| coordinate control of collagen synthesis and cell growth in chick embryo fibroblasts and the effect of viral transformation on collagen synthesis. | using collagenase digestion as an assay for collagen in partially synchronized secondary cultures of chick embryo fibroblasts, we find that the rate of collagen synthesis remains at a constant fraction of overall protein synthesis (5%) regardless of the growth rate of the cells even when the rate of protein synthesis is accelerated 5-fold by adding serum and altering the ph of the culture medium. however, in cells oncogenically transformed by rous sarcoma virus, the relative rate of collagen syn ... | 1977 | 19483 |
| cytoplasmic vacuoles of rous virus transformed cells are organelles involved in cation uptake. | cytoplasmic vacuoles induced during transformation of cells by bryan strain rous sarcoma virus (rsv-bh) have been studied using the cationic dye, neutral red(nr). both the rate of uptake and the accumulation of nr are greater in rsv-bh transformed cells than non-transformed cells however, uptake was greater in vacuolated than in non-vacuolated cells, whether or not they were transformed. the nr was incorporated into pre-existing vacuoles in the absence of cytoplasmic staining, suggesting the exi ... | 1978 | 24677 |
| effects of acidified fetal bovine serum on the fibrinolytic activity and growth of cells in culture. | the fibrinolytic activity of cells in culture varied with the type of serum employed in the growth medium. degradation of iodinated fibrin occurred slowly when rous sarcoma virus-transformed chick embryo fibroblasts were grown in medium containing fetal bovine serum (fbs), and rapidly when chicken serum was employed. this difference reflected the low plasminogen and high inhibitor content of fbs. the inhibitors were found to be serum macromolecules that were precipitated with ammonium sulfate or ... | 1978 | 27528 |
| characterization of rna polymerases from rous sarcoma virus-induced mouse ascites sarcoma cells. | rna polymerase was extracted from the schmidt-ruppin strain of rous sarcoma virus (sr-rsv)-induced c3h/he mouse ascites sarcoma cells (sr-c3h). rna polymerase was separated into rna polymerases i and ii by deae-sephadex chromatography. rna polymerase i was separated into ia and ib fractions by phospho-cellulose chromatography. in sr-c3h cells rna polymerase ib was the main component of rna polymerase i. at 0.05--0.1 m ammonium sulphate rna polymerase i transcribed native dna most actively, and r ... | 1979 | 38635 |
| studies on reverse transcriptase of rna tumor viruses. i. localization of thermolabile dna polymerase and rnase h activities on one polypeptide. | purified reverse transcriptase from avian myeloblastosis virus or rous sarcoma virus consists of two subunits of average mol wt of 100,000 and 60,000. the lower-molecular-weight subunit, alpha, has been isolated from avian myeloblastosis virus, rous sarcoma virus and a temperature-sensitive mutant of rous sarcoma virus, la337. subunit alpha manifests both the dna polymerase and rnase h activities associated with purified reverse transcriptase of avian rna tumor viruses. the thermal inactivation ... | 1975 | 46281 |
| rna-dependent dna polymerase activity of rna tumor viruses. v. rous sarcoma virus single-stranded rna-dna covalent hybrids in infected chicken embryo fibroblast cells. | rna-dna covalent hybrids containing viral rna have been isolated from nuclear fractions of rous sarcoma virus-infected chicken embryo fibroblast cells shortly after virus infection. the formation of covalent hybrid structures depends upon a functional reverse transcriptase in vivo, since its appearance in cells is temperature dependent when infected with rous sarcoma virus mutant la335, which contains a temperature-sensitive reverse transcriptase. | 1975 | 46286 |
| a replication defective mutant of rous sarcoma virus which fails to make a functional reverse transcriptase. | | 1975 | 46651 |
