Publications
| Title | Abstract | Year Filter | PMID(sorted ascending) Filter |
|---|
| simian alphaherpesviruses and their relation to the human herpes simplex viruses. | biochemical and immunological properties of structural and non-structural polypeptides of the human simplex viruses (hsv1 and hsv2) and four related herpesviruses of non-human primates [herpesvirus simiae (b virus), h. cercopithicus (sa8), h. saimiri 1 (hvs 1), and h. ateles 1 (hva 1)] were compared. using a radioimmunoassay (ria), the presence of antigenic determinants shared among all six viruses was demonstrated. the relative degree of antigenic cross-reactivity among these viruses was furthe ... | 1989 | 2558632 |
| expression of herpes simplex virus 1 glycoprotein b in human cells and protection of mice against lethal herpes simplex virus 1 infection. | 1989 | 2559611 | |
| anti-herpesvirus activity of carbocyclic oxetanocin g in vitro. | a series of new compounds, carbocyclic oxetanocins, have been synthesized and their anti-herpesvirus activity determined. carbocyclic oxetanocin g (oxt-g) was most active against herpes simplex virus (hsv) and human cytomegalovirus (hcmv) among carbocyclic oxetanocins tested; the median effective concentrations (ec50) for hsv-1, -2, and hcmv were 0.23, 0.04 and 0.40 micrograms/ml, respectively. the ec50 value of carbocyclic oxt-g against hsv-2 was significantly lower than those of acyclovir, gan ... | 1989 | 2559911 |
| [epidemiological evaluations of human immunodeficiency virus, herpes simplex virus type 1 and 2 and cytomegalovirus infections in drug addicts]. | eighty-eight drug addicts from the "ban center" in torre annunziata (naples) and 88 normal subjects pair-matched for age and sex were tested for igg to human immunodeficiency virus (hiv), herpes simplex virus (hsv) type 1 and 2 and cytomegalovirus (cmv). a high prevalence of subjects with antibodies to hsv-1 and cmv (80.7% and 65.9%) were recorded in the control group testifying to the high level of these infections in campania. prevalences were higher in drug addicts, and drug abuse was identif ... | 1989 | 2562004 |
| antibody response to type-common and type-unique epitopes of herpes simplex virus polypeptides. | herpes simplex virus type 1 (hsv1) and type 2 (hsv2) polypeptides with type-common and type-unique epitopes were identified using cross-adsorbed hyperimmune rabbit sera and western blotting techniques. twelve hsv1 and fourteen hsv2 polypeptides with type-specific epitopes were identified. cross-adsorbed human sera reacted to a subset of the type-specific epitopes defined by rabbit sera. human sera with both hsv1- and hsv2-specific antibodies were identified by their reaction to hsv1-type-specifi ... | 1985 | 2580054 |
| vinyl versus latex gloves as barriers to transmission of viruses in the health care setting. | one type of vinyl and seven types of latex gloves without visual defects were tested with respect to their barrier function against high concentrations of three viruses of varying size: herpes simplex virus type 1 (hsv-1, 180 nm), human immunodeficiency virus type 1 (hiv-1, 100 nm), and echovirus type 9 (echo 9, 25 nm). viral suspensions of hsv-1 (10(8) tcd50/ml), hiv-1 (10(5) tcd50/ml), and echovirus type 9 (10(7.5)tcd 50/ml) were placed in an inverted glove finger immersed in media and maintai ... | 1989 | 2703958 |
| reconstitution of cytotoxic t lymphocyte activity following allogeneic bone marrow transplantation in man. | longitudinal studies over an eight-month period have been performed to follow the t killer response restoration after allogeneic bone marrow transplantation (bmt). the capacity of the patient's peripheral blood mononuclear cells (pbm) to develop cytotoxic effector cells directed either against allogeneic cells or against epstein-barr virus (ebv) or herpes-simplex virus-1 (hsv-1)-infected syngeneic cells was tested monthly. the data suggest that in most cases the cytotoxic t lymphocyte (ctl) acti ... | 1987 | 2820090 |
| protection against herpes simplex virus infection in mice by recombinant murine interferon-beta in combination with antibody. | a recombinant murine interferon -beta (rmuifn-beta) was used to suppress the development of skin lesions and death of mice after challenge with herpes simplex virus (hsv) type 1 (hsv-1). depilated female balb/c mice were inoculated intradermally with hsv-1, hayashida strain, and were administered various concentrations of interferon (ifn) intraperitoneally 3 h later. the treatment with ifn was given once a day for 10 successive days. under the conditions in which almost all control mice died aft ... | 1987 | 2821897 |
| [(e)-5-(2-bromovinyl)-2'-desoxyuridine--a new nucleoside analog with selective inhibitory action against herpesviruses. studies in cell culture and animal experiments]. | (e)-5-(2-bromovinyl)-2'-deoxyuridine (1; brvudr) inhibits the replication of herpes simplex virus type 1 (hsv-1) and of varicella-zoster virus (vzv) in vitro at concentrations of 0.01 to 0.23 mumol/l, whereas herpes simplex virus type 2 (hsv-2) is influenced only at 5.5 to 27 mumol/l. in comparison to some classical and newly developed antiherpetics, i. e. 5-iodo-2'-desoxyuridine (2; idoxuridine, idu), 9-beta-d-arabinofuranosyladenine (4; vidarabine ara-a), 9-(2-hydroxyethoxymethyl) guanine (5; ... | 1987 | 2823299 |
| latent herpes simplex virus in human trigeminal ganglia. detection of an immediate early gene "anti-sense" transcript by in situ hybridization. | we used in situ hybridization to study the expression of herpes simplex virus type 1 genes during latent infections of human sensory ganglia. trigeminal ganglia were recovered at autopsy from 24 subjects with no evidence of an active herpetic infection. these ganglia were hybridized to 35s-labeled single-stranded rna probes spanning 72 percent of the herpes simplex genome. in the ganglia of 16 subjects, 0.2 to 4.3 percent of the neuronal cells contained abundant nuclear signals for viral rna. ga ... | 1987 | 2825014 |
| ribonucleotide reductase induced by varicella zoster virus. characterization, and potentiation of acyclovir by its inhibition. | an enzyme that catalyzes the conversion of cdp to 2'-dcdp in the presence of dithiothreitol (dtt) was detected in ammonium sulfate fractionated-extracts of varicella zoster virus (vzv)-infected cells. this ribonucleotide reductase was antigenically distinguishable from the isofunctional eucaryotic enzyme as well as the ribonucleotide reductases induced by herpes simplex virus types 1 and 2 (hsv-1 and hsv-2). the vzv-induced enzyme was purified to the extent that most of the contaminating enzymes ... | 1987 | 2825724 |
| antibodies against synthetic peptides of herpes simplex virus type 1 glycoprotein d and their capability to neutralize viral infectivity in vitro. | peptides corresponding to residues 1-13, 9-21, 18-30, 82-93, 137-150, 181-197, 232-243, 235-243, 267-281, 271-281 and 302-315 of glycoprotein d of herpes simplex virus type 1 (hsv-1) were chemically synthesized. these peptides were coupled to carrier proteins, and the resulting conjugates were used to immunize rabbits. an enzyme-linked immunosorbent assay was used to determine antipeptide antibody titers in serum collected after immunization. all peptides appeared to be immunogenic in rabbits. w ... | 1988 | 2826811 |
| synthesis and biological activities of 4-o-(difluoromethyl)-5-substituted-uracil nucleoside analogues. | various 4-o-difluoromethyl analogues of 5-substituted uridine (urd), 2'-deoxyuridine (durd), and arabinofuranosyluracil (arau) nucleosides were prepared via a cf2-insertion reaction into 4-o-silylated nucleosides and evaluated for activity against herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) and cytotoxicity in human embryonic lung fibroblast (helf) cell cultures. the introduction of the 4-substituent led to a strong reduction of antiviral activity for durd but not for arau analogues. ... | 1988 | 2828623 |
