| in vivo synthesis of potato spindle tuber viroid: kinetic relationship between the circular and linear forms. | | 1978 | 664231 |
| size and secondary structure of potato spindle tuber viroid. | | 1977 | 841846 |
| de novo synthesis of potato spindle tuber viroid as measured by incorporation of 32p. | | 1977 | 860413 |
| potato spindle tuber viroid. xiii. inhibition of replication by actinomycin d. | | 1975 | 1114697 |
| potato spindle tuber viroid. xiv. replication in nuclei isolated from infected leaves. | | 1975 | 1114704 |
| a viroid from nematanthus wettsteinii plants closely related to the columnea latent viroid. | a viroid was isolated from symptomless nematanthus wettsteinii plants using the return-page method for analysis of low m(r) nucleic acids. the rna was transmitted to tomato, three cultivars of potato, and scopolia sinensis plants by mechanical inoculation or by grafting. infected solanaceous plants developed symptoms similar to those caused by potato spindle tuber viroid (pstvd). the nematanthus viroid consists of 372 nucleotides, 214 g+c, 158 a+u, with a g+c/a+u ratio of 1.35. one of seven cdna ... | 1992 | 1279098 |
| piperonyl butoxide, a potent inhibitor of potato spindle tuber viroid in scopolia sinensis. | piperonyl butoxide has been found to act as potent inhibitor for potato spindle tuber viroid in scopolia sinensis hemsl plant. | 1975 | 1203757 |
| viroids are single-stranded covalently closed circular rna molecules existing as highly base-paired rod-like structures. | viroids are uncoated infectious rna molecules pathogenic to certain higher plants. four different highly purified viroids were studied. by ultracentrifugation, thermal denaturation, electron microscopy, and end group analysis the following features were established: (i) the molecular weight of cucumber pale fruit viroid from tomato is 110,000, of citrus exocortis viroid from gynura 119,000, of citrus exocortis viroid from tomato 119,000 and of potato spindle tuber viroid from tomato 127,000. (ii ... | 1976 | 1069269 |
| separation of potato spindle tuber viroid ribonucleic acid from scopolia sinensis into three infectious forms and the purification and oligonucleotide pattern of fraction ii rna. part ix. | the existence of three infectious forms of potato spindle tuber viroid (pstv) rna from scopolia sinensis was demonstrated by fractionation with high salt, by reverse phase and high pressure liquid chromatography, and by polyacrylamide gel electrophoresis. purification of fraction ii was achieved by the following steps: extraction of nucleic acid with phenol, precipitation of the rna with cetyltrimethylammonium bromide, fractionation of the rna with lithium chloride and isopropanol, and finally ... | 1976 | 953847 |
| comparative oligonucleotide fingerprints of three plant viroids. | 5' phosphorylation in vitro with gamma-32p-atp and t4 phage induced polynucleotide kinase was used to obtain rnaase a and rnaase t1 fingerprints of three plant viroids: potato spindle tuber viroid from tomato (pstv-tom), chrysanthemum stunt viroid from cineraria (chsv-cin) and citrus exocortis viroid from gynura aurantiaca (cev-gyn). these three viroids differ significantly from each other as judged from their oligonucleotide patterns. this supports the concept of individual viroid species. | 1977 | 896482 |
| synthesis of rna complementary to potato spindle tuber viroid using q beta replicase. | | 1977 | 867818 |
| potato spindle tuber viroid: circular dichroism spectrum and physical chemical studies of its interaction with ethidium bromide. | the presence and extent of base-paired secondary structure in the protein-free potato spindle tuber viroid rna has been investigated by spectroscopic techniques. dye-binding studies with the intercalating dye, ethidium bromide, indicate the presence of base-paired regions in the molecule. variation of the induced chirality in the dye with the dye to rna phosphate ratio indicate the presence of two base-paired regions in the molecule. | 1978 | 728834 |
| effects of random mutagenesis upon potato spindle tuber viroid replication and symptom expression. | a combination of random chemical mutagenesis plus temperature gradient gel electrophoresis was used to isolate a collection of 57 potato spindle tuber viroid (pstv) cdnas containing mutations distributed throughout the entire 359 nucleotide genome. although the presence of multiple mutations was often associated with a loss of cdna infectivity, infectious pstv cdnas containing as many as four unlinked alterations could be isolated. several mutations in the pathogenicity domain and left terminal ... | 1991 | 1926773 |
| nucleotide sequence and secondary structure of potato spindle tuber viroid. | the viroid of the potato spindle tuber disease (pstv) is a covalently closed ring of 359 ribonucleotides. as a result of intramolecular base pairing, a serial arrangement of double-helical sections and internal loops form a unique rod-like secondary structure. pstv is the first pathogen of a eukaryotic organism for which the complete molecular structure has been established. | 1978 | 643081 |
| evidence for a single infectious species of potato spindle tuber viroid. | potato spindle tuber viroid (pstv) has been separated into two electrophoretic species on polyacrylamide gels containing 8 m urea at 60 degrees. only the slower-migrating electrophoretic form was infectious and is presumably the circular form of the molecule. both forms had similar base compositions with a 55-58% gc content, similar to the citrus exocortis viroid. labeling studies in vivo suggest that the viroid is not methylated. | 1979 | 429145 |
| studies on the primary and secondary structure of potato spindle tuber viroid: products of digestion with ribonuclease a and ribonuclease t1, and modification with bisulfite. | potato spindle tuber viroid (pstv), a small infectios rna, has been completely digested with rnase t1 and rnase a, and the resulting oligonucleotides have been sequenced using 5'-terminal 32p-labelling with gamma-32p atp and t4 polynucleotide kinase, fingerprinting and controlled nuclease p1 digestion. modified nucleotides have not been detected in 5'-positions of these oligonucleotides. pstv consists of about 359 nucleotides and contains a remarkable stretch of 18 purines, mainly adenosines; th ... | 1978 | 418383 |
| separation and infectivity of circular and linear forms of potato spindle tuber viroid. | potato spindle tuber viroid can be separated into two fractions by polyacrylamide gelelectrophoresis in the presence of formamide and urea. one fraction contains predominantly circular molecules; the second fraction contains almost exclusively linear molecules. the purity of the fractions was estimated by electron microscopy of formaldehyde-denatured molecules. the length distributions of denatured circular and linear molecules were determined. both circular and linear molecules were found to be ... | 1977 | 269437 |
