Publications

histochemical localization of enzymes in the stigma and style of gossypium hirsutum l. during pre- and post-pollination stages.	the distributional pattern of some enzymes (esterase, beta-d-galactosidase, succinate dehydrogenase and malate dehydrogenase) is described in the dry stigma and closed style of gossypium hirsutum l. during pre- and post-pollination stages. all the four enzymes indicated granular reaction and increased activity in the transmitting tissue and its surrounding cells during post pollinated stage. the possible physiological role of these enzymes in pollen tube growth in vivo in stigma and style is dis ...	2001	114462
the protein inclusions in sieve elements of cotton (gossypium hirsutum l.).		1978	209208
buoyant density determination- on chloroplast dna in a variegated cytoplasmic mutant of gossypium hirsutum l.		1977	901444
effect of high-temperature stress on the growth and seed characteristics of barley and cotton.	the existence of a sensitivity gradient to a uniform high-temperature stress applied at stages during seed maturation can be demonstrated in barley. the germination of freshly harvested seed is depressed following heat stress at 7--10 days after awn emergence, but is enhanced by the same stress applied 3 weeks after awn emergence. the depression is attributed to reduced viability associated with thermal injury. the stimulation following stress at more mature stages of seed development is related ...	2015	1032107
intragenome distribution of 5-methylcytosine in dna of healthy and wilt-infected cotton plants (gossypium hirsutum l.).	fractionation of dna of healthy and wilt-infected cotton plants has been carried out according to the reassociation kinetics and the content of gc and 5-methylcytosine in the resulting fractions has been studied. the genome of cotton plant was found to be methylated quite unevenly. the gc rich (gc equals 64.7 mole%) fraction of highly reiterated sequences (cot equals 0-3.7 times 10- minus 2) has a high content of 5-methylcytosine (5.8 mole%), whereas the methylation degree of the fraction of uni ...	1975	1168849
[molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction].	using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to c-terminal peptides ggaactcccttttctggatagctcacc and cctggtccgaacccaaacaggacgcccc, were used to amplify, via polymerase chain reaction, genomic sequences from two gossypium species, a diploid gossypium herbaceum, and a tetraploid gossypium hirsutum cv. 108f. amplified dna was separated into individual sequences by cloning into an m13 vector. six diff ...	2006	1339958
circadian rhythm of heat resistance in cotton seedlings: synthesis of heat-shock proteins.	cotton (gossypium hirsutum l. cv. deltapine 50) seedlings grown under light-dark cycles of 12:12 h at 33 degrees c showed rhythmic changes in their resistance to heat shock of 53 degrees c for 40 min. the resistance was maximal at the middle of the light period and declined toward the end of the light period. one more peak of resistance developed in the middle of the dark period and declined toward the end of the dark period. rhythmic changes in heat resistance persisted under continuous light f ...	1992	1468437
gene expression in cotton (gossypium hirsutum l.) fiber: cloning of the mrnas.	cotton, an important natural fiber, is a differentiated epidermal cell. the number of genes that are active in fiber cells is similar to those in leaf, ovule, or root tissues. through differential screening of a fiber cdna library, we isolated five cdna clones that are preferentially expressed in fiber. one of the cdna clones, pcke6, corresponded to an abundant mrna in fiber. transcripts for e6 were detected throughout the development of the fiber. immunoprecipitation of in vitro translation pro ...	1992	1631059
two temporally synthesized charge subunits interact to form the five isoforms of cottonseed (gossypium hirsutum) catalase.	five charge isoforms of tetrameric catalase were isolated from cotyledons of germinated cotton (gossypium hirsutum l.) seedlings. denaturing isoelectric focusing of the individual isoforms in polyacrylamide gels indicated that isoforms a (most anodic) and e (most cathodic) consisted of one subunit of different charge, whereas isoforms b, c and d each consisted of a mixture of these two subunits. thus the five isoforms apparently were formed through combinations of two subunits in different ratio ...	1990	1695843
development and regulation of three glyoxysomal enzymes during cotton seed maturation and growth.	the temporal, nonconcerted development of activities of malate synthase (ms), isocitrate lyase (icl), and catalase (cat) was explored in more detail in maturing and germinated cotton (gossypium hirsutum l.) seeds. rna was extracted at six intervals beginning at 17 days post anthesis (dpa) through 72 hours post imbibition (hpi). in vitro translations revealed that mrnas for each enzyme were translatable at all intervals. enzyme activities and immunoselected proteins also were found at all interva ...	1990	1714313
acquisition of membrane lipids by differentiating glyoxysomes: role of lipid bodies.	glyoxysomes in cotyledons of cotton (gossypium hirsutum, l.) seedlings enlarge dramatically within 48 h after seed imbibition (kunce, c.m., r.n. trelease, and d.c. doman. 1984. planta (berl.). 161:156-164) to effect mobilization of stored cotton-seed oil. we discovered that the membranes of enlarging glyoxysomes at all stages examined contained a large percentage (36-62% by weight) of nonpolar lipid, nearly all of which were triacylglycerols (tags) and tag metabolites. free fatty acids comprised ...	1991	1955468
the degree of susceptibility of nectary-inoculated cotton flowers and bolls to subsequent seed infection by aspergillus flavus is determined at or before anthesis.	in greenhouse and field studies, cotton (gossypium hirsutum l.) flowers were inoculated with aspergillus flavus at the involucral nectaries. bolls developing from early-season flowers had significantly higher percentages of a. flavus-infected seed than did bolls from flowers formed later in the season. seeds from bolls inoculated 2 weeks after anthesis had the same infection levels as those from flowers inoculated at anthesis. these results indicate that early-season flowers are predisposed to a ...	1990	2119569