| photodynamic therapy of viral contaminants with potential for blood banking applications. | a photodynamic method has been evaluated as a means of eradicating viral contaminants with the potential for rendering blood safe for transfusion. herpes simplex virus type 1 (hsv-1) was tested under flowing conditions in culture media or in blood supplemented with the virus. hematoporphyrin derivative was used as the sensitizer and was photoactivated with visible light at 630 nm and 5 j/cm2. hsv-1 in suspension both in culture medium as well as in blood was shown to be killed. the human immunod ... | 1988 | 2829396 |
| regulated expression of stably transfected herpes simplex virus thymidine kinase genes in continuous cell lines expressing a temperature-sensitive mutant form of the immediate-early protein icp4. | we stably transfected the herpes simplex virus type 1 thymidine kinase gene into a continuous cell line expressing a temperature-sensitive form of the viral immediate-early protein icp4. in these cells, expression of the thymidine kinase gene was regulated in a temperature-sensitive manner, partially reproducing the controls that operate during a viral infection. | 1988 | 2829431 |
| effects of herpesvirus infections on the chemiluminescence induced by zymosan phagocytosis in mouse peritoneal macrophages. | the chemiluminescence (cl) induced by zymosan phagocytosis was tested in mouse peritoneal macrophages infected with three different types of herpes viruses: herpes simplex type-1 (hsv-1), human cytomegalovirus (hcmv) and murine cytomegalovirus (mcmv). the intensity of cl was tested in various intervals of virus infections. in the first eight hours zymosan induced chemiluminescence decreased in all the three systems. by the 24th hour, the macrophages infected with hcmv had almost completely recov ... | 1987 | 2830762 |
| comparative study on o-linked oligosaccharides of glycoprotein d of herpes simplex virus types 1 and 2. | glycoproteins d1 (gd1) and d2 (gd2) of herpes simplex virus type 1 and type 2, respectively, were purified from infected hep-2 cells labelled with [3h]glucosamine for 14 h followed by a 3 h chase using hd1 monoclonal antibody linked to sepharose. o-linked oligosaccharides were found to be present in both glycoproteins. the identification of n-acetyl [3h]galactosaminitol as the major labelled component in the oligosaccharides generated by mild alkaline borohydride treatment demonstrated that thes ... | 1988 | 2833570 |
| the human mhc-restricted cellular response to herpes simplex virus type 1 is mediated by cd4+, cd8- t cells and is restricted to the dr region of the mhc complex. | the nature of the in vitro human cytotoxic t-cell responder population to hsv type 1 (hsv-1) was studied. in 5-day hsv-1-stimulated cultures that contained mhc-restricted activity, two phenotypically distinct populations of cells were present that were capable of lysing hsv-1-infected b cell lines in a 5-h 51cr-release assay. the first was cd4+, cd8-, cd16- cell typical of class ii-restricted t cells, whereas the other population bore a cd4-, cd8-, cd16+ nk-cell phenotype. elimination of the nk ... | 1988 | 2834445 |
| methyl gallate, methyl-3,4,5-trihydoxybenzoate, is a potent and highly specific inhibitor of herpes simplex virus in vitro. ii. antiviral activity of methyl gallate and its derivatives. | methyl gallate (mg), methyl-3,4,5-trihydroxybenzoate, was highly active against herpes viruses as determined by plaque reduction assay. herpes simplex virus type 2, ms strain, was sensitive to mg at a mean 50% inhibitory concentration (ic50) of 0.224 micrograms/ml in monkey kidney cells. mg was specific for herpes viruses with the relative sensitivity hsv-2 greater than hsv-1 greater than cmv. two rna viruses tested were significantly less sensitive to mg. the structural components of mg which m ... | 1988 | 2840133 |
| synthesis and antiviral activity of certain 4-substituted and 2,4-disubstituted 7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidines. | treatment of the sodium salt of 4-chloro-2-(methylthio)pyrrolo[2,3-d]pyrimidine (2) with (2-acetoxyethoxy)methyl bromide (3) has provided 4-chloro-2-(methylthio)-7[(2-acetoxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (4). ammonolysis of 4 at room temperature gave 4-chloro-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (5). however, ammonolysis of 5 at 130 degrees c furnished 4-amino-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]-pyrrolo[2,3- d]pyrimidine (6), which on desulfurizati ... | 1988 | 2840500 |
| antigenic analysis of a major neutralization site of herpes simplex virus glycoprotein d, using deletion mutants and monoclonal antibody-resistant mutants. | herpes simplex virus glycoprotein d is a component of the virion envelope and appears to be involved in attachment, penetration, and cell fusion. monoclonal antibodies against this protein can be arranged in groups on the basis of a number of biological and biochemical properties. group i antibodies are type common, have high complement-independent neutralization titers, and recognize discontinuous (conformational) epitopes; they are currently being used in several laboratories to study the func ... | 1988 | 2841479 |
| mutational dissection of the hsv-1 immediate-early protein vmw175 involved in transcriptional transactivation and repression. | vmw175 is one of five immediate-early (ie) proteins encoded by herpes simplex virus type-1 (hsv-1). it is required for the transcription of later classes of genes and for the accompanying repression of ie expression. vmw175 has been shown to be a transactivator of transcription and also to autoregulate its own synthesis. we have made a large number of small, in-frame, insertion and deletion mutants of a plasmid-borne copy of the gene encoding vmw175. study of the activity of the resultant mutant ... | 1988 | 2842944 |
| genomic location of bovid herpesvirus type 2 nucleotide sequences homologous to five herpes simplex virus type 1 genes. | the location of nucleotide sequences within the bovid herpesvirus 1 (bhv-2) genome homologous to herpes simplex virus 1 (hsv-1) dna were investigated. bhv-2 dna was digested with restriction endonucleases and blotted to nitrocellulose paper. the blots were then probed with plasmids containing hsv-1 genes for thymidine kinase (tk), the major dna binding protein (icp8), the major capsid protein (vp5) and genes for hsv-1 glycoproteins gb, gd, and gc. except for hsv-1 gc, each hsv-1 gene tested hybr ... | 1988 | 2842979 |
| absence of induction of enhanced reactivation of herpes simplex virus in cells from xeroderma pigmentosum patients without skin cancer. | the time course of appearance of enhanced reactivation (er) and enhanced mutagenesis (em) of herpes simplex virus type 1 were studied in uv-irradiated stationary cultures of xeroderma pigmentosum (xp) fibroblasts. in some of the xp cells em followed similar kinetics of appearance as er. maximal activities occurred when infection was delayed 1 or 2 days after cell treatment. however, in certain xp cells only induction of the em response was observed, whereas er was absent. interestingly, the latt ... | 1988 | 2844398 |
| detection of herpes simplex virus type 1 in herpetic ocular diseases by dna-dna hybridization using a biotinylated dna probe. | a diagnostic hybridization assay for detecting herpes simplex virus type 1 (hsv-1) in ocular specimens was developed using cloned viral dna as a probe. this hybridization assay is based on visualizing a biotinylated probe that is hybridized to the target dna by a streptavidin/alkaline phosphatase system. the time required for performing this assay system is only two days. this assay system could detect a probe which had been hybridized to as little as 1 pg of homologous dna and did not cross-rea ... | 1988 | 2844977 |
