by contrast sce rates in the chinese hamster cell ...19863023994
organization and chromosomal distribution of a novel repetitive dna component from muntiacus muntjak vaginalis with a repeat length of more than 40 kb.the organization and chromosomal distribution of the repetitive dna component ib from muntiacus muntjak vaginalis (mmv) was investigated. dna fragments of component ib were cloned in cosmids and their structure analysed using restriction nucleases and blot-hybridization experiments. two cosmids were found to be practically identical by restriction enzyme mapping. the repeat unit of component ib dna is more than 40 kb and contains the 11 and 18 kb bam hi fragments, which have previously been show ...19863024931
longitudinal differentiation of metaphase chromosomes of indian muntjac as studied by restriction enzyme digestion, in situ hybridization with cloned dna probes and distamycin a plus dapi fluorescence staining.the longitudinal differentiation of metaphase chromosomes of the indian muntjac was studied by digestion with restriction enzymes, in situ hybridization with cloned dna probes and distamycin a plus dapi (4'-6-diamidino-2-phenylindole) fluorescence staining. the centromeric regions of chromosomes 3 and 3 + x of a male indian muntjac cell line were distinct from each other and different from those of other chromosomes. digestion with a combination of ecori and sau3a revealed a pattern correspondin ...19873040343
[karyological characteristics of cell sublines of the kidney of the kangaroo rat and of skin fibroblasts of the indian muntjac].a study was made of the karyotypic structure of sublines derived from the kangaroo rat's kidney (nbl-3) and skin fibroblasts of the indian muntjac, available in the cell culture bank of the institute of cytology acad. sci. ussr. a comparative karyologic analysis was made of subline nbl-3 both contaminated with mycoplasma (nblk) and decontaminated with antibiotics (nbld). authentic differences in cell distribution according to chromosome number in nblk and nbld variants were shown. modal numbers ...19883176180
caffeine induces uncoordinated expression of cell cycle functions after ultraviolet irradiation. accelerated cycle transit, sister chromatid exchanges and premature chromosome condensation in a transformed indian muntjac cell line.caffeine enhances the lethal effect of dna-damaging agents. it also affects the timing of events in the cell cycle; the enhanced cytotoxicity may be partly due to caffeine's ability to overcome the protective damage-induced delay in s or g2 phase. when the effects of caffeine are compared in a normal indian muntjac cell line and a simian virus 40 (sv40)-transformed, ultraviolet light (u.v.)-sensitive line in which u.v. induces many sister chromatid exchanges, different cell cycle sensitivities a ...19883253296
electron spectroscopic imaging of the centrosome in cells of the indian muntjac.specific antibody labelling indicates that phosphoproteins are present at microtubule-organizing centres, including the centrosome. we have employed electron spectroscopic imaging techniques that permit high-resolution elemental analysis of thin sections of intact cells to investigate the precise distribution of phosphorus and therefore phosphoproteins at the centrosome of indian muntjac cells. we report that these proteins are localized to both the pericentriolar matrix and the centriole. the m ...19883253303
parallel development of cadmium resistance and in vitro transformation in cultured indian muntjac cells.the development of cadmium resistance in an indian muntjac cell line has been investigated. the parent cell line is highly sensitive to cadmium ions. resistance was obtained by continuous growth of cells in low levels of cadmium with stepwise increments. four cell lines were developed with resistances of between 50- and 200-fold greater than that of the parental line. early in the development of resistance an unstable cell line displaying extensive chromosomal rearrangement and an elevated siste ...19883256541
[comparative studies on synaptonemal complexes in spermatocytes of chinese muntjac muntiacus reevesi, black muntjac m. crinifrons and indian muntjac m. muntjak]. 19883273674
mammalian kinetochore/centromere composition: a 50 kda antigen is present in the mammalian kinetochore/centromere.the composition of the mammalian kinetochore/centromere was studied by indirect immunofluorescence and immunoblotting protocols using serum from a patient with the crest variant of scleroderma. the results of these studies suggest that a protein with a molecular weight of 50 kda is localized at the surface of the primary constrictions (the kinetochore region) of both human and indian muntjac chromosomes. in addition, we were able to verify the presence of a 19.5 kda antigen (cenp-a), previously ...19873315496
microtubule and microfilament distribution and tubulin content in the cell cycle of indian muntjac cells.using dapi, rabbit antitubulin antibody, fitc-labeled goat anti-rabbit igg, and tritc-phalloidin to stain individual cells, the microspectrophotometric analysis showed that three markers that represent the nucleus, microtubules (mt), and microfilaments (mf), respectively, could be recognized in individual cells without interference. the phase of the cell cycle was determined by dna content. we found that in indian muntjac (im) cells, the amount of tubulin in g2 and m phases was about twice as mu ...19883402282