[molecular characteristics of the chalcone synthetase gene family in the tetraploid variety of gossypium hirsutum 108 f].		1990	2152190
characterization of a cdna clone encoding the complete amino acid sequence of cotton isocitrate lyase.	a cdna clone encoding the glyoxysomal enzyme isocitrate lyase (icl) (ec 4.1.3.1) was isolated from a library prepared from cotton (gossypium hirsutum l.) cotyledon poly(a)+ rna. the clone is 1893 basepairs (bp) in length and contains a 1728 bp open reading frame encoding a polypeptide of 576 residues (mr = 64,741). the deduced amino acid sequence of cotton icl is 85.2%, 90.3% and 41.1% identical to icl from rapeseed, castor bean and e. coli, respectively. cotton icl has a c-terminal tripeptide o ...	1990	2194576
a novel metabolic form of the 32 kda-d1 protein in the grana-localized reaction center of photosystem ii.	two forms of the 32 kda-d1 reaction center protein of photosystem ii (psii), having slightly different mobilities on denaturing polyacrylamide gels, have been resolved in spirodela oligorrhiza, glycine max l., gossypium hirsutum l., triticum aestivum l., and zea mays l. the protein band with faster mobility is identified as the 32 kda-d1 protein, and the less mobile band as a novel form, designated 32*. the two forms are structurally similar based on immunological and partial proteolytic tests. ...	1990	2203777
nucleotide sequence of the chloroplast rbcl gene from cotton gossypium hirsutum.		1990	2308826
effects of diuron and fluometuron metabolites on the growth and fiber quality of cotton (gossypium hirsutum).		1990	2322667
cottonseed extract versus pharmamedia for the in vitro mould-yeast conversion of blastomyces dermatitidis.	a cottonseed medium, based on a 1% aqueous extract of seeds of any of the eight indigenously available varieties of cotton belonging to gossypium hirsutum or gossypium arboreum, was evaluated for the mould-yeast conversion of blastomyces dermatitidis in vitro, and compared with pharmamedia agar as a control. the cottonseed agar was found to be as efficient as pharmamedia agar for the mould-yeast conversion of the 19 b. dermatitidis strains tested. therefore, cottonseeds provide an adequate and i ...	1990	2380881
nucleotide sequences of the chloroplast psba and trnh genes from cotton gossypium hirsutum.		1990	2408006
in situ hybridization of biotinylated dna probes to cotton meiotic chromosomes.	a modified procedure for in situ hybridization of biotinylated probes to meiotic chromosomes of cotton has been developed with high retention of squashed cells on slides, preservation of acid-fixed chromosome morphology, exceptionally low levels of background precipitate at nonspecific hybridization sites and improved photomicrographic recording. salient features of the techniques include pretreatment of slides before squashing, cold storage of squash preparations, and use of interference filter ...	1989	2741183
restriction fragment length polymorphisms in diploid and allotetraploid gossypium: assigning the late embryogenesis-abundant (lea) alloalleles in g. hirsutum.	we have determined the copy number of 21 genes in an allotetraploid and several diploid species of cotton by gel and dot blot hybridization with cloned cdnas. the legumin a, legumin b, and all 18 unique lea (late embryogenesis-abundant) cdna sequences isolated from the ad allotetraploid gossypium hirsutum are present in one copy in a, d, e, and f diploid species and in two copies in g. hirsutum. gel blot analysis of dnas digested with ecori or bamhi usually detects different sized fragments in a ...	1988	2895416
accumulation kinetics of cotton late embryogenesis-abundant mrnas and storage protein mrnas: coordinate regulation during embryogenesis and the role of abscisic acid.	the accumulation of total rna transcripts of 18 late embryo-abundant (lea) gene families, each encoding two closely related lea mrnas, was measured in cotyledon total rna during embryogenesis and germination of gossypium hirsutum l. by rna dot hybridization. transcript abundance of the three storage protein families was also followed. the lea mrnas belong to only two related groups of commonly regulated mrnas. the transcript level of each of the 6 members of class i has two transient maxima duri ...	1987	2957260
purification and biosynthesis of cottonseed (gossypium hirsutum l.) catalase.	as part of our research on peroxisome biogenesis, catalase was purified from cotyledons of dark-grown cotton (gossypium hirsutum l.) seedlings and monospecific antibodies were raised in rabbits. purified catalase appeared as three distinct electrophoretic forms in non-denaturing gels and as a single protein band (with a subunit mr of 57,000) on silver-stained sds/polyacrylamide gels. western blots of crude extracts and isolated peroxisomes from cotton revealed one immunoreactive polypeptide with ...	1988	3134010
studies on the sites expressing evolutionary changes in the structure of eukaryotic 5s ribosomal rna.	we have determined the complete sequences of 5s rrnas from a lamprey (lampetra reissneri), a lancelet (branchiostoma belcheri), silkworms (philosamia cynthia ricini, bombyx mori, antheraea pernyi), and a silkworm hybrid (artificially fertilized hybrid species of philosamia cynthia ricini male x bombyx mori female), as well as those of cotton seeds (gossypium hirsutum l.). having compared more than 170 eukaryotic 5s rrnas of which seven sequences have been determined by our group as mentioned abo ...	1988	3146644
phosalone applied to cotton (gossypium hirsutum l.): its deposition and persistence on foliages, soils and final residues in seeds.	phosalone, o,o-diethyl-s-(6-chloro-1,3-benzoxazol-2(3h)-onyl)methyl phosphorodithioate, was field-applied by ground equipment to cotton (gossypium hirsutum l.) at the rates of 1050 and 2100 g a.i./ha, respectively, to determine its dissipation on leaves and soils and the residues in seeds at harvest. the insecticide concentrations on cotton leaves and soils were measured periodically for 14 days following its application. it was found that the half lives of the insecticide on cotton leaves at th ...	1988	3372940