| activation of the human immunodeficiency virus long terminal repeat by herpes simplex virus type 1 is associated with induction of a nuclear factor that binds to the nf-kappa b/core enhancer sequence. | it has been previously shown that herpes simplex virus type 1 (hsv-1) infection of hela cells results in augmentation of gene expression directed by the human immunodeficiency virus (hiv) long terminal repeat (ltr). this effect is presumably mediated by protein interactions with the ltr. we have used two different assays of dna-protein interactions to study the hsv-induced activation of the hiv ltr. activation of the hiv ltr is associated with increased protein binding to ltr sequences in a regi ... | 1988 | 2845125 |
| enhanced thrombin generation and platelet binding on herpes simplex virus-infected endothelium. | atherosclerotic lesions have been reported to contain herpes simplex virus 1 (hsv-1) genomic material. this, and other previous evidence, suggests that latent viral infection may be an atherogenic trigger. moreover, active hsv-1 lesions manifest marked fibrin deposition in microvessels. in this report we show that very early infection of human endothelial cells with hsv-1 appears to alter surface conformation as detected by merocyanine 540 staining. concomitantly, the efficiency of prothrombinas ... | 1988 | 2847155 |
| antiviral activities of guanosine analogs in guinea pig embryonic fibroblasts. | previous research has shown that certain antiherpes substances which are activated by thymidine kinase are substantially more active in human fibroblasts than in green monkey kidney cells. the difference has been attributed to the presence of large amounts of intracellular thymidine in the latter cell type. antiviral guanosine analogs but not thymidine analogs show decreased antiviral activity when used in herpes simplex virus type 1-infected guinea pig fibroblasts. we report the intracellular p ... | 1988 | 2847633 |
| interferon inhibits herpes simplex virus-specific translation: a reinvestigation. | reports on the arrest of herpes simplex virus type 1 (hsv-1) replication by interferon (ifn) are inconsistent. by the use of immunofluorescence and immunoblot assays with monoclonal and polyclonal antibodies, effective arrest of viral translation by human ifn-alpha in human fibroblasts was detected for the hsv-1 strains kos and mcintyre. in hela cells which are less sensitive to ifn inhibition and in 444 cells, a hela-fibroblast hybrid cell line, the inhibition was less pronounced. these results ... | 1988 | 2848929 |
| interaction of herpes simplex virus type 2 with a rat glioma cell line. | the interaction between herpes simplex virus type 1 (hsv-1) and type 2 (hsv-2) and two neural cell lines, mouse neuroblastoma (n1e-115) and rat glioma (c6-bu-1), was investigated. n1e-115 cells were permissive to both types of hsv. in c6-bu-1 cells, on the other hand, all the hsv-1 strains tested so far showed persistent infection, and the infectious virus of hsv-2 strains disappeared spontaneously. the hsv-2-infected c6-bu-1 cells were positive for hsv-2-specific dna sequences, virus-specific r ... | 1988 | 2850449 |
| differences in the mechanism of induction of interferon-alpha by herpes simplex virus and herpes simplex virus-infected cells. | the cellular source of ifn alpha after induction with herpes simplex virus type-1 (hsv) and hsv-infected fibroblasts was investigated by using human peripheral blood mononuclear cell (pbmc) populations, purified according to conventional procedures, and which included t- and b-lymphocytes as well as monocytes. it appears that the cells responding to hsv virions are monocytes, whereas the pbmc population induced by hsv-infected cells is represented by b-lymphocytes. furthermore, by using monoclon ... | 1988 | 2850784 |
| antibody to cloned hsv glycoproteins b and d plus adult human leukocytes protect neonatal mice from lethal hsv infection. | antisera produced by hsv infection or following vaccination of guinea pigs with the cloned herpes simplex virus (hsv) glycoproteins gb and gd were compared for in vitro antibody-dependent cellular cytotoxicity (adcc) activity and for in vivo protection. antibody from guinea pigs was able to participate in adcc with human mononuclear cells in vitro, anti-gbgd serum being equivalent to hsv convalescent sera. in vivo, each of the guinea pig sera was able to protect neonatal mice from a fatal hsv-1 ... | 1988 | 2854958 |
| antiherpesvirus activity and mechanism of action of indolo-(2,3-b)quinoxaline and analogs. | the antiherpesvirus activity of 14 derivatives of indoloquinoxaline was tested. the most active was 2,3-dimethyl(dimethylaminoethyl)5h-indolo-(2,3-b)quinoxaline, also called b-220. the antiherpesvirus mechanism of b-220 was sought. the compound inhibited replication of herpes simplex virus type 1, cytomegalovirus, and varicella-zoster virus in tissue culture at concentrations of 1 to 5 microm, depending on the cell type used for assay and the amount of virus. cellular toxicity was seen at a conc ... | 1988 | 2855298 |
| molecular analysis of mutations induced in human cells by n-ethyl-n-nitrosourea. | mutational activation of cellular proto-oncogenes is an important event in the pathogenesis of chemically induced tumors. we have used the ori p-tk shuttle vector, phet, to analyze the types of dna sequence changes induced after treating mammalian cells with the carcinogen n-ethyl-n-nitrosourea (enu). this shuttle vector contains the putative replication origin of the epstein-barr virus (ebv) and is stably maintained as a plasmid in ebv-transformed human lymphoblastoid cells. populations of plas ... | 1988 | 2855602 |
| organization of cytoskeleton elements during herpes simplex virus type 1 infection of human fibroblasts: an immunofluorescence study. | cultured human fibroblasts showed a typical fibrillar organization of microtubules in immunofluorescence, including the vimentin type of intermediate filament as well as actin-containing microfilaments. during infection with herpes simplex virus type 1 (hsv-1), the vimentin organization was maintained whereas actin, myosin and tubulin showed a progressive association with the viral glycoproteins within juxtanuclear structures. these structures could also be revealed with fluorochrome-coupled whe ... | 1986 | 2868069 |
| induction of chromosomal aberrations in human cells by a temperature-sensitive mutant of herpes simplex virus type 2 and its revertants. | the induction of chromosomal aberrations by a temperature-sensitive (ts) mutant of herpes simplex virus type 2 (hsv-2) strain hg52 (ts 13), its revertants 4-8 and 5-8 and by etalon strains hsv-1 17 syn+ and hsv-2 hg52 was studied in human fibroblast and lymphocyte cultures. the effect on chromosomes of the revertants was tested at permissive (31 degrees c) and non-permissive (38 degrees c) temperatures. at 38 degrees c the revertants could not induce dnase activity. the present results contribut ... | 1986 | 2874732 |
| identification and nucleotide sequence of the glycoprotein gb gene of equine herpesvirus 4. | the nucleotide sequence of the glycoprotein gb gene of equine herpesvirus 4 (ehv-4) was determined. the gene was located within a bamhi genomic library by a combination of southern and dot-blot hybridization with probes derived from the herpes simplex virus type 1 (hsv-1) gb dna sequence. the predominant portion of the coding sequences was mapped to a 2.95-kilobase bamhi-ecori subfragment at the left-hand end of bamhi-c. potential tata box, cat box, and mrna start site sequences and the translat ... | 1989 | 2915378 |