| synthesis of dna transcripts of potato spindle tuber viroid. | | 1977 | 67055 |
| the sequence of a viroid from grapevine closely related to severe isolates of citrus exocortis viroid. | the primary structure of a grapevine viroid (gvs) isolated in spain was determined. the sequence consisted of 369 nucleotide residues forming a circular molecule. gvs presented extensive homology with viroids of the potato spindle tuber viroid (pstv) group, that was specially high in the case of citrus exocortis viroid (cev) both with variants found in isolates inducing severe (92% with cev-a) and mild (89% with cev-de26) symptoms on tomato. the secondary structure proposed for gvs showed that t ... | 1987 | 2438653 |
| sequence analysis of five new field isolates demonstrates that the chain length of potato spindle tuber viroid (pstvd) is not strictly conserved but as variable as in other viroids. | the sequence analysis of five new field isolates of potato spindle tuber viroid (pstvd) of different virulence revealed that the length of their rna chain is not strictly conserved to 359 nucleotides (nts), as one could have inferred from the previously sequenced pstvd strains. it was now found that the chain length is strain-specific like in the case of practically all other viroids, and that it may vary, so far, between 356 and 360 nts. taking our previously sequenced and least virulent mild s ... | 1992 | 1623184 |
| analysis of the virulence modulating region of potato spindle tuber viroid (pstvd) by site-directed mutagenesis. | a series of nucleotide substitutions (g46----c; c47----a; c315----u; u317----c) were introduced into the virulence modulating region of the intermediate strain of potato spindle tuber viroid (pstvd) in order to examine their effect upon viroid infectivity and pathogenicity with the presence of all four mutations resulting in the sequence of a previously reported severe strain of pstvd. eight of the resulting mutant cdnas were characterized for infectivity and symptom induction in tomato, and the ... | 1992 | 1546460 |
| rna progeny of an infectious two-base deletion cdna mutant of potato spindle tuber viroid (pstv) acquire two nucleotides in planta. | deletion mutations were generated in four structural domains of a potato spindle tuber viroid (pstv) complementary dna (cdna) clone. deletions of 3 to 5 nucleotides at the central conserved domain (ccggg, positions 94 to 98), variable domain (gccg, positions 146 to 149) and pathogenicity domain (cga, positions 286 to 288) abolished infectivity of dimeric or trimeric cdna constructs, or their in vitro transcripts. by contrast, a clone (st4) with a deletion of two nucleotides (uu, positions 339 an ... | 1992 | 1546455 |
| coat protein properties suggest that azuki bean mosaic virus, blackeye cowpea mosaic virus, peanut stripe virus, and three isolates from soybean are all strains of the same potyvirus. | the interrelationship of a number of potyviruses infecting legumes has been investigated by comparing molecular properties of their coat proteins. comparison of the coat proteins by the techniques of amino acid analysis and page was inadequate to distinguish strains from distinct potyviruses. however, high-performance liquid chromatographic peptide profiles of tryptic digests of coat proteins of these legume-infecting potyviruses enabled such assignments to be made. these data indicate that amin ... | 1992 | 1500273 |
| nonradioactive, photobiotin-labelled dna probes for routine diagnosis of viroids in plant extracts. | avocado sunblotch viroid (asbv), coconut cadang cadang viroid (cccv), chrysanthemum stunt viroid (csv) and potato spindle tuber viroid (pstv) were detected in plant extracts by dot-blot hybridization using nonradioactive photobiotin-labelled nucleic acid probes. recombinant dna probes, containing full-length monomer viroid inserts in the plasmid vectors psp64 or puc9, were biotinylated with photobiotin and used as sonicated double-stranded dna fragments. using fresh leaf material, a general meth ... | 1989 | 2654169 |
| base-pair probability profiles of rna secondary structures. | dynamic programming algorithms are able to predict optimal and suboptimal secondary structures of rna. these suboptimal or alternative secondary structures are important for the biological function of rna. the distribution of secondary structures present in solution is governed by the thermodynamic equilibrium between the different structures. an algorithm is presented which approximates the total partition function by a boltzmann-weighted summation of optimal and suboptimal secondary structures ... | 1992 | 1498695 |
| strains of bean common mosaic virus consist of at least two distinct potyviruses. | bean common mosaic virus (bcmv) consists of a large number of pathotypes and strains which have largely been identified by their characteristic interactions with a selected number of differential bean cultivars. the relationships among these strains and other potyviruses that infect legumes are complex, with indications that bcmv, blackeye cowpea mosaic virus (blcmv) and azuki bean mosaic virus (azmv) may be strains of the one virus. using high performance liquid chromatographic peptide profiles ... | 1992 | 1450767 |
| a microscale procedure for isolating and sequencing the viroid rna present in one gram of infected leaf tissue. | a microscale procedure for the isolation and purification of viroid rna from one gram of viroid-infected leaf tissue and for its subsequent sequencing at the cdna level is described using potato spindle tuber viroid (pstv) as model system. total nucleic acids are phenol-extracted and salt-fractionated with 2 m licl. the viroid-containing fraction is then subjected to bidirectional polyacrylamide gel electrophoresis. this removes all co-fractionated cellular rnas from the circular viroid rna whic ... | 1989 | 2723017 |
| biotinylated rna probes for the detection of potato spindle tuber viroid (pstv) in plants. | diseases caused by potato spindle tuber viroid (pstv) are of significant agronomic importance, and early detection is vital. the objective of this paper was to synthesize biotinylated rna probes in order to develop a specific, sensitive, and reliable assay system for detection of pstv in infected plants. rna probes were prepared by in vitro transcription of cloned pstv, and were labelled with either biotin-11-utp or [32p]utp. partially purified total rnas from healthy and from pstv-infected plan ... | 1989 | 2723019 |