regulation of in vivo nitrate reductase activity in cotton (gossypium hirsutum) leaves in light and dark and the possible role of cytokinin.		1987	3452593
coordinate accumulation of homeologous transcripts of seven cotton lea gene families during embryogenesis and germination.	one of two related patterns of total transcript accumulation are seen during embryogenesis for 18 cotton lea (late embryogenesis-abundant) gene families in the allotetraploid cotton gossypium hirsutum l. cv coker 201. coordinate accumulation in each class is complex, suggesting that lea mrna abundance is regulated by several events. each of the lea gene families probably contains two active homeologous genes (alloalleles), one in each of cotton's two subgenomes. it is of interest whether both tr ...	2013	3622929
recovery of soluble proteins from glanded cotton tissues with amines.	a simple soluble protein extraction method was developed for glanded cotton (gossypium hirsutum l.) tissues. gossypol, a major component of glands, is known to crosslink and precipitate proteins in cotton tissue homogenates. established phenolic removal reagents were evaluated as gossypol binding agents and found to be less than effective in enhancing cotton leaf-soluble protein recovery. several other amines, including a number of affinity support bound amines, were tested and found relatively ...	1986	3706729
proceedings: distribution of histamine-releasing activity in gossypium hirsutum l.		1973	4132097
some ultrastructural and enzymatic effects of water stress in cotton (gossypium hirsutum l.) leaves.	water stress induced by floating discs cut from cotton leaves (gossypium hirsutum l. cultivar stoneville) on a polyethylene glycol solution (water potential, -10 bars) was associated with marked alteration of ultrastructural organization of both chloroplasts and mitochondria. ultrastructural organization of chloroplasts was sometimes almost completely destroyed; peroxisomes seemed not to be affected; and chloroplast ribosomes disappeared. also accompanying water stress was a sharp increase in ac ...	1974	4528731
the inheritance of gossypol level in gossypium. ii. inheritance of seed gosypol in two trains of cultivated gossypoium barbadense l.	two strains of cultivated gossypium barbadense l., sea island as-2 and pima s-4, were used to study the effects of alleles at two loci on the production and/or storage of gossypol in mature embryos. the normal alleles, gl(2) and gl(3), are "native" to g. barbadense, whereas the mutant alleles, gl(2) and gl(3), were introduced from gossypium hirsutum l. through backcrossing. each strain was grown in three replications per trial, and one, sea island as-2, was grown in three environments. each expe ...	1973	4769299
in vitro culture of callus tissues and cell suspensions from okra (hibiscus esculentus l.) and cotton (gossypium hirsutum l.).		2013	4842933
the effect of trifluralin on the ultrastructure of dividing cells of the root meristem of cotton (gossypium hirsutum l. "acala 4-42').		1974	4854787
strontium mobility in germinating seeds and plants.	the uptake of strontium in the bean plant (phaseolus vulgaris) was linear for the first 34 hr during continuous exposure to radiostrontium. after 35 hr there was a sharp increase in the rate of uptake to 48 hr. radioactivity could be detected in the plant as early as 1 hr after addition of radiostrontium to the growth medium.seventy-five percent of the radiostrontium was located in the seed coat immediately after soaking bean seed in an (89)sr solution. this radioactivity in the seed coat decrea ...	1969	5775205
american cotton rat (sigmodon hispidus) as an experimental host for brugia pahangi.		1965	5857267
light effects on the nucleic acids of excised cotton cotyledons.	the effects of light and glucose in the nutrient medium on the nucleic acid metabolism of excised 8-day cotton (gossypium hirsutum var. acala 44) cotyledons were determined. the rates of synthesis as affected by light and glucose were determined by brief exposures to c(14)-labeled orotic acid. the nucleic acids were fractionated by homogenizing in tris-hcl buffer and centrifuging to obtain soluble and microsomal rna (20,000 x g supernatant) and a particulate nucleic acid fraction (20,000 x g pre ...	1966	5906375
effect of ethylene on auxin transport.	ethylene was found to have no influence on auxin transport in hypocotyls of helianthus annuus and phaseolus vulgaris; coleoptiles of zea mays; petiole sections of gossypium hirsutum, phaseolus vulgaris, and coleus blumei. in the experiments described here, the tissues were treated with ethylene only during the 3 hours of polar transport. this short treatment is in contrast to the methods of others who found an effect of ethylene on auxin transport when plants grown in ethylene are used as experi ...	1966	5990936
diurnal rhythm of sensitivity of cotton seedlings to herbicides.	the inhibition of growth of cotton seedlings (gossypium hirsutum, var. stardel) varied diurnally to applications of three herbicides [1,1-dimethyl-3-(alpha,alpha,alpha-trifluoro-m-tolyl) urea, 3',4'-dichloro-2-methacrylamide, and ethyl-n,n-dipropylthiocarbamate], but not to a fourth [3-(3,4-dichlorophenyl)-1, 1-dimethylurea]. inhibition was strongest when the plants were treated at about daybreak. the rhythmic response was apparently not endogenously controlled, since most of the diurnal effect ...	1967	6054808
addition of proteins to the cylindrical gel embedding medium for transverse molecular-weight markers in two-dimensional gel electrophoresis.	as an aid in the comparison of different complex mixtures of proteins resolved by two-dimensional electrophoresis, a simple method which results in the electrophoresis of molecular-weight standards as appropriately migrating, highly resolved bands extending across the entire second-dimension slab gel is described. the proteins to be used as markers are included in the molten agarose mixture used to affix the first-dimension cylindrical gel atop the second-dimension slab gel. as the proteins whic ...	1984	6486420