| mutational specificities of 1'-acetoxysafrole, n-benzoyloxy-n-methyl-4-aminoazobenzene, and ethyl methanesulfonate in human cells. | we have used an orip-tk shuttle vector to determine the types of mutations induced in human cells by ethyl methanesulfonate (ems), 1'-acetoxysafrole (acos), and n-benzoyloxy-n-methyl-4-aminoazobenzene (bzomab). plasmid dna was treated in vitro with mutagen and electroporated into human lymphoblastoid cells. after replication of the vector in human cells, plasmids were analyzed for mutations in the herpes simplex virus type 1 thymidine kinase gene. ethyl methanesulfonate induced predominantly gc- ... | 1989 | 2927421 |
| membrane markers, target cell specificity, and sensitivity to biological response modifiers distinguish human natural cytotoxic from human natural killer cells. | in the present report, we provide evidence for the distinct existence of a human natural cytotoxic (hnc) cell. this hnc cell can be identified by the monoclonal antibody hnc-1a3 and by the absence of the t10 antigen, other antigenic markers being shared, at least in part, with natural killer (nk) cells, t cells, or monocytes. in addition, the hnc cell preferentially kills the ma-160 target, the herpes simplex virus-1-infected ma-160 cell line, and the two human tumor cell lines hep-2 and hf-2. i ... | 1985 | 2932473 |
| binding site and subclass specificity of the herpes simplex virus type 1-induced fc receptor. | immunoglobulin fc-binding activity was detected by indirect immunofluorescence employing fluorochrome conjugated f(ab')2 antibody fragments on acetone-fixed cell cultures infected with herpes simplex virus type 1 (hsv-1). using this method the fc receptor-like activity seemed to be restricted to the igg class of human immunoglobulins. while igg1, igg2, and igg4 myeloma proteins bind to this putative fc gamma receptor at a concentration of 0.002 mg/ml, igg3 myeloma proteins were without activity ... | 1985 | 2982735 |
| herpes simplex virus type 1 infection of endothelial, epithelial, and fibroblast cells induces a receptor for c3b. | we recently demonstrated that herpes simplex virus type 1 (hsv 1) induces a receptor on human umbilical vein endothelial cells for complement component c3b (c3br). we assigned this receptor function to hsv 1 viral glycoprotein c (gc) based on several observations: tunicamycin, which prevents glycosylation and expression of n-linked glycoproteins on the surface of infected cells, markedly reduced expression of the c3br; monoclonal antibodies to hsv 1 gc blocked detection of the c3br, whereas mono ... | 1985 | 2982950 |
| herpes simplex virus vaccines--where are we? | 1985 | 2985314 | |
| an unusual spliced herpes simplex virus type 1 transcript with sequence homology to epstein-barr virus dna. | high-resolution transcription mapping localized a spliced 2.7-kilobase herpes simplex virus type 1 mrna. the 4-kilobase intron of this transcript encodes a nested set of transcripts on the opposite dna strand. the nucleotide sequence of the dna encoding the left-hand and right-hand exons of the spliced transcript was determined, and the salient features are presented here. of major interest is that both exons contained regions within several hundred bases of the splice donor and acceptor sites w ... | 1985 | 2985801 |
| purification of epstein-barr virus dna polymerase from p3hr-1 cells. | the epstein-barr virus dna polymerase was purified from extracts of p3hr-1 cells treated with n-butyrate for induction of the viral cycle. sequential chromatography on dna cellulose, phosphocellulose, and blue sepharose yielded an enzyme preparation purified more than 1,300-fold. the purified enzyme was distinct from cellular enzymes but resembled the viral dna polymerase in cells infected with herpes simplex virus type 1 or 2. the active enzyme had an apparent molecular weight of 185,000 as est ... | 1985 | 2985818 |
| fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus dna. | a strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (vzv) dna was found to be due to an insertion or deletion of dna sequences at a single site. dna sequence analysis showed that the nucleotide sequence ccgccgatggggagggggcgcggtacc is tandemly duplicated a variable number of times in different vzv strains and is responsible for the observed variation in mobilities of restriction fragments from this region of vzv dna. the variable ... | 1985 | 2985828 |
| vaccinia virus recombinant expressing herpes simplex virus type 1 glycoprotein d prevents latent herpes in mice. | in humans, herpes simplex virus causes a primary infection and then often a latent ganglionic infection that persists for life. because these latent infections can recur periodically, vaccines are needed that can protect against both primary and latent herpes simplex infections. infectious vaccinia virus recombinants that contain the herpes simplex virus type 1 (hsv-1) glycoprotein d gene under control of defined early or late vaccinia virus promoters were constructed. tissue culture cells infec ... | 1985 | 2986288 |
| [genetic transformation of somatic cells. iii. an analysis of the status of the plasmid nucleotide sequences in the extrachromosomal dna of transformant clone cells and the rescue of extrachromosomal molecules of the plasmid dna]. | extrachromosomal dnas from tk+ transformant clones of a238 chinese hamster cells isolated after the treatment with plasmid pst826 containing thymidine kinase gene (tk-gene) of herpes simplex virus (hsv1) and 1.8 kb insert of human satellite iii dna (hsiii) were studied by hybridization technique. in two tk+-clones (2t301 and 2t16) large quantities of rearranged plasmid dna molecules were found. electron microscopy show in clone 2t301 the presence of circular dnas with average length being 4.64 + ... | 1985 | 2990075 |
| cell-specific selection of mutants of a herpes simplex virus recombinant carrying deletions. | herpes simplex virus 1 (hsv-1) recombinant r316 was constructed so as to convert the thymidine kinase (tk), a beta gene, into an alpha-regulated gene by insertion of the bamhi n fragment in the proper transcriptional orientation into the bglii cleavage site of the tk gene (l. e. post, s. mackem, and b. roizman, cell 24, 555-565 (1981).) the bamhi n fragment contains the promoter and regulatory domains of the alpha 4 gene in addition to an origin of viral dna synthesis and the complete domain of ... | 1985 | 2990098 |
| herpes simplex virus 1 mutant deleted in the alpha 22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice. | r325-beta tk+, a herpes simplex virus 1 mutant carrying a 500-base-pair deletion in the alpha 22 gene and the wild-type (beta) thymidine kinase (tk) gene, was previously shown to grow efficiently in hep-2 and vero cell lines. we report that in rodent cell lines exemplified by the rat-1 line, plating efficiency was reduced and growth was multiplicity dependent. a similar multiplicity dependence for growth and lack of virus spread at low multiplicity was seen in resting, confluent human embryonic ... | 1985 | 2991560 |
| inhibition of herpes simplex virus replication in vitro by human cytotoxic t cell clones and natural killer cell clones. | the abilities of human cytotoxic t cell (ctl) clones and natural killer (nk) cell clones to inhibit the replication of herpes simplex virus (hsv) in vitro were shown. the specificities of clones inhibiting hsv replication were the same as those of cytotoxicity in hsv type specificity and hla restriction, i.e. hsv type 1 (hsv-1) and hsv type 2 (hsv-2) common ctl clones inhibited the replication of both hsv-1 and hsv-2 in autologous cells, but not in allogeneic cells. hsv-1-specific ctl clones inh ... | 1985 | 2995557 |