| serological and biological relationships among viruses in the bean common mosaic virus subgroup. | bean common mosaic virus (bcmv), blackeye cowpea mosaic virus (b1cmv), cowpea aphid-borne mosaic virus (cabmv), azuki bean mosaic virus (azmv), and peanut stripe virus (pstv) are five species of the genus potyvirus, family potyviridae which are seed-transmitted in beans or cowpeas. eighteen isolates of bcmv, five isolates of b1cmv, four isolates of cabmv, and one isolate each of azmv, and pstv were compared serologically using a panel of 13 monoclonal antibodies (mabs) raised against bcmv, b1cmv ... | 1992 | 1450766 |
| highly sensitive digoxigenin-labelled dna probe for the detection of potato spindle tuber viroid. | a molecular probe pspav6.2(+), with concatameric insert representing 6.2-times repeated copy of potato spindle tuber viroid (pstv) rna, was labelled with digoxigenin and used to detect pstv by dot-blot hybridization assay. the probe was highly sensitive and specific, detecting as little as 2.5 pg of pstv rna. both severe and mild pstv strains were detectable in 64-512-times diluted crude extracts from infected tomato leaves, and potato leaves, sprouts, and seeds. for extraction of plant tissue t ... | 1992 | 1430068 |
| [determination of potato spindle tumor viroid and chrysanthenum stund viroid using biotinylated olideoxyribonucleotides]. | a 26 base long oligodeoxyribonucleotide complementary to a common rna sequence of potato spindle tuber viroid (pstv) and chrysantemum stunt viroid (csv) was synthesized. the 3'-end biotinylated one was used for the detection of pstv and csv rna immobilized on nitrocellulose filters by nucleic acid hybridization. visualization of hybridization results was performed by two ways, either by streptavidin-alkaline phosphatase conjugate or streptavidine and biotinylated alkaline phosphatase. it was pos ... | 1992 | 1406609 |
| structural requirements for viroid processing by rnase t1. | viroids are replicated via a rolling circle-like mechanism in which (+) strand oligomeric intermediates have to be cleaved enzymatically to unit-length molecules followed by ligation to mature circles. a transcript of potato spindle tuber viroid, which is still infectious, consists of a monomeric molecule with only 22 additional nucleotides, thus doubling part of the central conserved region of viroids. it was shown that this transcript can be cleaved and ligated in vitro to circles by rnase t1. ... | 1992 | 1404386 |
| pear blister canker viroid is a member of the apple scar skin subgroup (apscaviroids) and also has sequence homology with viroids from other subgroups. | the sequence of pear blister canker viroid (pbcvd), the putative causal agent of pear blister canker (pbc) disease, has been determined. pbcvd consists of a single-stranded circular rna of 315 nucleotide residues which assumes a branched conformation when it is folded in the model of lowest free energy. pbcvd has highest sequence similarity with grapevine 1b viroid (52.4%), but also contains sequences related to regions present in viroids that belong to different subgroups, suggesting that pbcvd ... | 1992 | 1383394 |
| processing of linear longer-than-unit-length potato spindle tuber viroid rnas into infectious monomeric circular molecules by a g-specific endoribonuclease. | different cdna constructs were used for the in vitro synthesis of rna transcripts that contain a complete monomeric unit of the potato spindle tuber viroid (pstvd) plus an additional repeat of a part of the circular rna genome. these permutated linear longer-than-unit-length pstvd rnas were incubated with the g-specific endoribonuclease rnase t1 which generated monomeric circular pstvd rna molecules that were infectious when mechanically inoculated to tomato plants. besides the correct monomeric ... | 1992 | 1381536 |
| generation of viroid conformational isomers that are stable to incubation with magnesium ions and in a nuclear extract from tomato plants. | we identified conditions for heating and quick cooling viroid rnas in the presence of salt which lead to the production of conformational isomers stable to incubation for at least 45 minutes at 30 degrees in the presence of magnesium ions. elution in 0.3 m nacl allowed the purification of an electrophoretically slow form of an in vitro transcript carrying a complete copy of the potato spindle tuber viroid rna sequence. slow forms of this transcript and of kinase-labeled linear viroid rna persist ... | 1992 | 1282703 |
| towards an understanding of viroid nature and replication. | in leaf strips and in nuclei isolated from potato spindle tuber viroid (pstv)-infected tomato, incorporation of [3h]ump into pstv is shown to be inhibited by pre-treatment of the leaf-strips with actinomycin d. these results demonstrate that pstv is synthesized in the cell nucleus and that replication may occur from a dna template. | 1976 | 1275410 |
| 32p- and biotin-labelled in vitro transcribed crna probes for the detection of potato spindle tuber viroid and chrysanthemum stunt viroid. | replacing nick-translated dna probes by in vitro transcribed complementary rna (crna) probes considerably increased the sensitivity of dot-blot detection tests of potato spindle tuber viroid and chrysanthemum stunt viroid. as compared to the limit of detection of 5-10 pg of viroid obtained with 32p-labelled dna probes, crna probes allow the detection of less than 1 pg of pure viroid. when labelled with biotin by incorporation of biotin-labelled ribonucleotides, the crna probes have a limit of de ... | 1990 | 1691524 |
| ribonuclease t1 generates circular rna molecules from viroid-specific rna transcripts by cleavage and intramolecular ligation. | a 406 nucleotide long potato spindle tuber viroid (pstvd)-specific linear rna transcript was synthesized in vitro and subjected to limited digestion with ribonuclease (rnase) t1. under certain conditions this guanosine-specific endoribonuclease proved to be capable of processing the longer-than-unit-length, precursor-like viroid rna transcript by cleaving out a linear 358 nucleotide long product and ligating that to a circular rna molecule. the new finding that rnase t1 acts as an rna processing ... | 1991 | 1709278 |
| comparison of nonradioactive cdna probes for detection of potato spindle tuber viroid by dot-blot hybridization assay. | six nonradioactive cdna probes were compared for their sensitivities for detecting potato spindle tuber viroid (pstvd) by dot-blot hybridization assay. three biotinylated pstvd cdna probes, labeled by photoactivation with photobiotin, by nick translation or by random priming with biotinylated deoxyribonucleotides, were all capable of detecting 20 pg of purified pstvd by a colorimetric assay and 2-20 pg by a chemiluminescent assay. digoxigenin-labeled probe was able to detect 200 pg of purified p ... | 1991 | 1816253 |