| oxime derivatives of erythromycin: inhibitors of rous sarcoma virus reverse transcriptase activity and focus formation. | 9-o-methyloximd erythromycin a and its analogue inhibited reverse transcriptase and blocked focus formation of rous sarcoma virus. these chemicals inhibited neither dna-dependent dna polymerase nor dna-dependent rna polymerase from bacterial sources. however, they inhibited reverse transcriptase with an apparently differnt mechanism than that by rifamycin abdp. | 1975 | 47382 |
| rna-directed dna synthesis by the dna polymerase of rous sarcoma virus: structural and functional identification of 4s primer rna in uninfected cells. | the rna-directed dna polymerase of rous sarcoma virus requires a 4s rna molecule as primer for the initiation of dna synthesis on the viral 70s rna genome. we have now functionally identified primer activity in uninfected cells on the basis of the capacity of cellular 4s rna to actively participate in the initiation of dna synthesis by the rna-directed dna polymerase of rous sarcoma virus in vitro. this was accomplished by reconstitution experiments in which 4s rna from uninfected avian cells wa ... | 1975 | 48251 |
| quantitation of avian rna tumor virus reverse transcriptase by radioimmunoassay. | a radioimmunoassay was developed that can detect and quantitate 3 ng or more of the avian rna tumor virus reverse transcriptase. the assay detected no antigenic sites in rous sarcoma virus alpha virions or in virions of a murine rna tumor virus. about 70 molecules of reverse transcriptase were found per virion of avian myleloblastosis virus with this assay or with an assay based on antibody inhibition of enzymatic activity. the assay detected about 270 ng of enzyme per mg of cell protein in viru ... | 1975 | 48558 |
| bleomycin: action on growth of oncogenic rna viruses and on cell transformation. | bleomycin (blm) inhibits cell proliferation of noninfected chick embryo fibroblasts by blocking their dna synthesis selectively. chick embryo fibroblasts have beentransformed by schmidt-ruppin d strain of rous sarcoma virus. transformation has been determined by a focus assay. foci formation is strongly reduced by blm. virus replication is inhibited by blm in growing and confluent monolayer cells. this result might be explained by the observation that this drug reduces proliferation of growing a ... | 1975 | 50058 |
| detection and characterization of rna tumor virus-specific dna in cells. | rna tumor virus-specific dna in cells can be detected by its capacity to 1) alter the reassociation kinetics of labeled double-stranded product of viral rna-directed dna polymerase; 2) anneal single-stranded dna (cdna) synthesized by viral polymerase; or 3) hybridize labeled viral 70s (genomic) rna. duplexes formed with these procedures can be analyzed for fidelity of base pairing, and the integration of viral dna into the host genome can be established with a simple but stringent technique. we ... | 1975 | 51630 |
| transcription of the rous sarcoma virus genome in vitro and in vivo. | rna-directed dna synthesis by detergent-disrupted virions of rous sarcoma virus (rsv) initiates by the covalent attachment of pda to the 3'-terminal ra of a 4s rna hydrogen-bonded to the 70s rna template. this 4s "primer" has structural features of trna and can be aminoacylated with methionine. synthesis and integration of provirus dna can be monitored in both permissive (duck) and nonpermissive (mouse) cells acutely infected with rsv. the results of these studies, as well as data obtained with ... | 1975 | 51635 |
| rna-directed dna polymerase activity of reticuloendotheliosis virus: characterization of the endogenous and exogenous reactions. | reticuloendotheliosis virus (rev) contains an endogenously instructed, rna-directed dna polymerase activity. both the endogenous and exogenous dna polymerase activities exhibited up to 10-fold greater activity at the optimum concentration of manganous ion (0.025 mm for exogenous; 0.25 mm for endogenous) than at any concentration of magnesium ion. antiserum to the dna polymerase of an rev group virus (spleen necrosis virus) inhibited both endogenous and exogenous dna polymerase activity of rev, w ... | 1975 | 51935 |