| effect of herpes simplex virus type 1 on cellular pools of oligosaccharide-lipid. | incorporation of [3h]mannose into cellular pools of mannosylphosphoryl dolichol (man-p-dol), oligosaccharide-lipid, and glycoprotein was measured and compared in herpes simplex virus type 1 (hsv-1)-infected cells and -uninfected cells. while mannose incorporation into the monosaccharide-dolichol fraction was similar in infected or uninfected vero cells, incorporation into the oligosaccharide-lipid fraction was markedly reduced in hsv-1-infected cells (64% of control levels). in contrast, mannose ... | 1985 | 2998058 |
| inhibition of herpes simplex virus type 1-induced interferon synthesis by monoclonal antibodies against viral glycoprotein d and by lysosomotropic drugs. | components of herpes simplex virus remained bound to the diploid cell membrane after nucleocapsid penetration into the cytosol. these components enabled the infected cells to induce interferon-alpha (ifn-alpha) in peripheral blood mononuclear cells even when the infected cells were fixed by glutaraldehyde. monoclonal antibodies directed against the major viral glycoprotein d could neutralize their ifn-alpha-inducing capacity. thus, the process of ifn induction does not require uptake and penetra ... | 1985 | 2999320 |
| recovery of herpesviruses from cerebrospinal fluid of immunodeficient homosexual men. | over a one-year period the cerebrospinal fluid (csf) obtained from a series of homosexual men immunocompromised with either hodgkin's disease or acquired immune deficiency syndrome (aids) was cultured to assess the frequency with which infectious viruses could be recovered. of 58 patients examined, 4 (6.9%) had csf cultures that showed a cytopathology consistent with a virus infection. all isolates proved to be herpesviruses. cytomegalovirus (cmv) and varicella-zoster virus were isolated from cs ... | 1985 | 3000285 |
| herpes simplex virus expressing epstein-barr virus nuclear antigen 1. | dna fragments containing an open reading frame known to encode most or all of the ebna1 protein of epstein-barr virus (ebv) were fused in the proper transcriptional orientation to the promoter regulatory domain, capping site, and a portion of the 5' transcribed noncoding sequences of the hsv-1 alpha 4 gene of herpes simplex virus 1 (hsv-1). in these constructs 20, 130, or 385 bp of ebv dna and 28 bp of hsv-1 dna separated the alpha 4 cap site from a putative initiator codon of the ebna1 gene. th ... | 1986 | 3002038 |
| synergistic interaction between interferon-alpha and acyclovir in the treatment of herpes simplex virus type 1 infection in mice. | hairless mice were infected intracutaneously with hsv-1 and treated with rhuifn-alpha a/d, a recombinant dna-derived hybrid human interferon-alpha that is active on mouse cells in vitro and in vivo. when given alone (1 or 2 x 10(5) units/dose) at times soon after infection, interferon showed some efficacy, reducing disease severity by 20-30% compared to control. oral acyclovir was also effective in reducing disease severity in a dose-dependent manner, even when treatment was begun 72 h post-infe ... | 1985 | 3002258 |
| stress, loneliness, and changes in herpesvirus latency. | this study used a prospective design to examine the influence of examination stress and loneliness on herpesvirus latency as measured by changes in antibody levels to three herpesviruses, epstein-barr virus (ebv), herpes simplex type i (hsv-1), and cytomegalovirus (cmv). three blood samples were obtained from 49 first-year medical students, with the first sample drawn 1 month before final examinations, the second on the first day of final examinations, and the third during the first week after t ... | 1985 | 3003360 |
| effects of mercury (ii) compounds on the activity of dutpases from various sources. | the deoxyuridine triphosphate nucleotidohydrolases (dutpases, ec 3.6.1.23) from escherichia coli k-12-,acholeplasma laidlawii b-pg9-, human kb cell-, and the herpes simplex virus (hsv) type 1- and 2-induced dutpases were purified and used to determine the effect of various mercury (ii) compounds on their activities. mercuric acetate, 5-mercuri-dutp (hgdutp), and 5-mercuri-dctp (hgdctp) acted as irreversible active site-directed inhibitors of the dutpases purified from eukaryotic organisms but no ... | 1986 | 3005836 |
| herpesvirus infection in man. | herpesviruses which affect man are herpes simplex virus type 1 and type 2, varicella-zoster virus, cytomegalovirus and epstein-barr virus. the review deals with the more common clinical manifestations of human herpesvirus infections, which occur ubiquitously in all populations throughout the world. primary infections most commonly occur in childhood. it is a characteristic feature of herpesvirus that they generally remain in a latent form after clearance of the primary infection. the overall maj ... | 1985 | 3006233 |
| evolutionary comparisons of the s segments in the genomes of herpes simplex virus type 1 and varicella-zoster virus. | the genomes of herpes simplex virus type 1 (hsv-1) and varicella-zoster virus (vzv) consist of two covalently joined segments, l and s. each segment comprises an unique sequence flanked by inverted repeats. we have reported previously the dna sequences of the s segments in these two genomes, and have identified protein-coding regions therein. in hsv-1, the unique sequence of s contains ten entire genes plus the major parts of two more, and each inverted repeat contains one entire gene; in vzv, t ... | 1986 | 3007657 |
| establishment of a rat cell line inducible for the expression of human cytomegalovirus immediate-early gene products by protein synthesis inhibition. | upon transfection of rat-2-tk- cells with plasmid pes, containing the cloned 7.0-kilobase (kb) ecori-sali fragment (0.063 to 0.089 map units) of the human cytomegalovirus genome, major immediate-early antigen expression was obtained in 1 to 2% of the nuclei of the transfected cells, as determined by immunofluorescence with the e3 monoclonal antibody. cotransfection of pes with the cloned herpes simplex virus type 1 thymidine kinase gene resulted in the establishment of a hypoxanthine-aminopterin ... | 1986 | 3009892 |
| studies on herpes simplex virus type 1 glycoproteins using monoclonal antibodies. | monoclonal antibodies against herpes simplex virus type 1 glycoproteins were isolated and utilized to study the synthesis and processing of glycoproteins b, c, and d (gb, gc, gd, respectively). monoclonal antibodies against both gb and gd had higher virus-neutralizing activity when compared to that of gc. differences among these glycoproteins were observed in their time of appearance in the virus-infected cells. the presence of gd was detected at a very early stage of infection when compared to ... | 1986 | 3010559 |
| herpes simplex virus immediate early infected-cell polypeptide 4 binds to dna and promotes transcription. | in herpes simplex virus (hsv)-infected cells, there is a sequential expression of viral genes. in vivo experiments have implicated the mr 175,000 immediate early protein icp4 (infected-cell polypeptide 4) in the regulation of viral rna synthesis, but the mechanism whereby icp4 regulates transcription of viral genes is at present unknown. in this report we describe experiments with an in vitro transcription system and a purified preparation of icp4 (estimated 5% of total protein). using dna from ... | 1986 | 3012542 |
| evaluation of five cell types for the isolation of herpes simplex virus. | five cells were evaluated in a comparative analysis for sensitivity, specificity, and rapidity in detecting the presence of herpes simplex virus hsv-1 and hsv-2. included in this study were human embryonic kidney (hek), rabbit kidney (rk), mrc-5, mink lung (ml), and microtus agrestis (umma). a total of 274 specimens from genital, throat, skin, or other sources that were submitted for hsv isolation were used in the study. the sensitivity of the different cells was assessed by the total number of ... | 1986 | 3013496 |