| coat protein of potyviruses. 7. amino acid sequence of peanut stripe virus. | the amino acid sequence of the 287-residue coat protein of peanut stripe virus (pstv) was determined from the sequences of overlapping peptide fragments. results indicated that the amino terminus was blocked by an acetyl group, as has previously been found for the coat protein of johnsongrass mosaic potyvirus. comparison of the pstv sequence with coat proteins of 20 distinct potyviruses gave sequence identities of 47-57%, except for zucchini yellow mosaic virus (zymv), passionfruit woodiness vir ... | 1991 | 1863222 |
| the antigen of hepatitis delta virus: examination of in vitro rna-binding specificity. | the only known protein of hepatitis delta virus (hdv), the delta antigen, is found both within virus particles and within the nucleus of the infected cell, where it has one or more roles essential for rna genome replication. others have demonstrated that the antigen has the ability, in vitro, to specifically bind hdv rna species. we report a further examination of this phenomenon, using partially purified recombinant protein, expressed as a fusion with the staphylococcal protein a. from northwes ... | 1991 | 1906549 |
| formation of a thermodynamically metastable structure containing hairpin ii is critical for infectivity of potato spindle tuber viroid rna. | the functional relevance of a hairpin ii-containing structure of viroid rna was studied by site-directed mutagenesis, thermodynamic calculations, experimental denaturation curves and infectivity tests. hairpin ii is formed during thermal denaturation of circular viroids or as part of a metastable structure during synthesis of viroid replication intermediates. in potato spindle tuber viroid (pstvd), eight single-site mutations were generated in the segments which form hairpin ii. from the mutated ... | 1991 | 2001685 |
| development and application of a nonradioactive nucleic acid hybridization system for simultaneous detection of four potato pathogens. | cdna clones of potato virus x (pvxcp strain), potato virus y (pvyo strain), potato leaf roll virus (plrv) and potato spindle tuber viroid (pstv) were used separately or combined for the detection of the corresponding rnas in extracts of infected plants. a general method for the rapid preparation of rna extracts without use of organic solvents (i.e. phenol) was developed for this purpose. plant extracts from a range of field, artificially inoculated germplasm genotypes, micro-propagated and proto ... | 1991 | 2016393 |
| dot-blot procedure with [32p]dna probes for the sensitive detection of avocado sunblotch and other viroids in plants. | avocado sunblotch viroid (asbv) has been detected down to a level of about 20 pg per gram fresh weight of leaves by the use of a dot-blot hybridization procedure and partially purified nucleic acid extracts. three [32p]dna probes were compared, two prepared from full-length asbv clones in the single-strand m13mp93 vector and the other by primer extension on purified asbv. all three probes gave the same sensitivity of detection of asbv. the methods developed have also been used successfully for t ... | 1985 | 3980666 |
| detection of potato spindle tuber viroid (pstv) in dormant potato tubers by concatameric cdna probe. | the 32p-labelled concatameric insert cut out from a plasmid pspav6.2(+), containing 6.2 copies of a full-length pstv, was used to detect pstv in dormant potato tubers by dot-blot hybridisation assay. the concatameric insert probe was 4 times more sensitive than the monomeric one. this allowed the detection of 0.5 pg of viroid rna. the sensitivity makes th eoligomeric cdna probe a useful alternative to cdna probes. | 1990 | 2086594 |
| separation of the infectious ribonucleic acid of potato spindle tuber virus from double-stranded ribonucleic acid of plant tissue extracts. | the infectious ribonucleic acid (rna) of potato spindle tuber virus (pstv) can be separated by hydroxyapatite chromatography from double-stranded rna detectable in low amounts in both infected and uninfected plant tissue extracts. the chromatographic behavior of ribonuclease-sensitive pstv rna resembles that of transfer rna. | 1971 | 4332146 |
| potato spindle tuber viroid. xii. an investigation of viroid rna as a messenger for protein synthesis. | | 1974 | 4606921 |
| a new strain of potato spindle tuber viroid (pstvd-n) exhibits major sequence differences as compared to all other pstvd strains sequenced so far. | | 1990 | 2103469 |
| unusual properties of two branched rna's with circular and linear components. | irradiation with ultraviolet light was used to create two nonlinear rna molecules. circular potato spindle tuber viroid (pstv) rna was crosslinked at a single site to generate a figure eight-shaped molecule; 5s rrna from hela cells was transformed into an alpha-shaped molecule with a small circular element and two arms (1). crosslinked rna's could be separated from their untreated counterparts by electrophoresis in polyacrylamide gels containing urea. the gel mobility of crosslinked pstv was not ... | 1985 | 2410857 |
| a method for assessing the statistical significance of rna folding. | we have developed a statistical method that is designed for analyzing potential rna folded substructures. the statistical significance of rna folding is assessed by the segment score. the segment score is defined as the difference between the lowest free energy calculated for the real biological sequence and the mean of the lowest free energies from random permutations of the real segment sequence, divided by the standard deviation of the random sample. this procedure was applied to the well-stu ... | 1989 | 2480496 |
| imaging of viroids in nuclei from tomato leaf tissue by in situ hybridization and confocal laser scanning microscopy. | the intracellular localization of viroids has been investigated by viroid-specific in situ hybridization and analysis by digital microscopy of the distribution of the fluorescent hybridization signals. isolated nuclei from green leaf tissue of tomato plants infected with potato spindle tuber viroid (pstvd) were bound to microscope slides, fixed with formaldehyde and hybridized with biotinylated transcripts of cloned pstvd cdna. the bound probe was detected with lissamine--rhodamine conjugated st ... | 1989 | 2591366 |
| nucleotide sequence and proposed secondary structure of columnea latent viroid: a natural mosaic of viroid sequences. | the columnea latent viroid (clv) occurs latently in certain columnea erythrophae plants grown commercially. in potato and tomato, clv causes potato spindle tuber viroid (pstv)-like symptoms. its nucleotide sequence and proposed secondary structure reveal that clv consists of a single-stranded circular rna of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. the electrophoretic mobility of circular clv under nondenaturing condit ... | 1989 | 2602114 |
