Publications
Title | Abstract | Year Filter | PMID(sorted ascending) Filter |
---|
molecular cloning and chromosomal localization of a human peripheral-type benzodiazepine receptor. | the sequencing of endopeptidase-generated peptides from the peripheral binding site (pbs) for benzodiazepines, purified from a chinese hamster ovary (cho) cell line, produced internal sequence information, and confirmed and extended the nh2-terminal pbs sequence that we previously reported. since the sequences were highly similar to the corresponding rat pbs sequences, we investigated whether they were also conserved in human pbs. scatchard analysis of [3h]pk11195 (a derivative of isoquinoline c ... | 1991 | 1847678 |
binding of the b cell activation antigen b7 to cd28 costimulates t cell proliferation and interleukin 2 mrna accumulation. | a successful immune response requires intercellular contact between t and b lymphocytes. we recently showed that cd28, a t cell surface protein that regulates an activation pathway, could mediate intercellular adhesion with activated b cells by interaction with the b7 antigen. here we show that cd28 is the primary receptor for b7 on activated peripheral blood t cells, that cd28 binds to b7 in the absence of other accessory molecules, and that interaction between cd28 and b7 is costimulatory for ... | 1991 | 1847722 |
effect of protease inhibitors on dna amplification in sv40-transformed chinese hamster embryo cells. | we have examined the effect of protease inhibitors on radiation-induced dna amplification in vitro using an sv40-transformed chinese hamster embryo cell line. dna from cells irradiated with x-rays (10 gy) or ultraviolet radiation (8 j/m2) resulted in an 8-fold or greater amplification of sv40 sequences compared with unirradiated cells. addition of antipain or the soybean-derived bowman-birk protease inhibitor (bbi) to the culture medium, either 75 min after x-irradiation or within 15 min after u ... | 2007 | 1847840 |
effects of site-directed mutagenesis at residues cysteine-31 and cysteine-184 on lecithin-cholesterol acyltransferase activity. | native lecithin-cholesterol acyltransferase (lcat; phosphatidylcholine-sterol acyltransferase; phosphatidylcholine:sterol o-acyltransferase, ec 2.3.1.43) protein, and lcat in which either or both of the enzyme free cysteines had been replaced with glycine residues by site-directed mutagenesis, has been expressed in cultured chinese hamster ovary cells stably transfected with the human lcat gene. the mass of lcat secreted, determined by immunoassay, did not differ in the native and mutant species ... | 1991 | 1848009 |
changes in insulin-receptor tyrosine, serine and threonine phosphorylation as a result of substitution of tyrosine-1162 with phenylalanine. | previous studies, by ourselves and others, have shown that tyrosine residues 1158, 1162 and 1163 are very rapidly autophosphorylated on the human insulin receptor after insulin binding and that this is followed by the autophosphorylation of tyrosine residues 1328 and 1334. the autophosphorylation of these tyrosine residues, and their role in transmembrane signalling, were examined by using chinese-hamster ovary cells transfected with either normal intact insulin receptors or receptors in which t ... | 1991 | 1848075 |
coupling of a mutated form of the human beta 2-adrenergic receptor to gi and gs. requirement for multiple cytoplasmic domains in the coupling process. | we constructed five genes encoding mutant human beta 2-adrenergic receptor sequence (beta 2ar) which contained 12-22 amino acid substitutions with corresponding sequence from the human alpha 2aar in order to assess the receptor domains involved in gs versus gi recognition and coupling. mutant beta 2ar with substitutions in the n (s1)- and c-terminal (s2) portions of the third intracellular loop, the proximal cytoplasmic tail (s3), and two combinations thereof (s2,3 and s1,2,3), were stably expre ... | 1991 | 1848226 |
position and orientation-dependent effects of a eukaryotic z-triplex dna motif on episomal dna replication in cos-7 cells. | a cluster of simple repeated sequences composed of 5'-(gc)5(ac)18(ag)21(g)9(caga)4gagggagagaggcagagaggg(ag)27-3 ' located near the origin of replication associated with the chinese hamster dhfr gene has been shown to adopt multiple z-form and triplex dna structures under various experimental conditions (bianchi, a., wells, r. d., heintz, n. h., and caddle, m. s. (1990) j. biol. chem. 265, 21789-21796). thus, we refer to the cluster of alternating repeats as a z-triplex dna motif. primer extensio ... | 1991 | 1848241 |
topoisomerase ii activity in a dna double-strand break repair deficient chinese hamster ovary cell line. | topoisomerase ii activity was measured in wild-type, chinese hamster ovary k1 cells, and in the dna double-strand break repair deficient xrs-6 cell line. total topoisomerase ii activity in a high salt, nuclear extract was found to be the same in both cell lines, as measured by decatenation of kinetoplast dna networks and catenation of plasmid pbr322 dna. while at low drug concentrations m-amsa-induced enzyme cutting of nuclear dna was 25% less in xrs-6 cells, the frequency of dna breaks at high ... | 1991 | 1848351 |
expression and characterization of recombinant human angiotensin i-converting enzyme. evidence for a c-terminal transmembrane anchor and for a proteolytic processing of the secreted recombinant and plasma enzymes. | chinese hamster ovary (cho) cells have been transfected with either a full-length cdna encoding human angiotensin i-converting enzyme (kininase ii; ec 3.4.15.1) (ace) or a mutated cdna, in which the last c-terminal 47 amino acids, including the putative transmembrane domain, are not translated. cell lines expressing high levels of the wild-type ace or the mutant were established. the cells transfected with the wild-type cdna (cho-ace) express a membrane-bound ectoenzyme with an intracellular c t ... | 1991 | 1848554 |
characterization of latent recombinant tgf-beta 2 produced by chinese hamster ovary cells. | latent recombinant transforming growth factor-beta 2 (lrtgf-beta 2) complex has been purified from serum-free media conditioned by chinese hamster ovary cells transfected with a plasmid encoding the tgf-beta 2 (414) precursor. under neutral conditions, lrtgf-beta 2 had an apparent molecular weight of 130 kda. the complex contained both mature and pro-region sequences. acidification of lrtgf-beta 2 resulted in the release of mature 24 kda tgf-beta 2 from the high molecular weight pro-region-conta ... | 1991 | 1848562 |
transfected d2 dopamine receptors mediate the potentiation of arachidonic acid release in chinese hamster ovary cells. | a rat d2l dopamine receptor, a splice variant of the d2 receptor, has recently been cloned. when transfected into and stably expressed in chinese hamster ovary cells, these receptors mediate the inhibition of both basal and forskolin-stimulated camp production, as previously described. we examined what role this receptor might play in the production of the second messenger arachidonic acid. the calcium ionophore a23187 stimulated the release of arachidonic acid, and this release of arachidonic a ... | 1991 | 1848657 |
expression of three human beta-adrenergic-receptor subtypes in transfected chinese hamster ovary cells. | the genes coding for three pharmacologically distinct subtypes of human beta-adrenergic receptors (beta 1 ar, beta 2 ar and beta 3 ar) were transfected for expression in chinese hamster ovary (cho) cells. stable cell lines expressing each receptor were analyzed by ligand binding, adenylate cyclase activation and photoaffinity labeling, and compared to beta ar subtypes observed in previously described tissues, primary cultures and transfected cell lines. each of the three receptor subtypes displa ... | 1991 | 1848818 |