| concentration of rous sarcoma virus from tissue culture fluids with polyethylene glycol. | concentration of rous sarcoma virus from tissue culture fluids with polyethylene glycol, with and without nacl or dextran sulfate, resulted in significant and highly variable losses caused by entrapment of virus particles in proteinaceous debris. treatment of concentrated preparations with pronase greatly enhanced the recovery of virions. maximum recovery of virus particles was obtained by the addition of 8% polyethylene glycol and 0.4 m nacl to tissue culture fluids, followed by pronase treatme ... | 1975 | 52343 |
| in vitro transcription of dna from the 70s rna of rous sarcoma virus: identification and characterization of various size classes of dna transcripts. | dna transcripts, ranging from 1,500 to 4,500 nucleotides in length, can be identified in the dna product synthesized in vitro by the rous sarcoma virus-associated rna-directed dna polymerase. although these dna transcripts are considerably larger than the size classes of the dna product previously reported, they only represent a minor proportion (less than 5%) of the total dna synthesized in standard reaction mixtures containing rate-limiting concentration of one of the four deoxynucleoside trip ... | 1975 | 52725 |
| protein kinase and its regulatory effect on reverse transcriptase activity of rous sarcoma virus. | we have studied the effect of protein phosphokinase (ec 2.7.1.37; atp:protein phosphotransferase) and phosphoprotein phosphatase (ec 3.1.3.16; phosphoprotein phosphohydrolase) on reverse transcriptase (rna-dependent dna nucleotidyltransferase) activity of rous sarcoma virus. protein kinase from rous sarcoma virus-transformed chick embryo fibroblasts was purified by deae-cellulose chromatography, sephadex gel filtration, and isoelectric focusing. purified reverse transcriptase from rouse sarcoma ... | 1975 | 52872 |
| mode of inhibition of herpes simplex virus dna polymerase by phosphonoacetate. | phosphonoacetate is a highly specific inhibitor of herpes simplex virus-induced dna polymerase. sensitivity of herpesvirus type 1 or type 2 induced dna polymerase to the drug was similar. however, dna polymerases from other sources such as the host cells (wi-38), micrococcus luteus, and hepatitis b virus were highly resistant. in addition, escherichia coli rna polymerase and reverse transcriptase of rous sarcoma virus were also insensitive to the drug. enzyme kinetic studies showed that inhibiti ... | 1975 | 53071 |
| transformation of cells by rous sarcoma virus: cytoplasmic vacuolization. | chick embryo cells transformed by the bryan "high titer" strain of rous sarcoma virus (rsv-bh) are heavily vacuolated. a variety of microscopic techniques have been used demonstrating that the vacuoles are cytoplasmic, bounded by membrane, and are composed largely of water. proteins, lipids, glycoproteins, glycolipids, glycosaminoglycans, glycogen, and nucleic acids were undetectable in the vacuoles. physiological requirements for development of the vacuoles, and reversal of vacuolization, were ... | 1976 | 54359 |
| in vitro transcription of 70s rna by the rna-directed dna polymerase of rouse sarcoma virus: lack of influence of rnase h. | the influence of rous sarcoma virus (rsv)-associated rnase h on the in vitro synthesis of dna by the rsv rna-directed dna polymerase was determined under conditions whereby rnase h activity was selectively inhibited with naf. not only were we unable to detect any effect on the size, structure, or genetic complixity of the dna product synthesized in the absence of rnase h activity, but the displacement of dna from the 70s rna:dna hybrid structures was also unaffected. the suitability of 70s rna:d ... | 1975 | 54443 |
| on the fidelity of dna replication. enzyme activities associated with dna polymerases from rna tumor viruses. | dna polymerase from rna tumor viruses ("reverse transcriptase") has been analyzed for activities which have been associated with other dna polymerases. homogeneous dna polymerase from avian myeoblastosis virus catalyzes pyrophosphate exchange and pyrophosphorolysis. pyrophosphate exchange is dependent on a template and is base-specific. with avian myeloblastosis virus dna polymerase, ribonucleotide templates are more efficient for synthesis while deoxyribonucleotide templates are more effective ... | 1976 | 55414 |