| characterisation of synthetic dna probe detecting potato spindle tuber viroid. | chemically synthesized dna fragments complementary to selected regions of the potato spindle tuber viroid (pstv) genome were cloned into escherichia coli plasmid puc9. one of the recombinant plasmids (pibb4) with a 87 bp insert representing the central region of the pstv genome (nucleotides 88 to 174) was used after labelling by nick translation for detecting pstv by dot-blot hybridization. the molecular probe was almost as sensitive as the one carrying the full genomic pstv copy (pav401), detec ... | 1989 | 2668314 |
| potato spindle tuber viroid. v. failure of immunological tests to disclose double-stranded rna or rna-dna hybrids. | | 1971 | 5166353 |
| interactions between citrus exocortis and potato spindle tuber viroids in plants of gynura aurantiaca and lycopersicon esculentum. | plants of gynura aurantiaca and tomato (lycopersicon esculentum) were inoculated with severe strains of citrus exocortis viroid (cev) and potato spindle tuber viroid (pstv). the progeny of both viroids was analyzed by two systems of page which allowed discrimination between cev and pstv on the basis of their different sizes. when inoculated separately to g. aurantiaca cev and pstv induced severe and very mild symptoms, respectively, with cev accumulating to a higher level than pstv, whereas when ... | 1989 | 2722468 |
| infectivity of chimeric viroid transcripts reveals the presence of alternative processing sites in potato spindle tuber viroid. | in an investigation of viroid replication and pathogenesis, we have assessed the effect of sequence duplication of the upper central conserved region (ccr) of the molecule on the infectivity of rnas transcribed in vitro from partial dimers of wild-type and mutant viroid cdnas. in one set of experiments, the relative infectivities of one monomeric potato spindle tuber viroid (pstv) and five oligomeric sp6 transcripts [pstv or pstv-tasv (tomato apical stunt viroid) chimeras] were compared. with on ... | 1989 | 2728347 |
| molecular cloning of potato spindle tuber viroid (pstv) cdna synthesized by enzymatic elongation of pstv-specific dna primers: a general strategy for viroid cloning. | different cdnas were synthesized by primer extension from the rna of the severe strain kf 440 of potato spindle tuber viroid (pstv) with the aid of reverse transcriptase using three pstv-specific dna molecules as primers. the cdnas were made double-stranded and cloned into plasmid pbr 322. various overlapping subgenomic dna fragments were prepared from these clones and recombined in two different ways. in both cases a pstv dna copy was obtained which represented the entire pstv rna genome. the s ... | 1985 | 2985143 |
| use of [32p]rna probes for the dot-hybridization detection of potato spindle tuber viroid. | a dot-hybridization assay using 32p-labelled rna probes (+rna and crna) transcribed from potato spindle tuber viroid (pstv) cdna was described. a complete cdna copy of pstv, originally cloned in pbr 322 (pav 401) was subcloned in the bamhi site of a 'riboprobe' cloning vectors psp 64 and psp 65 in opposite orientations. the reconstructed plasmids were designated pdx 1 and pdx 4, respectively. transcription of pdx 1 and pdx 4 plasmids by sp6 rna polymerase resulted in the generation of pstv-speci ... | 1986 | 3025243 |
| purified scrapie prions resist inactivation by uv irradiation. | the development of effective purification protocols has permitted evaluation of the resistance of isolated scrapie prions to inactivation by uv irradiation at 254 nm. prions were irradiated on ice with doses of uv light ranging up to 120,000 j/m2. uv dosimetry experiments, performed with saccharomyces cerevisiae plasmid dna or eucaryotic cells, indicated that under these experimental conditions an incident uv dose of 10 j/m2 formed 2 thymine dimers per 5.1 x 10(6) daltons of eucaryotic cell dna. ... | 1987 | 3097336 |
| purified scrapie prions resist inactivation by procedures that hydrolyze, modify, or shear nucleic acids. | prions were purified from scrapie-infected hamster brains and incubated for 24 hr at 65 degrees with 2 mm zn2+ or 5 mm mg2+; no loss of infectivity was observed. bacteriophage m13, tobacco mosaic virus (tmv), potato virus x, and potato spindle tuber viroid were all inactivated by divalent metal ions under these conditions. prions also resisted inactivation by prolonged digestions with dnase i, rnases a and t1, and micrococcal nuclease. prions were resistant to psoralen photoadduct formation usin ... | 1987 | 3114950 |
| a novel aspect of the information content of viroids. | viroids were found to exhibit a structural periodicity characterized by repeat units of a length of 11 or 12 (potato spindle tuber viroid group and coconut cadang-cadang viroid), 60 (apple scar skin viroid) and 80 (avocado sunblotch viroid) nucleotide residues, respectively. it is suggested that structural periodicity of viroids is an indication of their protein-binding ability. | 1988 | 3167064 |
| coconut tinangaja viroid: sequence homology with coconut cadang-cadang viroid and other potato spindle tuber viroid related rnas. | the nucleotide sequence of two variants of coconut tinangaja viroid (ctiv) were obtained. both sequence variants are 254 nucleotide residues in size but differ in sequence at two positions. in comparisons with other viroids, the sequences and proposed secondary structure of ctiv show most homology with the 246 nucleotide residue variant of coconut cadang-cadang viroid (cccv (246]. several regions throughout the rod-like molecules of ctiv show significant structural and sequence homology with oth ... | 1988 | 3341120 |
| grapevine yellow speckle viroid: structural features of a new viroid group. | a single stranded circular rna was isolated from grapevines infected with yellow speckle disease. the rna which we have called grapevine yellow speckle viroid (gysv), contains 367 nucleotide residues and has the potential to form the rod-like secondary structure characteristic of viroids. gysv has 37% sequence homology with the recently described apple scar skin viroid (assv; 330 residues) and has some sequence homology with the viroids in the potato spindle tuber viroid (pstv) group. the sequen ... | 1988 | 3344221 |