protein synthesis is required for cholera toxin-induced stimulation of arachidonic acid metabolism. | the molecular events in the mechanism of action of cholera toxin were analyzed using chinese hamster ovary (cho) cells. cholera toxin stimulated both 3',5'-cyclic adenosine monophosphate (camp) synthesis and arachidonic acid metabolism in these cells. the turnover of phospholipid by cholera toxin-induced stimulation of phospholipase activity evoked the synthesis of pge2 and other prostaglandins. cholera toxin-induced release of both [3h]arachidonic acid and pge2 was blocked by addition of either ... | 1991 | 1849019 |
chromosome recombination and defective genome segregation induced in chinese hamster cells by the topoisomerase ii inhibitor vm-26. | we found that 4'-demethylepipodophyllotoxinthenylidene-beta-d-glucoside (vm-26; teniposide), which specifically inhibits the enzyme dna topoisomerase ii, induces the formation of quadriradial chromosomes in chinese hamster ovary cells. vm-26 traps topoisomerase ii molecules when they are covalently integrated into dna during their reaction. quadriradial chromosomes are formed by reciprocal exchange of double-stranded dna between single chromatids of two different chromosomes. using synchronised ... | 1991 | 1849068 |
the influence of dna-topoisomerase ii inhibitors novobiocin and fostriecin on the induction and repair of dna damage in chinese hamster ovary (cho) cells treated with mitoxantrone. | novobiocin (nb) at the concentration of 2 mmol/l added to the culture medium together with mitoxantrone (mit) (0.05-0.2 micrograms/ml) reduced the number of mit-induced single-strand breaks of dna to approximately one half measured by alkaline dna unwinding and hydroxyapatite chromatography of dna and similarly it reduced also the fraction of dna linked to proteins measured by the k(+) -sds precipitation method. neither repair of the induced dna breaks nor removal of the dna-protein cross-links ... | 1991 | 1849236 |
biosynthesis of lysosomal enzymes in cells of the end3 complementation group conditionally defective in endosomal acidification. | various aspects of lysosome biogenesis have been studied in chinese hamster ovary (cho) cells of the end3 complementation group (designated g.7.1 cells), which display a temperature-sensitive defect in the acidification of endosomes, but not lysosomes. in g.7.1 and normal wild-type cells grown at the permissive temperature (34 degrees c), the lysosomal enzymes alpha-glucosidase and cathepsin d were synthesized as high-molecular-weight precursors that subsequently underwent intracellular proteoly ... | 1991 | 1849319 |
evidence for coordinate regulation of the a system for amino acid transport and the mrna for the alpha 1 subunit of the na+,k(+)-atpase gene in chinese hamster ovary cells. | previous work suggested that the structural gene for the a system transporter and the mrna for the alpha subunit of the na+,k(+)-atpase in chinese hamster ovary cells cho-k1 [wild type (wt)] are coordinately controlled by regulatory gene r1. this conclusion was based on analysis of a mutant for the a system, alar4. this mutant had a constitutive level of a system transport activity equal to the level found in derepressed wt cells and a 4 times increase in abundance of the alpha 1 subunit of na+, ... | 1991 | 1849656 |
characterization of tissue-specific transcription by the human synapsin i gene promoter. | synapsin ia and synapsin ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. to identify control elements directing the neuronal expression of synapsins ia/b, we functionally analyzed the promoter region of the human synapsin i gene. a hybrid gene was constructed containing 2 kilobases of 5' flanking sequence from the synapsin i gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and non ... | 1991 | 1849657 |
role of threonine-286 as autophosphorylation site for appearance of ca2(+)-independent activity of calmodulin-dependent protein kinase ii alpha subunit. | to confirm directly the role of thr-286 as the autophosphorylation site responsible for the appearance of ca2(+)-independent activity of ca2+/calmodulin-dependent protein kinase ii alpha subunit, we constructed two mutated cdnas of thr-286 to pro or ala using site-directed mutagenesis and introduced into chinese hamster ovary cells. the mutant enzymes expressed in stable cell lines were partially purified and their catalytic properties were confirmed to be similar to those of wild-type kinase, e ... | 1991 | 1849884 |
recombinant human interleukin 3 induces proliferation of inflammatory cells and keratinocytes in vivo. | in this preclinical study we investigated the effect(s) of recombinant human (rh) interleukin 3 (il-3) on hemopoietic differentiation and attempted to evaluate possible clinical side effects of this hemopoietic growth factor. rh il-3, derived from either escherichia coli or chinese hamster ovary, was administered subcutaneously to 16 rhesus monkeys (by pairs) at different doses (11, 33, and 100 micrograms/kg/day) for 14 days. during the 2nd week of administration white blood cell counts increase ... | 1991 | 1850054 |
hyperthermia enhances the cytotoxic effects of reactive oxygen species to chinese hamster cells and bovine endothelial cells in vitro. | hyperthermia is under intensive investigation as a treatment for tumors both alone and in combination with other therapeutic agents. hyperthermia has a profound effect on the function and structural integrity of tumor microvasculature; this has often been cited as a reason for its effectiveness in treatment of tumors. to test the role of hyperthermia in cytotoxic effects of active oxygen species, chinese hamster, v79, and bovine endothelial cells were treated by the active oxygens, o not equal t ... | 1991 | 1850533 |
comparison of the activities of variant forms of eif-4d. the requirement for hypusine or deoxyhypusine. | eukaryotic protein synthesis initiation factor 4d (eif-4d) (current nomenclature, eif-5a) contains the unique amino acid hypusine (n epsilon-(4-amino-2-hydroxybutyl)lysine). the first step in hypusine biosynthesis, i.e. the formation of the intermediate, deoxyhypusine (n epsilon-(4-aminobutyl)lysine), was carried out in vitro using spermidine, deoxyhypusine synthase, and ec-eif-4d(lys), an eif-4d precursor prepared by over-expression of human eif-4d cdna in escherichia coli. in a parallel reacti ... | 1991 | 1850732 |
protease treatment of pertussis toxin identifies the preferential cleavage of the s1 subunit. | trypsin digestion of pertussis toxin (pt) preferentially cleaved the s1 subunit at arg-218 without detectable degradation of the b oligomer. the fragment produced, termed the tryptic s1 fragment, appears to remain associated with the b oligomer. chymotrypsin digestion of pt also preferentially cleaved the s1 subunit without detectable degradation of the b oligomer. the chymotryptic s1 fragment possessed a slightly lower apparent molecular weight than the tryptic s1 fragment and was more accessib ... | 1991 | 1850738 |
radiation protection of in vitro mammalian cells: effects of hydroxyl radical scavengers on the slopes and shoulders of survival curves. | we have tested several chemical compounds, characterized and widely used as hydroxyl radical (.oh) scavengers, for their effects on the radiation sensitivity of chinese hamster v79 cells irradiated in air or nitrogen. our purpose is to reexamine the proposed relationship between the level of protection and the rates at which the scavengers react with .oh. we found that the additives can have two apparently independent effects on the shape of survival curves: a reduction in sensitivity (i.e., "pr ... | 1991 | 1850852 |