mortality from byssinosis among new england cotton mill workers, 1905-1912.	little was known about mortality from byssinosis among american cotton mill workers until recent times. between 1912 and 1919, the labor department published two detailed investigations of mortality by cause of death among cotton mill workers and other residents of several new england mill towns. statistical tests reveal no significant difference in mortality rates from nontubercular respiratory diseases between cotton textile workers and other mill town residents. even when ex-mill workers who ...	1982	6759625
chloramphenicol stimulates acid phosphatase activity in germinating cotton (gossypium hirsutum) embryos.	low dosages of chloramphenicol (25-50 micrograms/ml) brought about a 2-4-fold stimulation of acid phosphatase activity in 48 h-germinated cotton (gossypium hirsutum) embryos. however, at high concentrations of chloramphenicol (100-1000 micrograms/ml), there was a progressive decline in enzyme activity. the stimulatory effect of the drug on acid phosphatase activity was relatively specific, since no significant stimulation of activities of proteinase, deoxyribonuclease, ribonuclease, o-diphenolas ...	1983	6870857
microtubules in differentiating sieve elements of gossypium hirsutum.		1982	7077737
changes in the endoplasmic reticulum during differentiation of a sieve element in gossypium hirsutum.		1981	7241641
nuclear degeneration and the association of endoplasmic reticulum with the nuclear envelope and microtubules in maturing sieve elements of gossypium hirsutum.		1981	7241642
ultrastructural studies of protophloem sieve elements in gossypium hirsutum.		1981	7277570
prenyltransferase from gossypium hirsutum.		1980	7436426
n-acylphosphatidylethanolamine in dry and imbibing cottonseeds. amounts, molecular species, and enzymatic synthesis.	n-acylphosphatidylethanolamine (nape), an unusual acylated derivative of phosphatidylethanolamine (pe), was recently shown to be synthesized from pe and free fatty acids in cotyledons of cotton (gossypium hirsutum l.) seedlings (k.d. chapman, t.s. moore [1993] plant physiol 102: 761-769). here we report that nape is present in dry seeds of cotton and increases with time of imbibition from 2.31 nmol/seed in dry seeds to 4.26 nmol/seed in 4-h-soaked seeds. total phospholipid/seed also increased su ...	1995	7480326
a modified hot borate method significantly enhances the yield of high-quality rna from cotton (gossypium hirsutum l.).	the isolation of biologically active rna from cotton (gossypium hirsutum l.) is difficult due to interference by high levels of endogenous phenolics, polysaccharides, and secondary metabolites. a modified hot borate procedure was developed to combat these cellular constituents during tissue homogenization, resulting in the quantitative recovery of rna suitable for hybridization analysis, in vitro translation, and cdna synthesis. the efficacy of several hot borate buffer adjuvants for the qualita ...	1994	7535022
a membrane-associated form of sucrose synthase and its potential role in synthesis of cellulose and callose in plants.	sucrose synthase (susy; ec 2.4.1.13; sucrose + udp reversible udpglucose + fructose) has always been studied as a cytoplasmic enzyme in plant cells where it serves to degrade sucrose and provide carbon for respiration and synthesis of cell wall polysaccharides and starch. we report here that at least half of the total susy of developing cotton fibers (gossypium hirsutum) is tightly associated with the plasma membrane. therefore, this form of susy might serve to channel carbon directly from sucro ...	1995	7568131
characterization of mrna for a proline-rich protein of cotton fiber.	cotton (gossypium hirsutum l.) mrna (h6) is expressed predominantly in fiber cells and is present during early primary cell wall formation. however, h6 protein is found to accumulate during later stages, when active secondary cell wall formation occurs, indicating possible regulation at the translational level and function in the secondary cell wall assembly. the nucleotide-derived amino acid sequence of pck-h6 is proline rich (35 mol %) with a calculated molecular mass of 21 kd. cotton protein ...	1995	7610164
organization, inheritance and expression of acetohydroxyacid synthase genes in the cotton allotetraploid gossypium hirsutum.	the acetohydroxyacid synthase (ahas) gene family of the cotton ad allotetraploid gossypium hirsutum has been cloned and characterized. we have identified six different ahas genes from an analysis of genomic clones and southern blots of genomic dna. four of the six genes are organized as tandem pairs, in which the genes are separated by only 2-3 kb. conservation of restriction fragment length polymorphisms between g. hirsutum and a-genome and d-genome-containing diploid cottons was sufficient to ...	1995	7640356
expression of two related vacuolar h(+)-atpase 16-kilodalton proteolipid genes is differentially regulated in a tissue-specific manner.	the 16-kd proteolipid subunit is the principal integral membrane protein of the vacuolar h(+)-atpase (v-atpase) complex that forms the proton channel responsible for translocating protons across lipid bilayers. two degenerate synthetic oligonucleotides, cot11 and cot12, corresponding to highly conserved transmembrane domains in all 16-kd subunits sequenced so far, were used to amplify a partial cdna of the v-atpase proteolipid subunit from cotton (gossypium hirsutum l.) by polymerase chain react ...	1995	7659746
solubilization and partial characterization of extensin fragments from cell walls of cotton suspension cultures. evidence for a covalent cross-link between extensin and pectin.	extensin, a major hydroxyproline (hyp)-rich glycoprotein in walls of cultured cells of dicotyledonous plants, is very difficult to solubilize. to learn about the nature of the insolubilization, we have tested the ability of a variety of selective hydrolytic methods, and combinations of them, to liberate extensin or fragments of extensin from suspension-culture cell walls. after the complete deglycosylation of cotton (gossypium hirsutum l.) walls, trypsinization solubilized 80% of the hyp. the se ...	1995	7659756