| interference between coinoculated viroids. | experiments were carried out to seek evidence of an interaction between two viroid rnas introduced to tomato plants in the same inoculum. at the level of symptom expression, the severe isolate of potato spindle tuber viroid (pstv) dominated the mild isolate. seventy-five percent of the plants inoculated with a 100-fold excess of the mild isolate developed unattenuated symptoms of severe disease. other experiments revealed that infectious rna molecules transcribed from cloned dna templates contai ... | 1988 | 3354205 |
| synthetic oligonucleotide hybridization probes to diagnose hop stunt viroid strains and citrus exocortis viroid. | four species of synthetic oligonucleotide probes for the diagnosis of hop stunt viroid (hsv) and citrus exocortis viroid (cev) were devised. probe hsv-1 detected all the members of hsv group, such as hsv-hop, hsv-grapevine, hsv-cucumber, hsv-citrus and a viroid-like rna isolated from plum trees affected by plum dapple fruit disease. probe hsv-2 discriminated hsv-grapevine from the other members of hsv group. hsv-hop and hsv-grapevine consist of the same numbers of nucleotides, with only one nucl ... | 1988 | 3366851 |
| viroid rna is accepted as a template for in vitro transcription by dna-dependent dna polymerase i and rna polymerase from escherichia coli. | the rna genome of potato spindle tuber viroid (pstv) is transcribed in vitro into complementary dna and rna by dna-dependent dna polymerase i and rna polymerase, respectively, from escherichia coli. in vitro synthesis of complementary rna produces distinct transcripts larger than unit length thus reflecting the in vivo mechanism of viroid replication. the influence of varying experimental conditions on the transcription process is studied; actinomycin d is found to drastically reduce complementa ... | 1982 | 6760914 |
| viroids and prions. | viroids are small "naked" infectious rna molecules that are pathogens of higher plants. the potato spindle tuber viroid (pstv) is composed of a covalently closed circular rna molecule containing 359 ribonucleotides. the properties of pstv were compared with those of the scrapie agent, which causes a degenerative neurological disease in animals. pstv was inactivated by ribonuclease digestion, psoralen photoadduct formation, zn2+ -catalyzed hydrolysis, and chemical modification with nh2oh. the scr ... | 1982 | 6813855 |
| viroids and virusoids are related to group i introns. | group i introns are found in nuclear rrna genes, mitochondrial mrna and rrna genes, and chloroplast trna genes. the hallmarks of this intron class are a 16-nucleotide consensus sequence and three sets of complementary sequences. the viroids (circular pathogenic plant rnas) and the virusoids (plant satellite rnas) also contain the consensus sequence and the three sets of complementary bases. pairing of the complementary bases would generate a viroid structure resembling a group i intron, which mi ... | 1986 | 3462692 |
| nucleotide sequence and secondary structure of apple scar skin viroid. | the complete nucleotide sequence of apple scar skin viroid(assv) has been established, and a probable secondary structure is proposed. a single-stranded circular assv rna consists of 330 nucleotides and can assume the rodlike conformation with extensive base-pairing characteristic of all the known viroids. assv shows low sequence homologies with other viroids and lacks the central conserved region. these indicate that assv should be allocated to a separate viroid group. however, homologous seque ... | 1987 | 3658673 |
| structure of viroid replicative intermediates: physico-chemical studies on sp6 transcripts of cloned oligomeric potato spindle tuber viroid. | the structure and structural transitions of transcripts of cloned oligomeric viroid were studied in physico-chemical experiments and stability calculations. transcripts of (+) and (-) polarity, from unit up to sixfold length, were synthesized from dna clones of the potato spindle tuber viroid (pstv) with the sp6 transcription system. their structural properties were investigated by optical denaturation curves, high performance liquid chromatography (hplc), electron microscopy, sedimentation-diff ... | 1986 | 3808953 |
| ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and hela 5s rna. | the positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid rna and hela 5s rrna. crosslinking in each of these molecules occurred at a single major site, which was located by rna fingerprinting and secondary analysis (and additional primer extension studies in the case of the viroid). various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to the ... | 1985 | 3863116 |
| complexes of viroids with histones and other proteins. | complexes of potato spindle tuber viroid (pstv) with nuclear proteins have been studied by in vitro reconstitution of the complexes and by isolation and characterization of in vivo complexes under non-dissociating conditions. for in vitro reconstitution, nuclear proteins were separated by sds-gel-electrophoresis, renatured and blotted onto nitrocellulose filters, and incubated with viroid. the viroid-protein complexes were crosslinked covalently, and the viroid containing protein bands were dete ... | 1985 | 3889835 |
| synthesis of (+) and (-) rna molecules of potato spindle tuber viroid (pstv) in isolated nuclei and its impairment by transcription inhibitors. | transcription studies with highly purified potato cell nuclei in combination with a 'transcription-hybridization analysis' unequivocally demonstrate that the nucleus is the subcellular site where the entire process of pstv replication takes place. inhibition experiments with actinomycin d and alpha-amanitin furthermore suggest that the nuclear dna-dependent rna polymerases i and ii are involved in the synthesis of pstv (+) and (-) rna, respectively. | 1985 | 4016225 |
| potato spindle tuber viroid. 8. correlation of infectivity with a uv-absorbing component and thermal denaturation properties of the rna. | | 1972 | 4636118 |
| the 7s rna from tomato leaf tissue resembles a signal recognition particle rna and exhibits a remarkable sequence complementarity to viroids. | from tomato leaf tissue we sequenced and characterized a 7s rna which consists of 299 nucleotides with either two or three additional uridine nucleotides at its 3'-terminus. about 56% of the nucleotides of this higher plant 7s rna are in nearly identical positions as those of the human 7sl rna which is an integral component of the signal recognition particle (srp) that mediates protein translocation. computer modelling and digestion studies with nucleases led to a secondary structure model for t ... | 1988 | 2468486 |
| potato spindle tuber viroid. xi. a comparison of the ultraviolet light sensitivities of pstv, tobacco ringspot virus, and its satellite. | | 1974 | 4817076 |
| potato spindle tuber viroid. vii. susceptibility of several solanaceous plant species to infection with low molecular-weight rna. | | 1972 | 5031507 |