rabbit haemorrhagic disease: an investigation of some properties of the virus and evaluation of an inactivated vaccine. | an inactivated vaccine against rabbit haemorrhagic disease (rhd), developed and tested in our laboratory, is produced commercially by bioveta, ivanovice, czechoslovakia. rabbits developed full protection against infection 3 weeks after the administration of a single dose. antibodies were detectable from day 5 after vaccination. naturally acquired antibodies were demonstrated in some rabbits kept on commercial farms. the virus survived at least 225 days in an organ suspension kept at 4 degrees c, ... | 1991 | 1850893 |
the two homologous domains of human angiotensin i-converting enzyme are both catalytically active. | molecular cloning of human endothelial angiotensin i-converting enzyme (kininase ii; ec 3.4.15.1) (ace) has recently shown that the enzyme contains two large homologous domains (called here the n and c domains), each bearing a putative active site, identified by sequence comparisons with the active sites of other zinc metallopeptidases. however, the previous experiments with zinc or competitive ace inhibitors suggested a single active site in ace. to establish whether both domains of ace are enz ... | 1991 | 1851160 |
structural and biological properties of human recombinant myeloperoxidase produced by chinese hamster ovary cell lines. | the cdna encoding human myeloperoxidase carries three atg codons in frame; 144, 111 and 66 bp upstream from the proprotein dna sequence. in order to determine the most efficient signal sequence, three cdna modules starting at each of the atg were cloned into an eucaryotic expression vector and stably expressed in chinese hamster ovary cell lines. in all three cases, recombinant human myeloperoxidase (recmpo) was secreted into the culture medium of transfected cells, indicating that each of the s ... | 1991 | 1851479 |
recognition and plasma clearance of endotoxin by scavenger receptors. | lipid a is the active moiety of lipopolysaccharide (lps, also referred to as endotoxin), a surface component of gram-negative bacteria that stimulates macrophage activation and causes endotoxic shock. macrophages can bind, internalize and partially degrade lps, lipid a and its bioactive precursor, lipid iva. we report here that lipid iva binding and subsequent metabolism to a less active form by macrophage-like raw 264.7 cells is mediated by the macrophage scavenger receptor. scavenger-receptor ... | 1991 | 1852209 |
mutagenesis and dna adduct formation by 1-nitropyrene in chinese hamster ovary cells without exogenous metabolic activation. | the direct-acting mutagenicity of 1-nitropyrene (1-np), a tumorigenic environmental pollutant and model nitropolycyclic aromatic hydrocarbon, was studied in chinese hamster ovary (cho) cells. previous reports indicated that 1-np, a potent direct-acting mutagen in salmonella typhimurium, was mutagenic in cho cells only in the presence of an exogenous activation system. in this study, a dna-repair-deficient cho cell line, cho-uv5, and the repair-proficient cho-k1-bh4 cell line were used to measure ... | 1991 | 1853350 |
the identification of heme oxygenase as a major hypoxic stress protein in chinese hamster ovary cells. | chronic hypoxia increases the expression of a set of stress proteins (oxygen regulated proteins or orps) which is implicated in the development of drug resistance and radiation sensitivity in tumour cells. five major orps have been documented, and two, orp 80 and orp 100, are considered to be identical to the glucose regulated stress proteins grp78 and grp94, respectively. we report here that orp 33 is a form of the heme catabolic enzyme, heme oxygenase, using evidence obtained from northern blo ... | 1991 | 1854629 |
novel chinese hamster ultraviolet-sensitive mutants for excision repair form complementation groups 9 and 10. | in this paper we demonstrate that the mutants cho7pv and cho4pv isolated by us from the cho-k1 prol- cell line represent two new complementation groups of uv-sensitive excision repair-defective rodent mutants. we have classified the mutant cho7pv as representative of group 9 and cho4pv as representative of group 10. cellular and biochemical characterization of these mutants indicates that they are moderately sensitive to a broad spectrum of mutagens (uv and mono- and bifunctional alkylating agen ... | 1991 | 1855213 |
modulation of genotoxic activity of tobacco smoke. | tobacco smoke (ts) caused a three- to nine-fold increase in the frequency of his+ revertants in salmonella typhimurium ta98 but not in ta97a, ta100 or ta102. activation by a post-mitochondrial fraction obtained from the liver of rats pretreated with aroclor-1254 or methylcholanthrene was required; fractions from phenobarbital-pretreated or untreated rats had no effect. vitamins a and e, but not ascorbic acid, inhibited the ts-induced mutagenesis by up to 63%, whereas glutathione and cysteine inc ... | 1991 | 1855912 |
inhibition by fatty acids of direct mutagenicity of n-nitroso compounds. | fatty acids inhibited the direct mutagenicity of n-nitroso compounds in salmonella typhimurium ta1535, escherichia coli wp2 and wphcr-, and e. coli h/r30r (wild) and hs30r (uvra). this inhibitory activity was dependent on the concentration of fatty acids, and fatty acids with longer alkyl chain were more potent. of the n-nitroso compounds tested, alpha-hydroxy nitrosamines underwent the strongest inhibitory effect. the rate of decomposition was not changed by addition of fatty acids. the partiti ... | 1991 | 1855917 |
design of constructs for the expression of biologically active recombinant human factors x and xa. kinetic analysis of the expressed proteins. | activation of vitamin k-dependent plasma proteases occurs by specific interaction with components of the blood coagulation cascade. in this report, we describe the direct expression and enzymatic characterization of the human coagulation zymogen factor x and its activated form, factor xa, from transformed chinese hamster ovary fibroblast cell lines. expression was achieved using either a full-length factor x cdna or a unique mutant factor xa cdna. the functional factor xa precursor contained a n ... | 1991 | 1856206 |
biosynthesis of glycosylated human lysozyme mutants. | complementary dna encoding human lysozyme was subjected to oligonucleotide-directed mutagenesis. at one of three selected positions, amino acid residues 22, 68, or 118, the signal for n-linked glycosylation was created. the mutant dnas were inserted into a eucaryotic vector and transfected into cultured hamster cells. the three mutant cdnas directed synthesis of lysozyme mutants, which were named li, lii, and liii. the mutant lysozymes li and lii comprised mixtures of glycosylated and nonglycosy ... | 1991 | 1856221 |
single nucleotide resolution of sterol regulatory region in promoter for 3-hydroxy-3-methylglutaryl coenzyme a reductase. | sterol-dependent regulation of the 3-hydroxy-3-methylglutaryl coenzyme a (hmg-coa) reductase promoter was previously localized to a 42-base pair region containing an octamer sequence, referred to as the sterol regulatory element (sre-1). a similar motif is found in the region of dna that is required for sterol-dependent regulation of the hmg-coa synthase and low density lipoprotein receptor genes. single nucleotide substitution analyses of the low density lipoprotein receptor and hmg-coa synthas ... | 2006 | 1856223 |
cloning and expression of an a1 adenosine receptor from rat brain. | we have used the polymerase chain reaction technique to selectively amplify guanine nucleotide-binding regulatory protein (g protein)-coupled receptor cdna sequences from rat striatal mrna, using sets of highly degenerate primers derived from transmembrane sequences of previously cloned g protein-coupled receptors. a novel cdna fragment was identified, which exhibits considerable homology to various members of the g protein-coupled receptor family. this fragment was used to isolate a full-length ... | 1991 | 1857334 |