copia-like retrotransposable element evolution in diploid and polyploid cotton (gossypium l.).	copia-like retrotransposable elements were identified in allotetraploid cotton, gossypium hirsutum, and two species representing its diploid progenitors, g. herbaceum and g. raimondii. these elements are present in high copy number in all three species. because the two diploid genomic groups have been isolated on opposite sides of the world for 6-11 million years, horizontal transfer of elements between these species is highly unlikely. elements were intensively sampled to generate a model of co ...	1993	7685393
a view of plant dehydrins using antibodies specific to the carboxy terminal peptide.	dehydrins are characterized by the consensus kikeklpg amino acid sequence found near the carboxy terminus, and usually repeated from one to many times within the protein. a synthetic peptide containing this consensus sequence was used to produce specific antibodies that recognize dehydrins in a wide range of plants. this range covered two families of monocots, viz. gramineae (hordeum vulgare l., triticum aestivum l., zea mays l., oryza sativa l.) and liliaceae (allium sativa l.), and five famili ...	1993	7693020
simultaneous induction of postabscission and germination mrnas in cultured dicotyledonous embryos.	cloned mrnas identify three programs of gene expression in cotton (gossypium hirsutum l.) embryos that are associated with the maturation (reserve accumulation) stage, the postabscission stage, which is marked by expression of late-embryogenesis-abundant (lea) mrnas, and germination (broadly defined as including all events through early postgerminative growth). in order to test if the regulation of these programs is the same in other dicotyledonous species, their expression was studied in normal ...	1994	7764404
characterization of a cotton (gossypium hirsutum l.) fiber mrna (fb-b6).		1995	7770543
a cdna encoding ribosomal protein s4e from cotton (gossypium hirsutum l.).		1995	7784518
isolation and characterization of a cdna encoding ribosomal protein s16 from cotton (gossypium hirsutum l.).		1994	7824648
the expression and anaerobic induction of alcohol dehydrogenase in cotton.	the alcohol dehydrogenase (adh) system in cotton is characterized, with an emphasis on the cultivated allotetraploid species gossypium hirsutum cv. siokra. a high level of adh activity is present in seed of siokra but quickly declines during germination. when exposed to anaerobic stress the level of adh activity can be induced several fold in both roots and shoots of seedlings. unlike maize and arabidopsis, adh activity can be anaerobically induced in mature green leaves. three major adh isozyme ...	1994	7826315
a detailed rflp map of cotton, gossypium hirsutum x gossypium barbadense: chromosome organization and evolution in a disomic polyploid genome.	we employ a detailed restriction fragment length polymorphism (rflp) map to investigate chromosome organization and evolution in cotton, a disomic polyploid. about 46.2% of nuclear dna probes detect rflps distinguishing gossypium hirsutum and gossypium barbadense; and 705 rflp loci are assembled into 41 linkage groups and 4675 cm. the subgenomic origin (a vs. d) of most, and chromosomal identity of 14 (of 26), linkage groups is shown. the a and d subgenomes show similar recombinational length, s ...	1994	7851778
cotton (gossypium hirsutum l.) pollen-specific polygalacturonase mrna: tissue and temporal specificity of its promoter in transgenic tobacco.	a gene (g9) expressed during late microsporogenesis in cotton (gossypium hirsutum l.) was isolated. sequence analysis of the cdna (1.3 kb) as well as the gene (2.6 kb) revealed an open reading frame of 1233 bases encoding a protein of 43.9 kda. the coding region of the gene is interrupted by three introns. northern analysis of the rna from developing anthers showed that the transcripts appear 12 days before anthesis and that the maximal concentration of rna occurs in pollen on the day of anthesi ...	1994	7858233
isolation and characterization of a cdna encoding ribosomal protein l41 from cotton (gossypium hirsutum l.).		1994	7972506
isolation of multiple cdnas encoding the vacuolar h(+)-atpase subunit b from developing cotton (gossypium hirsutum l.) ovules.		1994	7972522
phenylalanine ammonia-lyase from cotton (gossypium hirsutum) hypocotyls: properties of the enzyme induced by a verticillium dahliae phytotoxin.	phenylalanine ammonia-lyase (ec 4.3.1.5), induced by a verticillium dahliae phytotoxin, has been purified to electrophoretic homogeneity from cotton hypocotyls by differential ammonium sulfate fractionation and hydrophobic interaction chromatography, with a yield of 52%. the enzyme is a tetramer with a molecular weight of 332,000 to 337,000. the isoelectric point is 4.6, and no isoforms were observed. the subunits of the enzyme are unstable and breaks down to fragments with m(r)'s of 69,000 and ...	1994	8043606
a method for the isolation of nuclear dna from cotton (gossypium) leaves.	cotton leaves contain high levels of polyphenolic compounds that irreversibly interact with proteins and nucleic acids during dna isolation. a procedure to isolate nuclear dna from cotton (gossypium hirsutum l.) has been developed. the method is based on the rapid initial isolation of nuclei in a glucose medium designed to stabilize nuclear structure and composition while preventing covalent interactions with polyphenolics. the resulting dna is high in yield and purity and is suitable for southe ...	1993	8098189
vacuolar h(+)-atpase 69-kilodalton catalytic subunit cdna from developing cotton (gossypium hirsutum) ovules.		1993	8108515
[nucleotide sequence of internal transcribed spacers and 5.8s rdna for the ribosomal operon from alfalfa medicago sativa and cotton gossypium hirsutum l].	the 708- and 769-bp fragments from alfalfa and cotton containing the 3'-end of the 18s gene, the internal transcribed spacer. 1 (its1) the 5.8s gene, its2, and the 5'-end of the 28s gene were obtained using primers to the 18s and 28s ends of rdna from tomato by a polymerase chain reaction. these sequences were cloned into ptz19r. the 5.8s rdna, its1 and its2 nucleotide sequences of alfalfa and cotton were determined. comparative analysis of nucleotide sequences of alfalfa and cotton showed large ...	2006	8145750