| in vivo host immune to a tumor-specific transplantation antigen induced by rous sarcoma virus. | we examined the host immune response to a tumor-specific transplantation antigen (tsta) induced by rous sarcoma virus (rsv) in vivo. in contrast to previous in vitro studies, the present investigation demonstrated in vivo host immunity of the tsta 10-55 days after tumor inoculation. immunity to the tsta appeared specific, since the homologous rsv tumor was rejected. whereas the heterologous tumor grew progressively. no generalized suppression of cell-mediated or hymoral immunity was shown, becau ... | 1976 | 56445 |
| initiation of dna synthesis by the avian oncornavirus rna-directed dna polymerase: tryptophan trna as the major species of primer rna. | the major species of primer rna required for the initiation of dna synthesis by the rous sarcoma virus rna-directed dna polymerase can be aminoacylated by tryptophan. furthermore, an intact 3' terminus is required for the primer to function in the initiation of dna synthesis. | 1976 | 56457 |
| formation of an infectious virus-antibody complex with rous sarcoma virus and antibodies directed against the major virus glycoprotein. | preparations of rous sarcoma virus (rsv) can form an infectious viral-antibody complex with antibodies raised against the major glycoprotein, gp85, isolated from avian myeloblastosis virus and prague-rsv subgroup c. binding of anti-gp85 antibodies to rsv can be demonstrated by the inhibition of focus-forming activity after addition of goat anti-rabbit immunoglobulin and by a shift in density of virions treated with anti-gp85 serum. group- rather than subgroup- specific regions of viral gp85 appe ... | 1976 | 56458 |
| group-specific antigen shared by the members of the reticuloendotheliosis virus complex. | the polypeptides of reticuloendotheliosis virus (rev) were separated by gel filtration in the presence of guanidine hydrochloride. the eight peaks obtained by gel filtration were then analyzed by polyacrylamide gel electrophoresis and four appeared to contain single polypeptides. the material identified as p29 was used to prepare antiserum. this protein constitutes the major internal non-glycosylated polypeptide in the virion. double immunodiffusion indicated that the antiserum was specific for ... | 1976 | 56462 |
| fibroblast surface antigen (sf): molecular properties, distribution in vitro and in vivo, and altered expression in transformed cells. | we have recently described a cell type-specific surface (sf) antigen that is deleted in chick fibroblasts transformed by rous sarcoma virus, sf antigen is a major surface component and makes up about 0.5% of the total protein on normal cultured fibroblasts. the antigen is shed from normal cells and is present in circulation (serum, plasma), and in vivo, also, in tissue boundary membranes. the molecular equivalents of both cellular and serum sf antigen are distinct, large polypeptides, one of wh ... | 1976 | 56527 |
| pheasant virus: new class of ribodeoxyvirus. | cocultivation of cells derived from embryos of golden pheasants or amherst pheasants with chicken embryo cells infected with bryan strain of rous sarcoma virus resulted in the detection of viruses which appear to be endogenous in these pheasant cells. the pheasant viruses (pv) were similar to avian leukosis-sarcoma viruses (alsv) in their gross morphology, in the size of their rna, in the presence of a virion-associated rna-dependent dna polymerase (dna nucleotidyltransferase; deoxynucleoside tr ... | 1976 | 57621 |
| properties and kinetics of development of rous sarcoma virus-infected cells evidenced by methylene blue staining. | three different kinds of areas of infected cells corresponding to different focus formation stages can be evidenced by methylene blue (mb) staining in cultures of chick embryo (ce) fibroblasts infected at low multiplicity with the temperature-sensitive (ts) mutant of rous sarcoma virus (rsv), fu19, which transforms these fibroblasts at 37 degrees but not at 41 degrees. these are: (a) areas of mb-stainable cells with transformed phenotype (stp areas=foci); (b) areas of mb-stainable cells with nor ... | 1975 | 57944 |