distribution of m2 muscarinic receptors in rat brain using antisera selective for m2 receptors. | the dna fragment encoding the third intracellular loop of rat m2 muscarinic receptor was fused to the gene for staphylococcal protein a. the resultant fusion protein, expressed in bacteria, was purified via igg affinity chromatography and used as an antigen to raise a polyclonal antiserum. chinese hamster ovary cells transfected with cdna coding for a single muscarinic receptor subtype were used as tissue sources to screen antisera. the antiserum was shown to immunoprecipitate quantitatively (gr ... | 1991 | 1857338 |
32p-postlabelling analysis and micronuclei induction in primary chinese hamster lung cells exposed to tobacco particulate matter. | the genotoxicity of tobacco particulate matter (tpm) derived from a low-tar, low-nicotine cigarette has been examined by measuring micronucleus induction in a primary pulmonary cell line, both in the absence and presence of an exogenous source of metabolic activation. in an attempt to correlate the cytogenetic damage observed with dna adduct formation, dna extracted from tpm-treated cells has been analysed with two different modifications of the 32p-postlabelling assay. the results from the 32p- ... | 1991 | 1860172 |
chemical induction of somatic gene mutations and chromosomal aberrations in lung fibroblasts of rats. | rats can be used to detect both somatic gene mutations and chromosomal aberrations induced in vivo. the technique adapted from chinese hamsters for the isolation and analysis of lung fibroblasts confirm the surprising results obtained in hamsters; namely, methyl methanesulphonate induces many micronuclei but no significant increase in gene mutations. in contrast ethylnitrosourea induces both micronuclei and gene mutations. | 1991 | 1861691 |
effects of diethylstilbestrol and its methyl ethers on aneuploidy induction and microtubule distribution in chinese hamster v79 cells. | we previously reported that diethylstibestrol (des) and its derivatives inhibit the in vitro polymerization of microtubule proteins isolated from porcine brain (sato et al., 1987). we found that the presence of the free hydroxy group of des was indispensable for the inhibition of microtubule assembly. in the present investigation, this structure-activity relationship was confirmed by the effects of des and its methyl ethers on chromosome number and the cellular microtubule architecture of chines ... | 1991 | 1861692 |
preferential integration of marker dna into the chromosomal fragile site at 3p14: an approach to cloning fragile sites. | fragile sites are specific regions of chromosomes that are prone to breakage. in cells cultured under conditions that induce fragile site expression, high levels of inter- and intrachromosomal recombination have been observed involving chromosomal bands containing fragile sites. to determine whether expression of specific fragile sites would facilitate preferential integration of exogenous dna at these recombination hot spots, the vector psv2neo was transfected into a chinese hamster-human somat ... | 1991 | 1862089 |
alterations in microtubule assembly caused by the microtubule-active drug ly195448. | ly195448 is an experimental drug that blocks cells at metaphase (boder et al.: microtubules and microtubule inhibitors 1985: 353-361, 1985). a 4 hour exposure of nrk cells to a drug concentration of 46 microm (15 micrograms/ml) increased the number of mitotic cells in the population from 4.9% to 18.5%. examination of treated cells by immunofluorescence showed increased numbers of cells blocked at prometaphase, with short microtubules extending from the spindle pole to the kinetochores. the cytos ... | 1991 | 1863984 |
mast cell tryptase is a mitogen for cultured fibroblasts. | mast cells appear to promote fibroblast proliferation, presumably through secretion of growth factors, although the molecular mechanisms underlying this mitogenic potential have not been explained fully by known mast cell-derived mediators. we report here that tryptase, a trypsin-like serine proteinase of mast cell secretory granules, is a potent mitogen for fibroblasts in vitro. nanomolar concentrations of dog tryptase strongly stimulate thymidine incorporation in chinese hamster lung and rat-1 ... | 1991 | 1864960 |
structural analogues of pyrroline 5-carboxylate specifically inhibit its uptake into cells. | pyrroline 5-carboxylate, a naturally occurring intermediate, is a potent activator of redox-dependent metabolic pathways. the effect of pyrroline 5-carboxylate is due, at least in part, to the special mechanism mediating its entry into cells. using chinese hamster ovary cells we recently characterized the cellular uptake of pyrroline 5-carboxylate as a process transferring oxidizing potential pari passu with cell entry, a process consistent with group translocation. we sought to identify specifi ... | 1991 | 1865491 |
[the relationship of the saturation density of multilayer cell cultures to their mass exchange with the medium]. | chinese hamster fibroblasts (chf) and nih 3t3 cells were cultured on a glass substrate at different distances from the porous membrane separating the cells from the perfusing medium. it is shown that with perfusion of medium above the membrane there is no movement of the medium near the cells. in both the types of culture, the cells grow in multilayers, however the multilayer character of growth in chf is more pronounced than in nih 3t3 cells. the saturation density of the cultures depends on th ... | 1991 | 1866795 |
[the proliferative characteristics of cells in culture during perfusion of the medium]. | the proliferation of chinese hamster fibroblasts (chf) and nih 3t3 cells was studied at different flow rates immediately above the cells. it is shown that there is a limiting density of saturation of the perfused culture that accounts for 1.7 x 10(6) - 2.0 x 10(6) cells/cm2 for nih 3t3 cells, and for 6 x 10(6) - 7 x 10(6) cells/cm2 for chf. the growth curves and the distribution of cells with respect to the phases of the cell cycle during cultivation with and without perfusion are presented. bas ... | 1991 | 1866796 |
expression of the glut1 glucose transporter increases thymidine uptake in chinese hamster ovary cells at low glucose concentrations. | an increase in expression of the glut1 glucose transporter gene has been observed to be associated with an increase in glucose transport activity upon oncogenic transformation of the cells. increased expression of this glucose transporter isoform has been also observed in fetal tissues. to investigate the consequences of this phenomenon on cellular metabolism and cell growth, an expression vector containing the glut1 glucose transporter complementary dna was transfected into chinese hamster ovar ... | 1991 | 1868466 |
mutagenic properties of 2-amino-n6-hydroxyadenine in salmonella and in chinese hamster lung cells in culture. | the mutagenicity of the base analogue, 2-amino-n6-hydroxyadenine (aha), was tested in salmonella typhimurium ta100 and ta98 and in chinese hamster lung (chl) cells. aha showed very potent mutagenicity in ta100 without s9 mix, inducing 25,000 revertants/micrograms. the mutagenicity increased about 2-fold upon addition of s9 mix containing 10 microliters s9. aha was found to be one of the strongest mutagens for ta100. addition of s9 mix containing 100 microliters s9 induced no significant increase ... | 1991 | 1870613 |
high level expression of recombinant human tissue factor in chinese hamster ovary cells as a human thromboplastin. | tissue factor (tf) is the high affinity transmembrane receptor and cofactor for cellular initiation of the plasma coagulation protease cascades by factor viia. we describe the synthesis of recombinant hutf by stably transfected cho cell lines carrying integrated hutf dna, and the isolation of hutf glycoprotein with specific functional activity equivalent to natural hutf. the expression vector (pcdm8), carrying the cytomegalovirus promoter to drive transcription of a partial cdna construct encodi ... | 1991 | 1871713 |