toxicity of cotton phytoalexins to zoopathogenic fungi.	the sesquiterpenoid phytoalexins desoxyhemigossypol, desoxymethoxyhemigossypol, and hemigossypolone formed in cotton (gossypium hirsutum and g. barbadense) stem xylem infected with verticillium dahliae were shown to be highly toxic to zoopathogenic fungi. this appears to be the first study of the toxicity of terpenoid phytoalexins to zoopathogenic fungi. the toxicities of the phytoalexins expressed as mic (micrograms ml-1) values were 8 to 128 against four isolates of candida albicans and one is ...	1993	8167949
cotton (gossypium hirsutum) matp6 and matp7 oleosin genes.		1993	8278515
permanent gases inside healthy and microbially infected cotton fruit during development.	permanent gases inside developing cotton fruit (gossypium hirsutum l.) were, by weight, 46% nitrogen, 29% oxygen, 4% argon and 20% carbon dioxide, whereas plant canopy air assayed at 73% nitrogen, 25% oxygen, 2% argon and 0.3% carbon dioxide. light exposure, fruit age, and mild infection (erwinia) had no compositional effect but aggressive infection (aspergillus) raised carbon dioxide content to 31% by weight and correspondingly lowered oxygen to 17%. respiration with oxygen replenishment except ...	1993	8466505
diversity in cyclic sesquiterpene production by gossypium hirsutum.	major sesquiterpene components of oil of texas race stock 810 of gossypium hirsutum were alpha- and beta-selinene. this is the seventh cyclic terpene type found to date in this genus. both alpha- and beta-selinene, along with aromadendrene, were found but only as minor components of extracts of several domestic cultivars of g. hirsutum.	1995	8590634
structural characterization of genes corresponding to cotton fiber mrna, e6: reduced e6 protein in transgenic plants by antisense gene.	two genes, each corresponding to fiber mrna e6, were isolated from cotton cultivars coker 312 (gossypium hirsutum l.) and sea island (g. barbadense l.). e6 is one of the predominant fiber-specific mrnas present during early fiber development. the distinguishing feature of nucleotide-derived e6 protein is the presence of a motif where a dimer, ser-gly, is repeated several times. two of the sea island genes contained a pentameric motif, ser-gly, while one of the coker genes had one and the other h ...	1996	8616253
distribution of 5s and 18s-28s rdna loci in a tetraploid cotton (gossypium hirsutum l.) and its putative diploid ancestors.	the most widely cultivated species of cotton, gossypium hirsutum, is a disomic tetraploid (2n=4x=52). it has been proposed previously that extant a- and d-genome species are most closely related to the diploid progenitors of the tetraploid. we used fluorescent in situ hybridization (fish) to determine the distribution of 5s and 18s-28s rdna loci in the a-genome species g. herbaceum and g. arboreum, the d-genome species g. raimondii and g. thurberi, and the ad tetraploid g. hirsutum. high signal- ...	1996	8662259
differential induction of 3-hydroxy-3-methylglutaryl coa reductase in two cotton species following inoculation with verticillium.	gossypium barbadense cottons are typically more resistant to wilt pathogens than are gossypium hirsutum cultivars. both species make terpenoid phytoalexins in response to infection, implicating isoprenoid biosynthesis as a factor in resistance. conserved regions in plant 3-hydroxy-3-methylglutaryl coenzyme a reductase (hmgr), the first enzyme in the terpene biosynthesis pathway, were used to design polymerase chain reaction primers for cloning a fragment of a cotton hmgr gene. the clone was used ...	1995	8664497
purification of (+)-delta-cadinene synthase, a sesquiterpene cyclase from bacteria-inoculated cotton foliar tissue.	a sesquiterpene cyclase whose activity is induced in a glandless, bacterial blight-resistant line of cotton (gossypium hirsutum l.) catalyses the conversion of (e,e)-farnesyl diphosphate to (+)-delta-cadinene. this enzyme was purified by a combination of salt-induced phase separation, hydroxylapatite fractionation, hydrophobic interaction and strong anion-exchange chromatography, and denaturing polyacrylamide gel electrophoresis, followed by renaturation with tween 80. the purified enzyme has a ...	1996	8728715
characterization and expression of metallothionein-like genes in cotton.	we have characterized cotton (gossypium hirsutum l.) genes encoding type 1 metallothionein-like proteins that are highly expressed in roots. little or no expression of these genes was detected in other organs and tissues. the deduced amino acid sequences have a high degree of similarity with type 1 metallothionein-like proteins from other plants, including a central hydrophobic domain flanked by conserved cysteine-rich motifs. the type 1 metallothionein-like genes of cotton are encoded by a smal ...	1996	8790303
the alcohol dehydrogenase genes of cotton.	we report here the initial characterization of the alcohol dehydrogenase (adh) gene family of the allotetraploid gossypium hirsutum, a crop plant that is highly sensitive to waterlogging. twelve adh cdnas were isolated from a library constructed from rna prepared from anaerobically stressed root tips. nine of the twelve cdnas fell into one class, while each of the other three cdnas fell into a separate class. the 3'-untranslated regions had little or no homology between classes implying that eac ...	1996	8806419
characterization and expression of chitinase and 1,3-beta-glucanase genes in cotton.	we have isolated cdna clones representing mrnas encoding chitinase and 1,3-beta-glucanase in cotton (gossypium hirsutum l.) leaves. the chitinase clones were sequenced and found to encode a 28,806 da protein with 71% amino acid sequence similarity to the sk2 chitinase from potato (solanum tuberosum). the 1,3-beta-glucanase clones encoded a 37,645 da protein with 57.6% identity to a 1,3-beta-glucanase from soybean (glycine max). northern blot analyses showed that chitinase mrna is induced in plan ...	1996	8806421
ribosomal protein rl44 is encoded by two subfamilies in upland cotton (gossypium hirsutum l.).	we have isolated 4 cdna clones encoding the full-length sequence of the eukaryotic ribosomal protein rl44 from upland cotton (gossypium hirsutum l.). sequencing of these clones resulted in the classification of 2 subfamilies of rl44; these subfamilies had coding regions (315 bp) which were 92% identical. rl44-1 (454 bp) and rl44-2 (485 bp) constitute subfamily 1, whereas rl44-3 (913 bp) and rl44-5 (541 bp) constitute subfamily 2. the differences in nucleotide sequences, however, occurred only at ...	1996	8806588