scanning electron microscope analysis of structural changes and aberrations in human chromosomes associated with the inhibition and reversal of inhibition of ultraviolet light induced dna repair.metaphase chromosomes appear decondensed in preparations from mitotic cells that have been irradiated with ultraviolet light (uv) and incubated with inhibitors of dna synthesis; under these conditions dna repair is inhibited and both single and double strand dna breaks accumulate. after reversal of the inhibition chromosomes are condensed, but are often damaged. in this paper we show by scanning electron microscopy (sem) that decondensed hela chromosomes are composed of fibre clusters similar to ...19873436222
direct evidence for the non-random localization of mammalian chromosomes in the interphase nucleus.indirect immunofluorescence staining with human anti-centromere autoantibodies from a patient (lu 851) suffering from the crest form of scleroderma was used to analyse chromosome topology in interphase nuclei of rat-kangaroo (pto) and indian muntjac (im) cells. in some cells, centromeres were arranged in pairs suggesting association of homologous chromosomes. clustering of centromeres at one pole of the nucleus (rabl configuration) and other patterns suggesting higher order organization were als ...19863530789
a highly repetitive dna component common to all cervidae: its organization and chromosomal distribution during evolution.in recent work we have isolated and characterized a highly repetitive dna (mmv satellite ia) from muntiacus muntjak vaginalis, the species with the most reduced karyotype in the cervidae family. we have now analysed the genomes of nine related species for the presence of mmv satellite ia components, and have determined their organization and chromosomal distribution. repetitive satellite ia type dna is present in all species of the cervidae, and also in the bovine, but not in a species of the tr ...19873595313
the organization of the mammalian kinetochore: a scanning electron microscope study.a procedure has been developed for scanning electron microscopy that enables the visualization of kinetochores along the surface of isolated chromosomes of the indian muntjac. indirect immunofluorescence and thin section analysis of the kinetochores of those isolated chromosomes verified that these structures retained in vivo composition and morphology during the isolation procedure. in scanning electron micrographs the outer surface of the outer kinetochore plate can be visualized as a series o ...19873608716
co-cultivation of whole blood from male and female muntjacs and the cell proliferation kinetics in vitro.a mixed blood culture (mbc) of heparinized whole blood from male and female indian muntjac has been done using the brdu-hoechst-sunlight-giemsa method to study the cell-cycle kinetics in vitro. blood lymphocytes of both male and female muntjacs show a much shorter cell cycle time, roughly, 10-12 h for the initial but only 8 h for the subsequent cycles. there is a significant difference in the rate of cell proliferation between male and female cells. the male blood cells constitute a majority of ...19863713720
heterochromatin organization in the nucleus of indian muntjac (muntiacus muntjak).the heterochromatin in indian muntjac (muntiacus muntjak) is located at the periphery of primary constrictions of all the chromosomes. the x chromosome contains significantly larger amounts of heterochromatin than the rest of the complement by c-banding technique. however, the small portion of c-band region was found to be resistant by restriction endonuclease haeiii (5'...gg decreases cc...3') and was clearly visible on the nucleus. therefore, the position of this large heterochromatic segment ...20123756610
the fate of x-ray-induced chromosome aberrations in blood lymphocyte culture.the brdu-giemsa method which facilitates an unequivocal identification of metaphases at different cycles has been utilized to investigate the fate of x-ray-induced chromosome aberrations in the blood lymphocyte culture system of the indian muntjac which has the lowest diploid number (2n = 6 female/7 male) and easily distinguishable large-sized chromosomes. the results demonstrate that about 50% of dicentrics and only 12% of rings were transmitted from the first cycle to the second. there were as ...19873796662
two-parameter data acquisition system for rapid slit-scan analysis of mammalian chromosomes.a data acquisition system is described for recording two independent signals simultaneously from a laser-based flow cytometer for rapid slit-scan chromosome analysis. high-aperture microscope optics allow recording of fluorescence distributions along the longest axis of metaphase chromosomes with a spatial resolution better than 1 micron. fluorescence and small angle forward light scatter as well as dual-wavelength fluorescence signals from indian muntjac chromosomes stained with propidium iodid ...19873803098
the g-banded chromosomes of roosevelt's muntjac, muntiacus rooseveltorum.the chromosomes of a female roosevelt's muntjac (muntiacus rooseveltorum) captured in laos have been studied with g-banding. the diploid number is six and the karyotype is indistinguishable from that of the indian muntjac (muntiacus muntjak vaginalis).19853979122