dna double-strand breaks measured in individual cells subjected to gel electrophoresis. | microscopic examination of individual mammalian cells embedded in agarose, subjected to electrophoresis, and stained with a fluorescent dna-binding dye provides a novel way of measuring dna damage and more importantly, of assessing heterogeneity in dna damage within a mixed population of cells. with this method, dna double-strand breaks can be detected in populations of cells exposed to x-ray doses as low as 5 gy. the radiation dose-response relationship for initial formation of double-strand br ... | 1991 | 1873812 |
sequence requirements for the stimulation of gene amplification by a mammalian genomic element. | hsag-1 is a 3.4-kb genomic element from a human chronic lymphocytic leukemia--chinese hamster ovary (cho) hybrid cell line shown to stimulate the amplification of expression vectors in cis when transfected into a variety of cell lines [mcarthur and stanners, j. biol. chem. 266 (1991) 6000-6005]. subfragments of hsag-1 were tested for amplification activity by insertion into the vector, psv2dhfr. the results suggest that multiple positive- and negative-acting elements were present that influenced ... | 1991 | 1874442 |
an experimental approach to identifying the genotoxic risk from cooked meat mutagens. | in order to define the toxicological risk to the human population from the chemical compounds formed during the process of cooking animal meat, which have been described as possessing mutagenic, genotoxic and carcinogenic activities, an extensive study was undertaken of cooked meat extract and two cooked meat mutagens, 2-amino-3-methylimidazo(4,5-f)quinoline (iq) and 2-amino-3,8-dimethylimidazo(4,5-f)quinoxaline (meiqx). the study involved toxicokinetics and mouse-tissue distribution studies of ... | 1991 | 1874465 |
evidence for the activity of a phospholipid exchange protein in vivo. | liposomes containing a self quenching concentration of a fluorescent phosphatidylethanolamine analog, were microinjected into chinese hamster ovary cells. immediately after microinjection, little intracellular fluorescence was observed. 10 min post-injection, labeling of the nuclear envelope and mitochondria became evident. combined with control studies, our results suggest that phospholipid exchange protein(s) facilitates phosphatidylethanolamine movement in vivo. | 1991 | 1878376 |
[study of antimutagenic properties of bio-ginseng in mammalian cells in vitro and in vivo]. | the impact was studied of bio-ginseng produced from ginseng callus cells on the rate of chromosome rearrangements in chinese hamster cells and in continuous tumor cells of mice (ehrlich strain). bio-ginseng reduced rate of spontaneous sce as well as the level of mitomycin c-induced chromosome aberrations in chinese hamster cells. it protected ascitic tumor cells (ehrlich strain) against the mutagen action of urea nitrosomethyl. | 1991 | 1878567 |
increased cytotoxicity of low-dose, long-duration exposure to 5-fluorouracil of v-79 cells with hyperthermia. | we examined the cytotoxic effects of combined low dose and long exposure to 5-fluorouracil (5-fu) and hyperthermia on chinese hamster v-79 cells with reference to timing and sequence of administration. the survival rate following hyperthermia at 42 degrees c for 2 h alone was 95.4%, and that after exposure to 1.0 micrograms/ml/5-fu alone for 48 hours, 94.2%. with respect to the combination of 5-fu and heat, the survival rate of cells exposed to hyperthermia at 42 degrees c for 2 h followed by 1. ... | 1991 | 1879041 |
induction of heat-shock proteins by glutamine. the 'feeding effect'. | subconfluent, log-phase chinese hamster ovary cells induced the major heat-shock proteins (hsp) when cells were refed, 40 hours after seeding. this method of inducing heat-shock proteins was also obtained by refeeding with fresh serum-free media, but not with media with a long shelf life or with media prepared without glutamine. it was observed that addition of glutamine alone to cultures at 40 hours post-seeding induced heat-shock proteins. addition of ammonium chloride, however, had no discern ... | 1991 | 1879557 |
immunization with soluble murine cd4 induces an anti-self antibody response without causing impairment of immune function. | the t cell surface molecule cd4 (l3t4 in mouse) is important in the t lymphocyte response to ag presented in association with mhc class ii molecules. to examine the role of cd4 in immune function, we expressed a soluble form of murine cd4 by deleting the transmembrane and cytoplasmic regions of the l3t4 gene and transfecting the altered gene into chinese hamster ovary cells. the recombinant soluble mouse cd4 (smcd4) retained the native conformation of the external portion, as indicated by the bi ... | 1991 | 1880414 |
[comparative studies on immunogenicity of chinese hamster ovary cell derived hb vaccine and plasma derived hb vaccine]. | chinese hamster ovary cell derived hb vaccine (cdv) and plasma derived hb vaccine (pdv) were separately given to two groups of 131 and 112 medical stuff subjected, and both the anti-hbs responses were observed for 24 months from the time of first injection. the anti-hbs positive rate at the 7th month was 97% (mean geometric anti-hbs concentration 588 iu/l) in cdv group and 78% (83 iv/l) in pdv group, and the positive rate and mean titer of anti-hbs were always higher for 24 months in cdv group. ... | 1991 | 1880449 |
sensitization to hyperthermia by 3,3'-dipentyloxacarbocyanine iodide: a positive correlation with dna damage and negative correlations with altered cell morphology, oxygen consumption inhibition, and reduced atp levels. | the cyanine dye 3,3'-dipentyloxacarbocyanine iodide (dioc5(3)) (concentrations of 0.5 microgram/ml to 5.0 micrograms/ml) was shown to be a potent sensitizer of chinese hamster ovary (cho) cells to hyperthermic cell killing at 43.0 degrees c or 45.5 degrees c, while exhibiting no cytotoxicity at 37.0 degrees c. sensitization to hyperthermic cell killing was accompanied by an increase in damage to the dna, as measured by dna unwinding. the increased dna damage correlated qualitatively with the enh ... | 2013 | 1880454 |
induction of mutations at the thymidine kinase locus in cho cells by restriction endonucleases. | induced mutation frequencies were measured at the tk locus (encoding for the enzyme thymidine kinase) following treatment of chinese hamster ovary cells (cho ki) with two restriction endonucleases (res), pvuii and ecori, which generate 'blunt-ended' and 'cohesive-ended' dna double-strand breaks (dsb), respectively. electroporation was used to introduce these enzymes into the cells. restriction endonucleases generating blunt-ended dsb have been shown to mimic the action of ionising radiation in c ... | 1991 | 1881352 |
site-specific mutagenesis of human follistatin. | follistatin is a monomeric protein originally discovered in ovarian follicular fluid as a suppressor of pituitary follicle-stimulating hormone (fsh) secretion, and later identified as a binding protein for activin. to explore the role of the asn-linked carbohydrate chains on the follistatin molecule in regard to the inhibition of fsh secretion and activin binding ability, site-specific mutations were introduced at either or both of the two potential asn-linked glycosylation sites of human follis ... | 1991 | 1883364 |
expression, purification and characterization of secreted recombinant human insulin-like growth factor-i (igf-i) and the potent variant des(1-3) igf-i in chinese hamster ovary cells. | recombinant human insulin-like growth factor-i (higf-i) and a biologically potent variant lacking the n-terminal tripeptide (des(1-3)igf-i) were produced from transfected chinese hamster ovary cells. the constructs encoding the signal peptide, sequence of the mature peptide and a c-terminal extension peptide were expressed under the control of a rous sarcoma virus promoter. successfully transfected clones secreting correctly processed recombinant higf-i or des(1-3)igf-i were selected by their se ... | 1991 | 1883485 |