| detection of hsv1 dna by in situ hybridisation in human brain after immunosuppression. | human brain cells were examined for the presence of herpes simplex virus type 1 (hsv1) dna sequences by in situ hybridisation. viral genome was detected in immunosuppressed patients with virological evidence of past hsv infection but not in immunosuppressed patients with no such evidence. in patients who had not been immunosuppressed, no hsv dna sequences were detectable. | 1986 | 3016195 |
| the properties and sequence of glycoprotein h of herpes simplex virus type 1. | the map position of the coding sequence of glycoprotein h of herpes simplex virus type 1 was determined by marker transfer studies in which dna fragments cloned from a virus resistant to neutralisation by an anti-gh monoclonal antibody were used to transfer antibody resistance to wild type virus dna following cotransfection. the gh coding sequence was mapped to the bglii "m" fragment of hsv-1 dna (map coordinates 0.27-0.312), confirming the map position previously determined by intertypic recomb ... | 1986 | 3016991 |
| glycoprotein c of herpes simplex virus 1 is an inhibitor of the complement cascade. | mammalian cells in culture express membrane receptors for c3b when infected with hsv-1. c3b binding is mediated by glycoprotein c (gc), a virus-specified membrane glycoprotein. in view of the inhibitory functions of other c3b-binding proteins, we studied the capacity of gc to modulate complement activation. glycoprotein c was purified from hsv-1-infected cells by immunoaffinity chromatography. glycoprotein c, but not a control viral glycoprotein, demonstrated dose-dependent acceleration of decay ... | 1986 | 3018078 |
| antiherpetic effects of a human alpha interferon analog, ifn-alpha con1, in hamsters. | the efficacy of a novel consensus form of human alpha interferon designated ifn-alpha con1 was evaluated against herpesvirus infections in vitro and in vivo. at comparable antiviral concentrations, natural lymphoblastoid ifn, ifn-alpha con1, the molecular subtype ifn-alpha, and the hybrid ifn-alpha ad(bgl) obtained by recombinant dna methods conferred similar protection against herpes simplex virus type 1 and type 2 (hsv-2) infections of human cells in vitro. whereas 7 x 10(5) u of ifn-alpha ad( ... | 1986 | 3019238 |
| identification of an epstein-barr virus-coded thymidine kinase. | we have demonstrated the presence of an epstein-barr virus (ebv)-coded thymidine kinase (tk) by producing biochemically transformed, tk-positive mammalian cell lines using either microinjection of whole ebv virions or calcium phosphate-mediated transfection of the sali-b restriction endonuclease fragment of ebv dna. analysis of these cell lines showed that: (i) ebv dna was present in the cell lines, (ii) sequences from the sali-b restriction endonuclease fragment of ebv were expressed, (iii) a t ... | 1986 | 3019675 |
| characterization and immunogenicity of hsv-1 antigens obtained following zwitterionic detergent treatment. | a preparation was obtained from herpesvirus hominis type 1 (hsv-1) infected cells using the zwitterionic detergent, empigen bb. the preparation was partially purified by ultracentrifugation over a cushion of 20% sucrose. serological characterization by elisa and immuno double diffusion, using both polyclonal and monoclonal antibodies shows this preparation to contain hsv glycoproteins, including gc, gd and ge. immunization of balb/c mice elicited serum antibody responses against both hsv-1 and h ... | 1986 | 3020821 |
| elisa for detection of igg and igm antibodies to hsv-1 and hsv-2 in human sera. | a rapid, enzyme-linked immunoassay (elisa) was applied to identify and measure specific igg and igm antibodies to herpes simplex viruses types 1 and 2 (hsv-1 and hsv-2). detergent solubilized infected cells and mock-infected cells were used as antigens in the assay. identification of type-specific antibodies was achieved by a competition assay in which clinical sera mixed with hsv-1 or hsv-2 antigens were assayed for reactivity to identical antigens coating wells of polystyrene microtiter plates ... | 1986 | 3021796 |
| selection and characterization of an interferon-responsive clonal cell line of hela cells. | hela cells generally do not respond well to interferon (ifn). we have used is-1, an ifn-sensitive mutant of mengovirus, to select a clone of ifn-responsive hela cells (f-h12). at moderate levels of human alpha/beta ifn, is-1 yields were fivefold lower in these cells than in similarly protected control cells. in contrast, wild-type mengovirus, vesicular stomatitis virus and a wild-type and thymidine kinase-negative strains of herpes simplex virus type 1 grew equally well in both cell lines. by a ... | 1986 | 3023528 |
| genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus dna polymerase gene. | the human cytomegalovirus (hcmv)-induced dna polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. to identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (hsv-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced dna polymerases to the hcmv dna polymerase. a cosmid and plasmid library of the entire hcmv genome was screened with the bamhi q fragment ... | 1987 | 3023689 |
| comparison of upstream sequence requirements for positive and negative regulation of a herpes simplex virus immediate-early gene by three virus-encoded trans-acting factors. | using a short-term cotransfection system with recombinant chloramphenicol acetyltransferase (cat) target genes and intact genes for regulatory proteins, we previously demonstrated that expression from the promoter-regulatory region of the gene for the immediate-early 175,000-molecular-weight (ie175k) protein of herpes simplex virus type 1 was subject to trans-acting effects by three different virus-encoded components. in the present work we have attempted to delineate the upstream cis-acting req ... | 1987 | 3023697 |
| mode of action, toxicity, pharmacokinetics, and efficacy of some new antiherpesvirus guanosine analogs related to buciclovir. | 9-[4-hydroxy-3-(hydroxymethyl)butyl]guanine (3hm-hbg), (rs)-9-[4-hydroxy-2-(hydroxymethyl)butyl]guanine ([+/-]2hm-hbg), and cis-9-(4-hydroxy-2-butenyl)guanine (2en-hbg), new acyclic guanosine analogs structurally related to buciclovir (bcv [(r)-9-(3,4-dihydroxybutyl)guanine]), were evaluated in parallel with buciclovir as anti-herpes simplex virus (hsv) agents. in cell cultures, replication of different strains of hsv type 1 (hsv-1) and hsv-2 was inhibited at nontoxic drug concentrations. the co ... | 1986 | 3024562 |
| estimation of the b lymphocyte precursor frequencies to herpes simplex type 1 glycoproteins by a limiting dilution assay. | the precursor frequency of b lymphocytes from balb/c mice producing hsv-1 glycoprotein b (gb), glycoprotein c (gc), and glycoprotein d (gd) antibody was determined by limiting dilution analysis under conditions to detect antibody from the clonal progeny of a single b cell precursor. in spleens of naive mice the average gc frequency was 1/48,917 +/- 5,550, while gd was 1/73,330 +/- 15,898, and gb frequency was in excess of 1/100,000. immunization with live hsv-1 (kos) increased the b cell frequen ... | 1986 | 3025354 |
| minimal transcriptional enhancer of simian virus 40 is a 74-base-pair sequence that has interacting domains. | we have assayed the ability of segments of the simian virus 40 (sv40) 72-base-pair (bp) repeat enhancer region to activate gene expression under the control of the sv40 early promoter and to compete for trans-acting enhancer-binding factors of limited availability in vivo in monkey cv-1 or human hela cells. the bacterial chloramphenicol acetyltransferase and the herpes simplex virus type 1 thymidine kinase genes were used as reporters in these assays. a 94-bp sequence located between sv40 nucleo ... | 1986 | 3025607 |