higher plants contain homologs of the bacterial cela genes encoding the catalytic subunit of cellulose synthase.	in spite of much effort, no one has succeeded in isolating and characterizing the enzyme(s) responsible for synthesis of cellulose, the major cell wall polymer of plants. we have characterized two cotton (gossypium hirsutum) cdna clones and identified one rice (oryza sativa) cdna that are homologs of the bacterial cela genes that encode the catalytic subunit of cellulose synthase. three regions in the deduced amino acid sequences of the plant cela gene products are conserved with respect to the ...	1996	8901635
use of meiotic fish for identification of a new monosome in gossypium hirsutum l.	the extensive use of molecular cytogenetics in human genetics and clinical diagnostics indicates that analogous applications in plants are highly feasible. one sort of application would be the identification of new aneuploids, which traditionally involves either direct karyotypic identification, which is feasible in only a few plant species, or tests with markers (cytogenetic, genetic, or molecular), which require sexual hybridization and at least one subsequent seed or plant generation. we have ...	1997	9061912
identification of a cotton fiber-specific acyl carrier protein cdna by differential display.	transcripts from immature fibers and stripped ovules (fibers removed) of cotton (gossypium hirsutum l.) were compared by differential display to identify cdna fragments that represent mrnas that are expressed primarily in cotton fibers. eight independent fiber-specific cdna fragments were isolated. one of these cdnas had strong sequence similarity with acyl carrier protein (acp). a full-length cdna for the cotton fiber-specific acp was isolated using a pcr cdna library screening technique. this ...	1997	9130594
sequence and rt-pcr expression analysis of two peroxidases from arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.	cdna clones encoding two new arabidopsis thaliana peroxidases, atp 1a and atp 2a, have been identified by searching the arabidopsis database of expressed sequence tags (dbest). they represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (armoracia rusticana) isoperoxidases hrp c, hrp e5 and the similar arabidopsis isoperoxidases atp ca, atp ...	1997	9132061
identification of a delta-tip cdna clone and determination of related a and d genome subfamilies in gossypium species.	tonoplast intrinsic proteins (tips) have been implicated in the process of cell elongation, such as occurs in the developing cotton fiber. we have isolated a cdna clone (997 bp in length) from a cotton (gossypium hirsutum l.) library which putatively encodes a protein of 248 residues (mr 25079) with 85% identity to arabidopsis delta-tip. the derived amino acid sequence included two conserved sequences associated with major intrinsic proteins (sgxhxnpa at residues 78 to 85, npa residues at 197 to ...	1997	9177317
manipulation of catalase levels produces altered photosynthesis in transgenic tobacco plants.	constructs containing the cdnas encoding the primary leaf catalase in nicotiana or subunit 1 of cottonseed (gossypium hirsutum) catalase were introduced in the sense and antisense orientation into the nicotiana tabacum genome. the n. tabacum leaf cdna specifically overexpressed cat-1, the high catalatic [corrected] form, activity. antisense constructs reduced leaf catalase specific activities from 0.20 to 0.75 times those of wild type (wt), and overexpression constructs increased catalase specif ...	1998	9449845
moderately high temperatures inhibit ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) activase-mediated activation of rubisco	we tested the hypothesis that light activation of ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) is inhibited by moderately elevated temperature through an effect on rubisco activase. when cotton (gossypium hirsutum l.) or wheat (triticum aestivum l.) leaf tissue was exposed to increasing temperatures in the light, activation of rubisco was inhibited above 35 and 30 degreesc, respectively, and the relative inhibition was greater for wheat than for cotton. the temperature-induced inhib ...	1998	9490757
genes involved in osmoregulation during turgor-driven cell expansion of developing cotton fibers are differentially regulated.	cotton (gossypium hirsutum l.) fibers are single-celled trichomes that synchronously undergo a phase of rapid cell expansion, then a phase including secondary cell wall deposition, and finally maturation. to determine if there is coordinated regulation of gene expression during fiber expansion, we analyzed the expression of components involved in turgor regulation and a cytoskeletal protein by measuring levels of mrna and protein accumulation and enzyme activity. fragments of the genes for the p ...	1998	9536073
polyploid formation created unique avenues for response to selection in gossypium (cotton).	a detailed restriction fragment length polymorphism map was used to determine the chromosomal locations and subgenomic distributions of quantitative trait loci (qtls) segregating in a cross between cultivars of allotetraploid (aadd) gossypium hirsutum ("upland" cotton) and gossypium barbadense ("sea island," "pima," or "egyptian" cotton) that differ markedly in the quality and quantity of seed epidermal fibers. most qtls influencing fiber quality and yield are located on the "d" subgenome, deriv ...	1998	9539752
analysis of plastid dna-like sequences within the nuclear genomes of higher plants.	a wide-ranging examination of plastid (pt)dna sequence homologies within higher plant nuclear genomes (promiscuous dna) was undertaken. digestion with methylation-sensitive restriction enzymes and southern analysis was used to distinguish plastid and nuclear dna in order to assess the extent of variability of promiscuous sequences within and between plant species. some species, such as gossypium hirsutum (cotton), nicotiana tabacum (tobacco), and chenopodium quinoa, showed homogenity of these se ...	1998	9615455