characterization of chinese hamster ovary cells that are resistant to 3-beta-[2-(diethylamino)ethoxy]androst-5-en-17-one inhibition of low density lipoprotein-derived cholesterol metabolism. | the pharmacological agent u18666a (3-beta-[2-(diethylamino)ethoxy]androst-5-en-17-one inhibits the intracellular transport of low density lipoprotein (ldl)-derived cholesterol in chinese hamster ovary (cho) cells. ldl-derived cholesterol accumulates in the lysosomes of u18666a-treated cells causing delayed ldl-mediated regulation of cellular cholesterol metabolism and impaired movement of ldl-derived cholesterol to other cell membranes. as a result of impaired ldl-derived cholesterol transport, ... | 2007 | 1885589 |
posttranslational modifications of fibromodulin. | tyrosine sulfate residues were identified in fibromodulin produced by tracheal chondrocytes, by tendon and sclera fibroblasts in primary culture, as well as in chinese hamster ovary cells transfected with a construct containing fibromodulin cdna. the tyrosine sulfate residues were located in the n-terminal part of fibromodulin. thus, chinese hamster ovary cells expressing a deleted variant of fibromodulin lacking the n-terminal 52 amino acids following the predicted signal peptide did not contai ... | 1991 | 1885612 |
effects of substrate texture and curvature on the morphology of cultured cells. | the ultrastructural characteristics of several growth matrices were examined using two cell types chosen for their distinct growth habits. chinese hamster ovary cells and balb-c 3t3 mouse fibroblasts were grown on flat substrates (glass, tissue culture plastic, millipore filters) as well as spherical (glass, tissue culture plastic, cross-linked dextran) substrates. cells were plated maintaining equal densities and growth surface area. once the majority of the cells reached confluency, the cell's ... | 1991 | 1885994 |
post-transcriptional regulation in higher eukaryotes: the role of the reporter gene in controlling expression. | we have investigated whether reporter genes influence cytoplasmic regulation of gene expression in tobacco and chinese hamster ovary (cho) cells. two genes, uida encoding beta-glucuronidase (gus) from escherichia coli and luc, encoding firefly luciferase (luc), were used to analyze the ability of a cap, polyadenylated tail, and the 5'- and 3'-untranslated regions (utr) from tobacco mosaic virus (tmv) to regulate expression. the regulation associated with the 5' cap structure and the tmv 5'-utr, ... | 1991 | 1886610 |
a generalized concept for cell killing by heat. effect of chronically induced thermotolerance. | chronic thermotolerance was induced in chinese hamster ovary (cho) cells by pretreatment at 40 degrees c for various times ranging from 15 min to 16 h. the thermotolerant cells were either exposed to single heat treatments at 43 degrees c or subjected to step-down heating consisting of a priming treatment at 43 degrees c for 90 min followed immediately by a graded test treatment at 40 degrees c. data evaluation using a mathematical model published previously (h. jung, radiat. res. 106, 56-72, 19 ... | 1991 | 1886977 |
dose dependence of the oxygen enhancement ratio (oer) in radiation inactivation of chinese hamster v79-171 cells. | the dose dependence of the oxygen enhancement ratio (oer) has been examined through multiple measurements of the response of chinese hamster v79-171 cells to low and high doses of radiation under aerobic and hypoxic conditions. in this series of experiments the cells were maintained at 37 degrees c throughout the gassing and irradiation periods, to simulate normal physiological conditions. flow cytometry and cell sorting techniques were used to facilitate accurate measurement of cell survival th ... | 1991 | 1886978 |
the radiation response of asynchronous cells at low dose: evidence of substructure. | flow cytometry and cell sorting techniques have been used together with repeated measurement in an attempt to define better the radiation survival response of asynchronously dividing chinese hamster v79-171 cells under aerobic and hypoxic conditions. although the first two decades of cell inactivation have been examined, particular attention has been given to the low-dose range of a few grays, as used in individual radiation therapy treatments. a single linear-quadratic dose-response function wa ... | 1991 | 1886979 |
caffeine sensitization of chinese hamster ovary cells to heat killing. | the effects of the methylxanthine, caffeine, on heat sensitization was investigated using chinese hamster ovary (cho) cells. caffeine sensitized cho cells to heat killing by reducing both the shoulder and the slope of the 44 degrees c survival curve. heating was performed in suspension by addition of cells to preheated spinner flasks containing caffeine. changes in intracellular free calcium levels, [ca2+]i, were measured at 37 degrees c using the luminescent probe aequorin. caffeine (1-5 mm) in ... | 1991 | 1886980 |
changes in the nuclear structure in the radiation-sensitive cho mutant cell, xrs-5. | the structural organization of the cell nucleus was investigated by transmission electron microscopy in the radiosensitive chinese hamster ovary (cho) cell mutant, xrs-5 (d0 = 45 cgy), relative to parental k1 cells (d0 = 200 cgy). in 99% of all xrs-5 cells, the outer layer of the nuclear envelope was separated from the inner layer, while 96% of k1 cells had closely apposed layers. this separation of the inner and outer layers of the nuclear envelope in xrs-5 cells was not explained by an increas ... | 1991 | 1886982 |
differences in thermotolerance induced by heat or sodium arsenite: correlation between redistribution of a 26-kda protein and development of protein synthesis-independent thermotolerance in cho cells. | in previous studies, we have demonstrated the differences in thermotolerance induced by heat and sodium arsenite (lee et al., radiat. res. 121, 295-303, 1990). in this study, we investigated whether a 26-kda protein might play an important role in evincing these differences. chinese hamster ovary (cho) cells treated for either 1 h with 100 microm sodium arsenite (ars) or 10 min at 45.5 degrees c became thermotolerant to a test heat treatment at 43 degrees c administered 6 or 12 h later, respecti ... | 1991 | 1886989 |
transduction of the cho aprt gene into mouse l cells using an adeno-5/aprt recombinant virus. | an adenovirus-5 recombinant virus adapt1 carrying the chinese hamster ovary (cho) adenine phosphoribosyltransferase (aprt) gene was constructed by insertion of a 2.5-kb fragment containing the complete cho aprt structural gene linked to a moloney murine sarcoma virus (msv) promoter into the e3 region of adenovirus-5. the cho aprt gene was in the opposite orientation to the adenovirus e3 promoter. mouse lapt- tk- (lat) cells expressed the cho aprt gene when infected with the virus, even at low mo ... | 1991 | 1887332 |
deficient synthesis of mthfd, a trifunctional folate-dependent enzyme, in the cho ade e mutant. | mthfd is a folate-dependent trifunctional protein comprised of three activities: n5,n10-methylenetetrahydrofolate dehydrogenase, n5,n10-methenyltetrahydrofolate cyclohydrolase, and n10-formyltetrahydrofolate synthetase. the enzymes catalyze sequential interconversion of tetrahydrofolate derivatives required for purine, methionine, and thymidylate synthesis. a chinese hamster ovary cell line (ade-e), reported to have reduced cyclohydrolase activity, was studied to characterize the nature of the m ... | 1991 | 1887335 |