| suppressive effect of monocytes in vitro in patients with carcinoma of the uterine cervix. | the adherent cell fraction (adc) of human peripheral blood mononuclear cells (pbm) contains two cell types of opposing function in vitro. dendritic cells (dc) act as antigen-presenting cells (apc) in vitro, while monocytes (mo) have a suppressive effect on antigen activation of t cells. in this report we show that patients with cervical carcinoma have a significantly increased number of suppressive mo compared with healthy controls. the t cell response to herpes simplex virus (hsv-1) and ppd was ... | 1986 | 3026137 |
| the role of epithelial cell differentiation in the expression of herpes simplex virus type 1 in normal human oral mucosa in culture. | we have examined by immunofluorescent antibody staining technique the expression of herpes simplex virus type 1 (hsv-1) in organ cultures of the normal human oral mucosa. the expression of hsv-1 antigen was found selectively in the epithelial cell layers in relatively undifferentiated states such as basal layer and lower prickle cell layer in addition to the basement membrane. when the epithelial cells dissociated from the oral mucosa were infected with hsv-1 and association of the hsv-1 express ... | 1987 | 3026290 |
| restricted replication of herpes simplex virus type 1 in murine embryonal carcinoma cells. | herpes simplex virus type 1 (hsv-1) has a broad host range but the kos strain of hsv-1 did not replicate efficiently in murine embryonal carcinoma (ec) cells. the yield of infectious hsv-1 from ec cells was 100- to 1000-fold lower than that from fibroblast cell lines of mouse, monkey or human origin. the thymidine kinase (tk) gene of hsv-1 is expressed early during the infectious cycle. the levels of tk mrna and of tk activity in infected ec cells were only two- to threefold lower than levels fr ... | 1987 | 3029290 |
| herpes simplex virus type 1 latency in rabbit corneal cells in vitro: reactivation and recombination following intratypic superinfection of long term cultures. | herpes simplex virus type 1 (hsv-1) has been isolated from explanted human corneas after cultivation in vitro. to determine whether hsv-1 is persistent or latent in corneal cells, a system to study hsv-1 infection of rabbit corneal cells in vitro was developed. by elevation of the incubation temperature to 42 degrees c before and during hsv-1 infection it was shown that both keratocytes and epithelial cells support a nonproductive rather than a productive infection. on subsequent temperature red ... | 1987 | 3029308 |
| herpes simplex virus, cytomegalovirus and epstein-barr virus antibody titres in sera from schizophrenic patients. | serum antibody titres to herpes-simplex (hsv-1, 2), cytomegalovirus (cmv), and epstein-barr virus capsid antigen (ebv-vca) were determined in 38 unrelated chronic schizophrenic patients, 11 nuclear families with at least 2 schizophrenic members, and 2 control groups. the distributions of antibody titres to herpes simplex and cytomegalovirus were similar among all groups. patients had higher anti-ebv-vca titres than non-hospitalized controls; however, hospital staff members in contact with the pa ... | 1986 | 3029788 |
| dna sequences which regulate the expression of the pseudorabies virus major immediate early gene. | it has been shown previously that the transcription of herpes simplex virus (hsv) immediate early (ie) genes is transactivated by a component of the virus particle. the trans-inducing factor (tif) is known to be polypeptide vmw65. infection with pseudorabies virus (prv), a related herpesvirus, does not increase expression from hsv ie regulatory sequences (w. batterson and b. roizman, 1983, j. virol. 46, 371-377). to examine the control of the prv ie gene and possible sequence specificity of a ti ... | 1987 | 3029974 |
| hsv-1 thymidine kinase negative vaccine: pathogenicity, protection, and perils. | primary inoculation of mice and rabbits with an avirulent hsv-1 thymidine kinase negative (tk-) mutant reduced keratitis, mortality, and superinfection of the trigeminal ganglion (tg) as measured by cocultivation and iontophoresis-induced ocular shedding following ocular challenge with hsv-1 mckrae and w strains. however species differences were demonstrated; with complete protection in rabbits, and incomplete protection in mice. in mice, budr/autoradiography and restriction enzyme analysis iden ... | 1987 | 3030639 |
| the mechanisms of antiviral immunity induced by a vaccinia virus recombinant expressing herpes simplex virus type 1 glycoprotein d: clearance of local infection. | we have shown that immunization of mice with a vaccinia virus recombinant expressing glycoprotein d of herpes simplex virus (hsv)-1 will induce a variety of l3t4+ t cell responses. these included a hsv-specific delayed-type hypersensitivity response, t cell help for the induction of antiviral antibodies, and the ability to eliminate a challenge dose of hsv from the pinna. this protection against a subcutaneous virus challenge was not mediated by the delayed-type hypersensitivity response because ... | 1987 | 3033075 |
| anti-glycoprotein d antibodies that permit adsorption but block infection by herpes simplex virus 1 prevent virion-cell fusion at the cell surface. | certain monoclonal antibodies specific for glycoprotein d of herpes simplex virus have potent neutralizing activity but fail to block attachment of virus to cells. here we have investigated the fate of neutralized and infectious virus after attachment to primate cells. infectious virions fused with the cell surface such that naked nucleocapsids were detectable in the cytoplasm near or just under the plasma membrane. neutralized virions did not fuse with the cell. they remained attached to the ce ... | 1987 | 3037552 |
| sequence analyses of herpesviral enzymes suggest an ancient origin for human sexual behavior. | comparison of the amino acid sequences of the deoxythymidine kinases of herpes simplex (hsv) and of marmoset herpes viruses (mhv) suggests a divergence time of 8 to 10 million years ago for hsv-1 and -2. like mhv, hsv-1 and -2 cause local infections in their natural hosts, and direct contact between two individuals during the brief period of infectivity is needed for transmission. because b virus, a nearer relative of hsv, depends on both oral and genital routes of transmission, we postulate tha ... | 1988 | 3128793 |
| large macromolecules can be introduced into cultured mammalian cells using erythrocyte membrane vesicles. | plasmid 6.4 kbp dna, 14 kbp dna, lambda phage particles, all of which contained herpes simplex virus type 1 (hsv-1) thymidine kinase (tk) gene, or igm molecules, were mixed with erythrocyte membranes and treated with neutral detergent. the transparent mixture was diluted with phosphate-buffered saline (pbs), followed by centrifugation to collect membrane vesicles containing the large macromolecules. 10-15% of 6.4 kbp, 3% of 14 kbp, 4-7% of the lambda phage particles and 14.5% of igm were trapped ... | 1985 | 3161750 |
| expression of herpes simplex virus glycoprotein d on antigen presenting cells infected with vaccinia recombinants and protective immunity. | we studied the effect of the temporal regulation of herpes simplex virus (hsv) type 1 glycoprotein d (gd-1) expression in ia+ epidermal cells (ec) and macrophages on virus specific immunity and protection from hsv-2 challenge. gd-1 was expressed on the surface of cells infected with a vaccinia recombinant containing gd-1 under the control of an early vaccinia virus promoter (vp176). it was not expressed in cells infected with a recombinant (vp254) in which gd-1 is controlled by a late vaccinia v ... | 1988 | 3263886 |