the muntjak satellite ia sequence is composed of 31-base-pair internal repeats that are highly homologous to the 31-base-pair subrepeats of the bovine satellite 1.715.the nucleotide sequence of a cloned muntjak satellite ia repeat unit (muntiacus muntjak vaginalis) was determined. the repeat is 807 base pairs (bp) long. by introducing minor deletions and insertions, the whole sequence of the satellite can be arranged in 27 subrepeats of 31 bp length. although diverged relative to each other, all subrepeats show a homology of more than 53% with the common consensus sequence. in 29 out of the 31 bp the consensus sequence of the muntjak satellite subrepeat is id ...19853979396
characterization of g-banded chromosomes of the indian muntjac and progression of banding patterns through different stages of condensation.muntjac prophase and metaphase chromosomes were g-banded following methotrexate-mediated synchronization of peripheral lymphocytes. bands and subbands were characterized from prophase through metaphase, and the progression of band patterns from late prophase to mid-metaphase was analyzed. extended prophase chromosomes exhibited more bands and subbands, a number of which became fused with each other, giving rise to fewer and thicker bands in the condensed metaphase chromosomes. it appeared that t ...19854006518
heterochromatin of the indian muntjac. replication, condensation, dna ultracentrifugation, fluorescent and heterochromatin staining. 19714106459
prematurely condensed chromosomes of the indian muntjac: a model system for the analysis of chromosome condensation and banding. 20144135823
constitutive heterochromatin of indian muntjac chromosomes revealed by dnase treatment and a c-banding technique. 19744138961
idiogram and fluorescence pattern of the chromosomes of the indian muntjac. 19714142014
[setaria (a) andersoni n. sp., filaria of muntiacus muntjak cervidae in south vietnam]. 19724679131
a comparison of prophase and metaphase g-bands in the muntjak. 20194736396
germ-cell chromosomes and their behavior during meiosis in a male indian muntjac, muntiacus muntjak. 19725020837
an investigation of somatic pairing in the muntjak (muntiacus muntjak). 19725038358
nonrandom arrangement of metaphase chromosomes in cultured cells of the indian deer, muntiacus muntjak. 19725038359
[ethological observations on captive and semi-wild muntjaks (muntiacus muntjak zimmermann 1780 and m. reevesi ogilby 1839)]. 19715104269
indian muntjac, muntiacus muntjak: a deer with a low diploid chromosome number.the indian muntjac (muntiacus muntjak) has a diploid chromosome number of 7 in the male and 6 in the female, the lowest number yet described in a mammal. its near relative, reeve's muntjac (muntiacus reevesi) has a diploid number of 46, and the karyotypes of the two, species are very different.19705444269
fine structure of kinetochore in indian muntjac. 19715569205
sce and dna methylation.the interrelationship between sister chromatid exchange (sce) formation and dna methylation was studied in chinese hamster v79 and indian muntjac cells. a dna methylation inhibitor, 5-azacytidine (5azac), induced sces only when it had been present in cells for at least 2 rounds of dna replication. this result suggests that sces are formed during replication of hemimethylated or demethylated dna possessing 5azac, and that hypomethylated sites may become fully methylated after they pass 1 cell div ...19846085258
visible light observations on the kinetochore of the indian muntjac, muntiacus muntjac, z.we report here a silver stain technique (kt stain) for locating the kinetochore (centromere body) without concomitant staining of c-band material. we compare our observations with those obtained from c-banding, cd (centromeric dot) banding, and electron micrographs, and we report preliminary observations on indian muntjac centromeres.19806156799
dna methylation and viral gene expression in adenovirus-transformed and -infected cells.the level of dna methylation in adenovirus type 2 (ad2) and type 12 (ad12) dna was determined by comparing the cleavage patterns generated by the isoschizomeric restriction enzymes hpaii and mspi. as previously reported virion dna of ad2 and ad12 is not methylated. parental or newly synthesized ad2 dna in productively infected human kb or hek cells is not methylated either, nor is the integrated form of ad2 dna in productively infected cells. hamster cells and muntiacus muntjak cells are abortiv ...19806160461
sister chromatid differentiation and isolabeling of chromosomes.isolabeling observed during sister chromatid differentiation (scd) was studied from human skin fibroblasts by the fluorescence-plus-giemsa (fpg) technique. bromodeoxyuridine (brdu) was fed to exponentially dividing cells for 52 h to enable completion of two consecutive cycles of dna replication. during this period, the late-replicating regions of some chromosomes were able to go through three replication cycles. these chromosome regions had evidently incorporated brdu bifiliarly in both chromati ...19816165669
evidence for non-random sequence of centromere separation in muntjak chromosomes by high resolution tv-microscopy.the sequence of separation of sister centromeres in the chromosomes of the muntjak was analysed using a high resolution tv-microscope-system. computer programs which permit the identification of the individual chromosome pairs and the measurement of the distances between the sister centromeres are described. the study demonstrates that the centromeres do not separate in a random sequence. it could be shown that the amount of pericentromeric heterochromatin participates in the control of centrome ...19836204653
Displaying items 1 - 100 of 240