a fiberless seed mutation in cotton is associated with lack of fiber cell initiation in ovule epidermis and alterations in sucrose synthase expression and carbon partitioning in developing seeds	fiber cell initiation in the epidermal cells of cotton (gossypium hirsutum l.) ovules represents a unique example of trichome development in higher plants. little is known about the molecular and metabolic mechanisms controlling this process. here we report a comparative analysis of a fiberless seed (fls) mutant (lacking fibers) and a normal (fls) mutant to better understand the initial cytological events in fiber development and to analyze the metabolic changes that are associated with the loss ...	1998	9765525
structural analysis of a hmg-coa-reductase pseudogene: insights into evolutionary processes affecting the hmgr gene family in allotetraploid cotton (gossypium hirsutum l.).	structural analysis of hmg-coa reductase (hmgr) genes in the allotetraploid cotton species gossypium hirsutum l. revealed the first-known existence of a pseudogene, psihmg5, for this important enzyme. complete sequencing of the genomic clone hmg5 unveiled several deleterious lesions, resulting in an organization that departed significantly from the linear canonical hmgr gene structure. although analysis of the 5' flanking region indicated a promoter-like composition based on comparison with othe ...	1998	9799357
heterologous myb genes distinct from gl1 enhance trichome production when overexpressed in nicotiana tabacum.	myb-class transcription factors implicated in cell shape regulation were overexpressed in arabidopsis thaliana and nicotiana tabacum in an attempt to assess the extent to which cellular differentiation programs might be shared between these distantly related plants. glabrous 1, a myb gene required for trichome development in arabidopsis, did not alter the trichome phenotype of the tobacco plants in which it was overexpressed. mixta, which in antirrhinum majus is reported to regulate certain aspe ...	1999	9895315
isolation of a cotton cap gene: a homologue of adenylyl cyclase-associated protein highly expressed during fiber elongation.	the cdna encoding cap (adenylyl cyclase-associated protein) was isolated from a cotton (gossypium hirsutum) fiber cdna library. the cdna (ghcap) contained an open reading frame that encoded 471 amino acid residues. rna blot analysis showed that the cotton cap gene was expressed mainly in young fibers.	1998	10050322
the involvement of hydrogen peroxide in the differentiation of secondary walls in cotton fibers	h2o2 is a widespread molecule in many biological systems. it is created enzymatically in living cells during various oxidation reactions and by leakage of electrons from the electron transport chains. depending on the concentration h2o2 can induce cell protective responses, programmed cell death, or necrosis. here we provide evidence that h2o2 may function as a developmental signal in the differentiation of secondary walls in cotton (gossypium hirsutum) fibers. three lines of evidence support th ...	1999	10069824
gtpase activity and biochemical characterization of a recombinant cotton fiber annexin.	a cdna encoding annexin was isolated from a cotton (gossypium hirsutum) fiber cdna library. the cdna was expressed in escherichia coli, and the resultant recombinant protein was purified. we then investigated some biochemical properties of the recombinant annexin based on the current understanding of plant annexins. an "add-back experiment" was performed to study the effect of the recombinant annexin on beta-glucan synthase activity, but no effect was found. however, it was found that the recomb ...	1999	10069831
glycerol is a suberin monomer. new experimental evidence for an old hypothesis	the monomer composition of the esterified part of suberin can be determined using gas chromatography-mass spectroscopy technology and is accordingly believed to be well known. however, evidence was presented recently indicating that the suberin of green cotton (gossypium hirsutum cv green lint) fibers contains substantial amounts of esterified glycerol. this observation is confirmed in the present report by a sodium dodecyl sulfate extraction of membrane lipids and by a developmental study, demo ...	1999	10069853
coordinated accumulation of (+)-delta-cadinene synthase mrnas and gossypol in developing seeds of gossypium hirsutum and a new member of the cad1 family from g. arboreum.	a new member of the (+)-delta-cadinene synthase (cad1) family was isolated from a gossypium arboreum cdna library. this cdna encodes a protein that showed 97.3%, 96.9%, and 79.2% sequence identities with the proteins encoded by previously isolated cdnas of cad1-c1, cad1-c14, and cad1-a, respectively. it may be grouped into the cad1-c subfamily as cad1-c2. seeds of a glanded cotton cultivar, g. hirsutum cv. sumian-6, were collected at different intervals during maturation, and the cad1 mrna level ...	1999	10075752
inhibition and acclimation of photosynthesis to heat stress is closely correlated with activation of ribulose-1,5-bisphosphate carboxylase/oxygenase	increasing the leaf temperature of intact cotton (gossypium hirsutum l.) and wheat (triticum aestivum l.) plants caused a progressive decline in the light-saturated co2-exchange rate (cer). cer was more sensitive to increased leaf temperature in wheat than in cotton, and both species demonstrated photosynthetic acclimation when leaf temperature was increased gradually. inhibition of cer was not a consequence of stomatal closure, as indicated by a positive relationship between leaf temperature an ...	1999	10318695
low levels of nucleotide diversity at homoeologous adh loci in allotetraploid cotton (gossypium l.).	levels of genetic diversity within and among populations and species are shaped by both external (population-level) and internal (genomic and genic) evolutionary forces. to address the effect of internal pressures, we estimated nucleotide diversity for a pair of homoeologous adh loci in an allotetraploid species, gossypium hirsutum. these data represent the first such estimates for a pair of homoeologous nuclear loci in plants. estimates of nucleotide diversity for adha in gossypium are lower th ...	1999	10331275