| adenovirus replication as an in vitro probe for drug sensitivity in human tumors. | the feasibility of using adenovirus 5 as an in vitro probe for chemosensitivity in short-term cultures of human tumors was evaluated using human melanoma cell lines and primary cultures of melanoma biopsies. a convenient immunoperoxidase method was developed for quantitating viral replication 2 days after infection. two different approaches were explored: the host cell reactivation assay (hcr) using drug-treated virus; and the viral capacity assay using drug-treated cells. the hcr assay detected ... | 1986 | 3525182 |
| a novel selective broad-spectrum anti-dna virus agent. | a new compound has been found, (s)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine ((s)-hpmpa), that has potent and selective activity against a broad spectrum of dna viruses, including herpes simplex virus (types 1 and 2); varicella zoster virus; thymidine kinase-deficient (tk-) mutants of herpes simplex and varicella zoster virus; human cytomegalovirus; phocid, simian, suid, bovid and equid herpesviruses; african swine fever virus; vaccinia virus; and human adenoviruses. it is also active again ... | 1986 | 3762696 |
| improvement of the bioavailability of the anti-herpes virus agent bvdu by use of 5'-o-alkoxycarbonyl derivatives with increased metabolic stability. | (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) was found by hplc analysis to be rapidly metabolized in mice and in liver homogenates from mouse and man to the antivirally inactive (e)-5-(2-bromovinyl) uracil (bvu) but was comparatively stable in blood from both species. of a series of 5'-o-alkoxycarbonyl derivatives of bvdu, the 5'-o-tert.-butoxycarbonyl derivative (brl 37000) was the most stable in mouse and human blood and liver homogenates, neither its ester bond nor its n-glycosidic linkage bei ... | 1986 | 3793660 |
| synergistic activity of combinations of recombinant human alpha interferon and acyclovir, administered concomitantly and in sequence, against a lethal herpes simplex virus type 1 infection in mice. | the nucleoside analog acyclovir [9-(2-hydroxyethoxymethyl)guanine] and the hybrid recombinant human alpha interferon (rhuifn-alpha a/d) were evaluated in weanling mice for their efficacy alone and in combination against a lethal systemic infection with herpes simplex virus type 1. simultaneous parenteral treatment with combinations of both agents at various doses resulted in a higher percentage of survival than when either agent was administered alone, with a synergistic interaction demonstrated ... | 1985 | 4037769 |
| proteins specified by herpes simplex virus. 8. characterization and composition of multiple capsid forms of subtypes 1 and 2. | two classes of herpesvirus capsids, designated a and b, were isolated from the nuclei of human cells infected with herpes simplex virus (hsv). a and b capsids share in common four structural proteins, i.e., no. 5, 19, 23, and 24. b capsids contain 7.7 to 9.7 times more deoxyribonucleic acid than a capsids; moreover, they contain proteins no. 21 and 22a in addition. all of the proteins contained in the capsid except no. 22a are present in the enveloped nucleocapsids (virions) in approximately the ... | 1972 | 4344252 |
| more rapid isolation of herpes simplex virus in a continuous line of mink lung cells than in vero or human fibroblast cells. | herpes simplex virus (hsv) was isolated from clinical specimens more rapidly in mink lung (ml) cells, a continuous cell line available from a commercial supplier, than in vero cells or human fibroblast (hf) cells. stock strains of hsv type 1 (hsv-1) and hsv-2 titered higher in ml cells than in vero or hf cells. ml cells were equivalent to rabbit kidney (rk) cells in the isolation of hsv in clinical specimens, but titers of stock hsv strains were lower. ml cells could be employed to type strains ... | 1984 | 6091988 |
| the antiviral spectrum of (e)-5-(2-bromovinyl)-2'-deoxyuridine. | the antiviral activity spectrum of (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) is not restricted to herpes simplex virus type 1 (hsv-1) and varicella-zoster virus (vzv) but also encompasses several other herpesviruses such as suid herpesvirus type 1 (shv-1), bovid herpesvirus type 1 (bhv-1), simian varicella virus (svv), herpesvirus saimiri, herpesvirus platyrrhinae, and the baculovirus trichoplusia ni multiple nuclear polyhedrosis virus. other herpesviruses such as herpes simplex virus type 2, ... | 1984 | 6092320 |
| bk virus-plasmid expression vector that persists episomally in human cells and shuttles into escherichia coli. | we describe a novel expression vector, pbk tk-1, that persists episomally in human cells that can be shuttled into bacteria. this vector includes sequences from bk virus (bkv), the thymidine kinase (tk) gene of herpes simplex virus type 1, and plasmid pml-1. tk+-transformed hela and 143 b cells contained predominantly full-length episomes. there were typically 20 to 40 (hela) and 75 to 120 143 b vector copies per cell, although some 143 b transformants contained hundreds. low-molecular-weight dn ... | 1984 | 6092918 |
| isolation of human dnas homologous to the bamhi-z fragment of herpes simplex virus type 1 dna. | human dna hybridizes with the bamhi-z fragment (map coordinates 0.936 to 0.949) of herpes simplex virus type 1 (hsv-1) dna. to characterize the bamhi-z homologue of human dna, we isolated six independent hybrid phages with a sequence homologous to the bamhi-z fragment from a human genomic dna library. three of the six had a common 1.2-kb bamhi-ecori fragment homologous to the bamhi-z, and this fragment existed as 10-60 copies per human haploid genome. a 0.29-kb mboii segment of the bamhi-z fragm ... | 1984 | 6098540 |
| inappropriate peripheral blood lymphocyte responses to herpes viruses in patients with behçet's syndrome. | specific antibody production and the proliferative response of peripheral blood lymphocytes (pbls) to a variety of viruses, including herpes simplex virus-type-1 (hsv-1) and varicella zoster (vz), were studied in 7 patients with behçet's syndrome. none of the patients produced an antibody response against hsv-1 or vz. furthermore, none of the patients showed a proliferative response to vz, and three of them also failed to mount a response to hsv-1. these results suggest that the pbls of patients ... | 1984 | 6098552 |
| novel codon utilization within the vaccinia virus thymidine kinase gene. | the nucleotide and predicted amino acid sequences of the thymidine kinase genes encoded by vaccinia virus and herpes simplex virus (type 1) were analyzed, and there was no evidence of any significant homology. the manner in which the triplet code was used by each virus was also examined. the frequencies of codon utilization by the herpes virus gene were very similar to those used by most human genes, whereas the vaccinia virus gene was quite distinct, suggesting novel evolutionary and regulatory ... | 1984 | 6099662 |
| induction of uracil-dna glycosylase and dutp nucleotidohydrolase activity in herpes simplex virus-infected human cells. | hela bu cells infected with either the type 1 or the type 2 forms of herpes simplex virus show an increase in the activities of uracil-dna glycosylase and dutp nucleotidohydrolase. under optimal conditions, uracil-dna glycosylase activity increases approximately 40-fold in hsv type 2-infected cells. in herpes simplex virus (hsv) type 1-infected cells, uracil-dna glycosylase activity increases only 6-fold. at a kcl concentration of 100 mm, uracil-dna glycosylase derived from hsv type 2-infected c ... | 1981 | 6115860 |