| potato spindle tuber viroid. vi. monodisperse distribution after electrophoresis in 20 per cent polyacrylamide gels. | | 1971 | 5130125 |
| potato spindle tuber virus: a plant virus with properties of a free nucleic acid. 3. subcellular location of pstv-rna and the question of whether virions exist in extracts or in situ. | | 1971 | 5543290 |
| specifically primed synthesis in vitro of full-length dna complementary to potato-spindle-tuber viroid. | potato spindle tuber viroid (pstv) rna is transcribed in vitro by reverse transcriptase into complementary dna in the presence of synthetic oligodeoxyribonucleotides as primers. in the case of priming with the pentadecadeoxyribonucleotide d(t-t-c-t-t-t-t-t-t-c-t-t-t-t-c) complementary to pstv rna from nucleotides 49 to 63, specificity of transcription initiation allows rapid sequencing of part of the viroid genome using chain-terminating dideoxyribonucleoside triphosphates. the dna transcripts o ... | 1981 | 6169524 |
| sequence homology between potato spindle tuber viroid and u3b snrna. | sequence homology was found by computer analysis between potato spindle tuber viroid (pstv) rna and u3b snrna of novikoff hepatoma cells. this homology is colinear in arrangement, extends in length to 81% of the entire u3b snrna molecule and is involved in the pstv molecule unique sites which, if depicted in terms of the secondary structure of the circular pstv molecule, reveal a conspicuous regularity in their location. a strong relation in primary structure between pstv and u3b snrna is demons ... | 1983 | 6196230 |
| a severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only. | fingerprint analyses of two potato spindle tuber viroid (pstv) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the rnase t1 and rnase a fingerprints. the complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides caaaaaag, cuuuuucucuaucuuacuug, and aaaaaaggac in the 'severe' strain are replaced by caauaag, cuuuuucucuaucuuucu ... | 1981 | 6271277 |
| nuclear dna from uninfected or potato spindle tuber viroid-infected tomato plants contains no detectable sequences complementary to cloned double-stranded viroid cdna. | high molecular weight tomato nuclear dna was isolated from uninfected and potato spindle tuber viroid (pstv)-infected tomato leaves. restriction digests were fractionated on agarose gels, denatured and transferred to diazobenzyloxymethylpaper, and hybridized to 32p-labeled cloned double-stranded pstv cdna. no hybridization to dna from either uninfected or infected tissue could be detected under conditions that permitted detection of cloned double-stranded pstv cdna at a concentration equivalent ... | 1981 | 6273895 |
| structural similarities between viroids and transposable genetic elements. | the primary structures of the tomato planta macho and tomato apical stunt viroids have been determined, and probable secondary structures are proposed. both viroids can assume the rodlike conformation with extensive base-pairing characteristic of all known viroids. sequence homologies between the two viroids (75%) and with members of the potato spindle tuber viroid group (73-83%) indicate that they both belong to this group. comparative sequence analysis of all members of the group reveals strik ... | 1983 | 6312450 |
| construction of infectious potato spindle tuber viroid cdna clones. | contiguous restriction fragments from two cloned partial-length potato spindle tuber viroid (pstv) cdnas were used to construct recombinant dnas containing full-length monomeric and dimeric pstv cdna. when five different pstv cdna plasmids and rna isolated from e. coli cells harboring these plasmids were tested for infectivity on tomato, plasmid dnas containing pstv cdna dimers were infectious. rna transcripts containing the sequence of pstv from these plasmids were also infectious. the sequence ... | 1983 | 6314259 |
| viroid replication: equilibrium association constant and comparative activity measurements for the viroid-polymerase interaction. | the binding and replication of purified potato spindle tuber viroid (pstv) by dna-dependent rna polymerase ii from wheat germ was studied in analytical ultracentrifugation experiments and in vitro transcription assays. the equilibrium association constant for the viroid-polymerase interaction is 1.9 x 10(7) m-1. both ultraviolet and fluorescent monitoring during the sedimentation experiments showed two distinguishable viroid-polymerase complexes. these are interpreted as resulting from a 1:1 and ... | 1984 | 6473106 |
| multimeric non-radioactive crna probes improve detection of potato spindle tuber viroid (pstvd). | experimental data showed that multimeric, complementary rna (crna) probes, labelled with non-radioactive digoxigenin (dig), improved sensitivity of detection of the potato spindle tuber viroid (pstvd) rna by 2- to 30-fold as compared with corresponding multimeric cdna probes. the degree of pstvd detectability improvement depended upon the type of alkaline phosphatase substrate (colorimetric vs. chemiluminescent) used. use of hexameric dig-labelled crna probes in combination with chemiluminescent ... | 1994 | 7822462 |
| cloning of the capsid protein gene from a blotch isolate of peanut stripe virus. | the 3' terminal 1,367 nucleotides (nts) of a blotch isolate of the potyvirus, peanut stripe virus (pstv), were cloned and sequenced. this region included the 861 nts (287 amino acids) of the pstv capsid protein (cp). the amino acid sequence of the predicted proteinase cleavage site was identified. this region shared limited homology with other potyvirus proteinase cleavage sites. the viral cp gene sequence was followed by 254 nucleotides of 3' nontranslated sequence and a poly-a tail. based on c ... | 1993 | 7916587 |
| purification and partial characterization of the major "pathogenesis-related" tomato leaf protein p14 from potato spindle tuber viroid (pstv)-infected tomato leaves. | the acid-extractable leaf proteins of potato spindle tuber viroid (pstv) infected tomato plants were analysed electrophoretically on polyacrylamide gels. the most prominent alteration found during disease development was the appearance of a "pathogenesis-related" protein with an apparent molecular weight of 14,000 (called p14) which is drastically increased in concentration. its induction, however, is not viroid-specific because it is also accumulating after viral and fungal infections. the degr ... | 1984 | 6477130 |