expression of a human cdna encoding a protein containing gar synthetase, air synthetase, and gar transformylase corrects the defects in mutant chinese hamster ovary cells lacking these activities. | the isolation of a human cdna encoding the multifunctional protein containing gar synthetase, air synthetase, and gar transformylase by functional complementation of purine auxotrophy in yeast has been reported. chinese hamster ovary (cho) cell mutant purine auxotrophs deficient in gar synthetase (ade-c) or air synthetase plus gar transformylase (ade-g) activities were transfected with this human gart cdna subcloned into a mammalian expression vector. this restored 49-140% of the activities of g ... | 1991 | 1887337 |
quantitative determination of mrna phenotypes by the polymerase chain reaction. | a method for quantitative determination of specific cellular mrna is described. the mrna in a dilution series of total rna was reverse transcribed by an oligo-dt primer and the cdna was amplified by the polymerase chain reaction (pcr) using sets of specific primers. a 32p- or biotin-labeled specific probe was hybridized to the pcr products immobilized on nitrocellulose membrane. the intensity of the hybridization signals was evaluated for quantification of the pcr products. a standard curve was ... | 1991 | 1888041 |
[expression of human lymphotoxin gene in cho-dhfr- cells]. | a recombinant plasmid p91-hult was constructed with a human lymphotoxin (hult) gene 2.4 kb ecori fragment and a mammalian cell expression vector plasmid p91023. the hult ecori dna fragment covers entire coding sequence and some 3(1) non-translated region sequence of the gene, p91-hult dna was used to transfect chinese hamster cell line cho-dhfr- cells by using calcium phosphate-dna coprecipitation method, and dhfr+ transfectants were obtained. rna dot blot hybridization analysis showed that the ... | 1991 | 1888532 |
structure/activity investigations in eight arylalkyltriazenes comparison of chemical stability, mode of decomposition, and sce induction in chinese hamster v79-e cells. | a series of seven 1-aryl-3.3-dialkyltriazenes, including 1-phenyl-3.3-dimethyltriazene (dmpt), 1-phenyl-3.3-di-(trideuteromethyl)-triazene (dmpt-ds), 1-p-methylphenyl-3.3-dimethyltriazene (dmpmpt), 1-p-nitrophenyl-3.3-dimethyltriazene (dmpnpt), 1-phenyl-3.3-diethyltriazene (dept), 1-phenyl-3.3-di-n-propyltriazene (dnprpt) and 1-phenyl-3.3-diisopropyltriazene (diprpt) and 1.3-diphenyl-3-methyltriazene (dpmt), was synthesized and characterized by uv/vis, ir and 1h-nmr spectroscopy. chemical half-l ... | 1991 | 1889006 |
adaptation of the interspersed repetitive sequence polymerase chain reaction to the isolation of mouse dna probes from somatic cell hybrids on a hamster background. | a strategy for the rapid isolation of dna probes from radiation-fusion chinese hamster cell hybrids containing overlapping portions of the murine x chromosome based on the interspersed repetitive sequence polymerase chain reaction (irs-pcr) previously used with human somatic cell hybrids has been developed. this specific amplification of mouse dna on a hamster background depends on the use of primers directed to the b2 short interspersed repeat element family and the r repeat, from the long inte ... | 1991 | 1889819 |
inhibition of intercellular communication in chinese hamster v79 cells by fractionated asphalt fume condensates. | asphalt fume condensate is a skin carcinogen in mice, yet this complex mixture contains relatively low levels of known carcinogenic initiators. consequently, its biological activity has been attributed to the presence of cocarcinogenic or tumor-promoting agents. one of several proposed mechanisms of tumor promotion is inhibition of intercellular communication. in an attempt to determine if asphalt fume has tumor-promoting potential inhibition of intercellular communication was measured in v79 ce ... | 1991 | 1890695 |
inhibition of mutagenesis and transformation by root extracts of panax ginseng in vitro. | the root extract of panax ginseng was investigated for its inhibitory effects on dna synthesis, mutagenicity, and cellular transformation using v79 and nih 3t3 cells. dna synthesis measured by the [3h]thymidine incorporation into v79 chinese hamster lung cells was significantly decreased by the addition of ginseng extract (0-1 microgram/ml) to the medium. however, ginseng extract was found to increase the rate of dna excision repair synthesis in v79 cells in response to treatment with uv radiati ... | 1991 | 1891494 |
2,4-dichlorophenoxyacetic acid effects on polyamine biosynthesis. | 2,4-dichlorophenoxyacetic acid (2,4-d) is a herbicide extensively used in agriculture. it was considered of interest to study its toxicity on animal cells. we had previously determined that 1 mm 2,4-d can inhibit cell growth, dna and protein synthesis of cultured chinese hamster ovary cells (cho) with cell accumulation in the g1/s interphase of the cell cycle. the present work examined the effects of 2,4-d on polyamine biosynthesis. the results suggest some possible mechanism of the herbicide's ... | 1991 | 1891779 |
hydroxyeicosatetraenoic acid oxidation in chinese hamster ovary cells: a peroxisomal metabolic pathway. | to evaluate the peroxisomal requirement for beta-oxidation of hydroxyeicosatetraenoic acids (hetes), we tested 5-, 12- and 15-hete oxidation in wild-type and mutant chinese hamster ovary (cho) cells. mutant cho cells contain peroxisomal ghosts, have random cytosolic localization of catalase and lack two of the enzymes necessary for peroxisomal beta-oxidation. reverse-phase hplc indicated that 33% of 12-hete radioactivity was converted by wild-type cho cells during a 2 h incubation to one major a ... | 2007 | 1892874 |
effect of vitamin e on arachidonic acid peroxidation and its binding to chinese hamster v79 cell dna. | following 24 h incubation in standard culture medium (containing 2 microm of arachidonic acid, aa), and 10 and 20 microm supplemented aa, approx. 55, 40 and 33%, respectively, of the fatty acid was incorporated into chinese hamster v79 cell lipids. the aa content of cells increased 5 to 7-fold with the 10 and 20 microm supplementations of aa and, there was a correspondingly marked decrease in the proportion of aa incorporated into phospholipids (94 vs. 50 and 32%), whereas an increased percentag ... | 2007 | 1892884 |
cell adhesion and growth on polymer surfaces with hydroxyl groups prepared by water vapour plasma treatment. | various polymer surfaces--polyethylene, polypropylene, polystyrene, polyethylene terephthalate and poly(methyl methacrylate)--were modified by water vapour plasma discharge treatment. the plasma-treated polymer surfaces were characterized by water contact angle measurement and electron spectroscopy for chemical analysis. it was observed that by the water vapour plasma treatment, the wettability of the polymer surfaces increases largely and almost all functional groups produced on the surfaces ar ... | 2007 | 1892978 |
human glioblastoma cell derived transforming growth factor-beta 2: evidence for secretion of both high and low molecular weight biologically active forms. | transforming growth factors beta (tgf-beta) form a family of multifunctional polypeptides which in the active dimeric forms have a molecular weight of 25 kda. human glioblastoma cells secrete immunosuppressive tgf-beta consisting mostly of tgf-beta 2 rather than tgf-beta 1. the results shown here demonstrate that in addition to the mature 25 kda form of tgf-beta 2, glioblastoma cells release a biologically active high molecular weight form of tgf-beta 2 which suppresses the interleukin-2-depende ... | 1991 | 1894732 |
an experimental approach to identifying the genotoxic risk by cooked meat mutagens. | in order to define the toxicological risk for the human population derived from the chemical compounds formed during the process of cooking animal meat, which have been described to possess a mutagenic, genotoxic, and carcinogenic activity, an extensive study has been developed on cooked meat extract and two cooked meat mutagens, iq and meiqx. the study has been based on toxicokinetics and mouse tissue distribution of the two chemicals, on in vitro and in vivo mutagenicity/genotoxicity analyses ... | 1991 | 1897387 |
the role of protein kinase c in the stimulation of phosphatidylcholine synthesis by phospholipase c. | the role of protein kinase c in the stimulation of phosphatidylcholine (pc) synthesis by phospholipase c was investigated. phospholipase c treatment of chinese hamster ovary cells (cho) generates diacylglycerol, which is an activator of protein kinase c. the protein kinase c activator, 12-o-tetradecanoyl-phorbol-13-acetate (tpa) stimulated choline incorporation into two cho cell lines, a wild-type cell line, wtb, and a mutant cell line, dtg 1-5-4. dtg 1-5-4 is a mutant defective in receptor-medi ... | 1991 | 1898031 |
enhancement of heme oxygenase-1 synthesis by glutathione depletion in chinese hamster ovary cells. | chinese hamster ovary cells cultured in vitro were used to assess the role of glutathione metabolism in the induction of the 32-kda stress protein. enhanced synthesis of the 32-kda protein was observed after cells were incubated with cdcl2 or diethylmaleate and protein was subjected to sds-page followed by fluorography. concomitantly, in both cell preparations an increase in heme oxygenase activity was observed. proteins from cdcl2- and diethylmaleate-treated cells were subjected to western blot ... | 1991 | 1898036 |
oligosaccharide structures present on asparagine-289 of recombinant human plasminogen expressed in a chinese hamster ovary cell line. | the oligosaccharide structures linked to asn289 of a recombinant (r) variant (r561s) human plasminogen (hpg) expressed in chinese hamster ovary (cho) cells, after transfection of these cells with a plasmid containing the cdna coding for the variant hpg, have been determined. employing high-performance anion-exchange liquid chromatography mapping of the oligosaccharide units cleaved from the protein by glycopeptidase f, compared with elution positions of standard oligosaccharides, coupled with mo ... | 1991 | 1899031 |
isolation of two chloroethylnitrosourea-sensitive chinese hamster cell lines. | 1-[(4-amino-2-methylpyrimidin-5-yl)methyl]-3-(2-chloroethyl)-3- nitrosourea hydrochloride (acnu), a cancer chemotherapeutic bifunctional alkylating agent, causes chloroethylation of dna and subsequent dna strand cross-linking through an ethylene bridge. we isolated and characterized two acnu-sensitive mutants from mutagenized chinese hamster ovary cells and found them to be new drug-sensitive recessive chinese hamster mutants. both mutants were sensitive to various monofunctional alkylating agen ... | 1991 | 1899038 |
heterogeneous repair of methylnitrosourea-induced alkali-labile sites in different dna sequences. | the repair of dna damage induced by methylnitrosourea (mnu) in restriction fragments containing the dihydrofolate reductase (dhfr) gene in chinese hamster ovary cells was compared to that in equal size restriction fragments containing a nontranscribed flanking sequence 3' to the dhfr gene or the c-fos gene. following exposure to 10(-3) m mnu, restriction fragments containing either the dhfr gene or the 3' flanking sequence had similar amounts of alkali labile sites, approximately 2 sites/restric ... | 1991 | 1899045 |
disruption of the golgi apparatus by brefeldin a inhibits the cytotoxicity of ricin, modeccin, and pseudomonas toxin. | we have studied the cytotoxicity of ricin in cells treated with brefeldin a (bfa), which dramatically disrupts the structure of the golgi apparatus causing golgi content and membrane to redistribute to the er. bfa inhibits the cytotoxicity of ricin in chinese hamster ovary, normal rat kidney, and vero cells and abolishes the enhancement of ricin cytotoxicity by nh4cl, nigericin, swainsonine, and tunicamycin or by a mutation in endosomal acidification. bfa protects cells from the cytotoxicities o ... | 1991 | 1899070 |
tea tannin components modify the induction of sister-chromatid exchanges and chromosome aberrations in mutagen-treated cultured mammalian cells and mice. | the modifying effects of tannin components extracted from green tea and black tea on mutagen-induced sces and chromosome aberrations were studied. these tannin components did not affect spontaneous sces and chromosome aberrations in cultured chinese hamster cells. the frequency of sces and chromosome aberrations induced by mitomycin c (mmc) or uv was enhanced by the posttreatment with tea tannin components. when cells were post-treated with tea tannin components in the presence of metabolic enzy ... | 1991 | 1899132 |
the dysfunctional ldl receptor in a monensin-resistant mutant of chinese hamster ovary cells lacks selected o-linked oligosaccharides. | the chinese hamster ovary (cho) cell line monr31, which is resistant to the cytotoxic ionophore monensin, produces a receptor for the low density lipoprotein (ldl) that has a lowered binding affinity for ldl and is approximately 5 kda smaller in size than the receptor from parental cho cells. it has been proposed that the reduced size and affinity for ldl are associated with a reduced level of o-glycosylation of ser/thr residues in the receptor. to examine this possibility in more detail, both p ... | 1991 | 1899178 |
construction and characterization of a functional chimeric murine-human antibody directed against human fibrin fragment-d dimer. | fibrin-directed monoclonal antibodies may be clinically useful for in vitro thrombus imaging and for the targeting of fibrinolytic agents to blood clots. one such murine monoclonal antibody, (mab-15c5), raised against the fragment-d dimer epitope of cross-linked human fibrin, was previously characterized [holvoet, p., stassen, j. m., hashimoto, y., spriggs, d., devos, p. & collen, d. (1989) thromb. haemostasis 61, 307-313] has recently been cloned and expressed [vandamme, a.-m., bulens, f., bern ... | 1991 | 1899382 |
heterogeneity in the tyrosine sulfation of chinese hamster ovary cell produced recombinant fviii. | by the use of recombinant technology, several stable chinese hamster ovary (cho) cell lines expressing human fviii were established. thrombin treatment and sds-page analysis of the purified recombinant fviii (rfviii) revealed a striking difference from plasma-derived fviii (pfviii). a 43-kda fragment of the fviii heavy chain appears as a double band from rfviii, while a single band from pfviii is observed. all other fragments from the two samples appeared similar by sds-page. the heterogeneity i ... | 1991 | 1899619 |
effect of deficiencies in dna repair on the toxicity of mitomycin c and porfiromycin to cho cells under aerobic and hypoxic conditions. | a wild type chinese hamster cell line (aa8) and three repair-deficient sublines of aa8 (em9, uv4, and uv5) were used to study the nature of the cytotoxic lesions produced by the bioreductive alkylating agents mitomycin c and porfiromycin under aerobic and hypoxic conditions. the sensitivities of the repair-deficient sublines to the drugs varied markedly: em9 was similar to aa8, whereas uv4 was exquisitely sensitive and uv5 was of intermediate sensitivity. moreover, both the relative toxicities o ... | 1991 | 1899798 |
assignment of human preprothyrotropin-releasing hormone (trh) gene to chromosome 3. | the human gene encoding preprotrh (thyrotropin-releasing hormone) was assigned to chromosome 3, using human-chinese hamster ovary somatic cell hybrids, analyzed by southern hybridizations. hybridization was carried out with a 32p-labeled human preprotrh cdna labeled by the method of random priming. hybridization of the cdna probe to a human specific 4.8-kb dna fragment of ecori-digested wbc dna was used to localize the human preprotrh gene. no hybridization, by contrast, was seen with human prep ... | 1991 | 1900134 |