| analysis of the population structure of three phenotypically different pstvd isolates. | phenotypically dissimilar greenhouse isolates from a polish collection of potato spindle tuber viroid (pstvd) were analysed. partially purified pstvd genomic rnas from severe, intermediate and mild isolates was reverse transcribed and the resulting cdnas enzymatically amplified. abutting-primer pcr (ab-p pcr) technology was used to obtain, in a single step, infectious full-length pstvd cdna monomers and these were sequenced. the mild isolate was found to be composed of a unique molecular variant ... | 1994 | 7998831 |
| detection of avocado sunblotch viroid in chloroplasts of avocado leaves by in situ hybridization. | in situ hybridization experiments were carried out to detect avocado sunblotch viroid (asbvd) in foliar tissue of avocado, using a digoxigenin-labelled rna probe complementary to the asbvd-rna in sections of aldehyde-fixed, lrgold-embedded leaf samples. detection of the probe was made through anti-digoxigenin antibody and protein-a colloidal gold (20 nm). seventy to 80% of the signals came from chloroplast while the cytoplasm and vacuole were labelled with ca. 10% of the gold particles. this is ... | 1994 | 7998844 |
| cloned single- and double-stranded dna copies of potato spindle tuber viroid (pstv) rna and co-inoculated subgenomic dna fragments are infectious. | a set of monomeric and oligomeric potato spindle tuber viroid (pstv) specific dna forms representing complete dna copies of the circular pstv rna genome were constructed and cloned in plasmid pbr322 and bacteriophage m13. both single- and double-stranded pstv dnas are capable of initiating viroid replication in mechanically inoculated tomato plants where it normally proceeds via the rna-rna pathway without dna being involved. all dimeric and higher multimeric forms were infectious irrespective o ... | 1984 | 6549294 |
| cowpea aphid borne mosaic virus-morocco and south african passiflora virus are strains of the same potyvirus. | high performance liquid chromatography (hplc) profiles of tryptic peptides and partial amino acid sequence analysis have been employed to establish the taxonomic status of the moroccan isolate of cowpea aphid-borne mosaic virus (cabmv). some previous reports have suggested cabmv to be very closely related to blackeye cowpea mosaic virus (b1cmv) while other reports have concluded that this relationship is distant. in this report a tryptic digest of the coat protein of cabmv-morocco was compared w ... | 1994 | 8002788 |
| oligomeric forms of potato spindle tuber viroid (pstv) and of its complementary rna are present in nuclei isolated from viroid-infected potato cells. | different oligomeric forms of pstv are detected in nuclei isolated from pstv-infected potato cells by means of molecular hybridization, using as probes synthetic oligodeoxyribonucleotides with sequence specificity for (+)pstv and for (-)pstv. in addition to several species of longer-than-unit-length (-)pstv molecules, two oligomeric forms of (+)pstv are detected, which correspond in size to rna strands of approximately two and three times viroid unit-length. they must be considered as the precur ... | 1983 | 6626709 |
| analysis of acid-extractable tomato leaf proteins after infection with a viroid, two viruses and a fungus and partial purification of the "pathogenesis-related" protein p 14. | gel electrophoretic analysis revealed marked alterations in the pattern of acid-extractable proteins from tomato leaves after infection with a viroid (pstv), two viruses [tobacco mosaic virus (tmv) and cucumber mosaic virus (cmv)], and a fungus (cladosporium fulvum) when compared to the pattern from healthy leaves. a pathogen-specific appearance of new protein bands was only found after infection with tmv (mw 17,400 and 65,000), cmv (mw 9000 and 8000) and cladosporium fulvum (mw 28,000). with th ... | 1982 | 6891893 |
| in vitro transcription of viroid rna into full-length copies by rna-dependent rna polymerase from healthy tomato leaf tissue. | rna-dependent rna polymerase from healthy tomato plant tissue accepts potato spindle tuber viroid (pstv) rna as a template for the in vitro synthesis of full-length rna copies of the pstv genome. viroid transcription requires the presence of mn2+ and /or mg2+ ions and is not inhibited by concentrations of 10(-5) m alpha-amanitin. this is the first report of a well-defined product synthesized in vitro by an rna-dependent rna polymerase from healthy plants. | 1982 | 6896006 |
| molecular cloning and characterization of a complete dna copy of potato spindle tuber viroid rna. | double-stranded cdna has been synthesized from rna of a severe strain of potato spindle tuber viroid using a synthetic oligodeoxyribonucleotide as a primer. upon cloning in bacteriophage m13mp9, two recombinant phages were selected to construct a pbr322-derived plasmid containing a complete viroid dna copy. elucidation of the nucleotide sequence revealed four differences with the previously established sequence of another pstv strain, three of which were base exchanges and one a deletion. | 1982 | 6897677 |
| nucleotide sequence and secondary structure of citrus exocortis and chrysanthemum stunt viroid. | the complete nucleotide sequence of citrus exocortis viroid (cev, propagated in gymura) and chrysanthemum stunt viroid (csv, propagated in cineraria) has been established, using labelling in vitro and direct rna sequencing methods and a new screening procedure for the rapid selection of suitable rna fragments from limited digests. the covalently closed circular single-stranded viroid rnas consist of 371 (cev) and 354 (csv) nucleotides, respectively. as previously shown for potato spindle tuber v ... | 1982 | 7060550 |
| chemiluminescent detection of potato and pome fruit viroids by digoxigenin-labeled dot blot and tissue blot hybridization. | a chemiluminescent molecular hybridization protocol was compared to 32p autoradiography for detecting potato spindle tuber viroid (pstvd) and apple scar skin group viroids (assvd). labeled crna probes for pstvd and assvd were synthesized by sp6 rna polymerase transcription using digoxigenin-11-utp or alpha-[32p]utp. dot blot hybridization of purified viroids and sap extracts from infected plants showed that chemiluminescent detection using digoxigenin-labeled probes was as sensitive as autoradio ... | 1993 | 8366166 |
| stiffness of viroids and viroid-like rna in solution. | the sedimentation coefficients of the potato spindle tuber viroid, four viroid-like rnas from cadang-cadang-disease, circular rna from velvet tobacco mottle virus, circular rna from solanum nodiflorum mottle virus and double stranded rna5 from cucumber mosaic virus were measured in the analytical ultracentrifuge. the numbers of nucleotides of the rna species varied between 246 and 670. the hydrodynamic models of rigid rods and flexible cylinders were applied for the interpretation of the sedimen ... | 1982 | 7145708 |