| inhibition of infectious rous sarcoma virus production by rifamycin derivative. | a new rifamycin derivative, rifazone-82 (r-82), an inhibitor of viral rna-dependent dna polymerase, is selectively toxic to transformed chicken cells in culture. r-82 has now been shown to possess antiviral activity as well. the relatively nontoxic properties of r-82 to nontransformed cells have permitted the execution of experiments examining the effect of a rifamycin derivative on virus reproduction. addition of low concentrations of r-82 (15 mug/ml) to cultures soon after rous sarcoma virus i ... | 1976 | 58073 |
| recombination between a temperature-sensitive mutant and a deletion mutant of rous sarcoma virus. | cells doubly infected with two mutants of the schmidt-ruppin strain of rous sarcoma virus (rsv), ts68, which is temperature sensitive for cell transformation (srcts), and a deletion mutant, n8, which is deficient in the envelope glycoprotein (env-), produced a recombinant which carried the defects of both parents. the frequency of formation of such a recombinant was exceptionally high and made up 45 to 55% of the progeny carrying the srcts marker. by contrast, the reciprocal recombinant, which i ... | 1976 | 60496 |
| endogenous dna polymerase of a transformation-defective rous sarcoma virus: characterization and comparison with the enzyme of the non-defective parent. | an rna-directed dna polymerase associated with transformation-defective (td) segregant of rous sarcoma virus (rsv) has been characterized. the enzyme required both a monovalent and a divalent cation, a sulfhydryl reducing agent, and all four deoxyribonucleoside triphosphates for the expression of maximal activity. sensitivity of the endogenous rna-directed dna polymerase activity to a low concentration of pancreatic rnase indicated that the enzyme utilized the td virus endogenous rna as template ... | 1976 | 62591 |
| a comparison of four methods used to concentrate rous sarcoma virus from tissue culture fluids. | three methods of pelleting, pelleting followed by pronase treatment, polyethylene glycol (peg)-pronase, and diaflo ultrafiltration (diafiltration) were used to concentrate rsv(rav-1) from tissue culture fluids. sucrose-gradient fractions containing virus preparations which had been concentrated by diafiltration or pelleting were heavily contaminated with amorphous debris. this debris was not present in similar, gradient-purified preparations that had been concentrated by the peg-pronase or pelle ... | 1976 | 63539 |
| phenotypic mixing between avian and mammalian rna tumor viruses: i. envelope pseudotypes of rous sarcoma virus. | | 1977 | 65828 |
| rna-dependent dna polymerase of avian sarcoma virus b77. ii. comparison of the catalytic properties of the alpha, beta2, and alphabeta enzyme forms. | the alpha, beta2, and alphabeta forms of the rna-dependent dna polymerase of avian sarcoma virus b77 grown in duck embryo fibroblasts have been compared with respect to several kinetic properties. the following results were obtained. 1. the km values for dttp and dgtp for enzyme forms alpha, beta2, and alphabeta were 77, 39, and 74, and 6.8, 3.1, and 6.1 micronm, respectively. 2. the affinity of 70 s rous sarcoma virus rna for enzyme form alphabeta was about twice that for the other two forms. 3 ... | 1977 | 66235 |
| low-molecular-weight rnas of moloney murine leukemia virus: identification of the primer for rna-directed dna synthesis. | the small rnas of moloney murine leukemia virus (m-mulv) were fractionated into at least 15 species by two-dimensional polyacrylamide gel electrophoresis. the pattern of small rnas is significantly different from that of rous sarcoma virus. a subset of the virion small rnas is associated with the genome rna in the 70s complex. one of the associated molecules, a cellular trna, is tightly bound to the genome rna and serves as the major primer for m-mulv rna-directed dna synthesis in vitro. | 1977 | 66325 |
| rous sarcoma virus genome is terminally redundant: the 5' sequence. | when rous sarcoma virus rna is transcribed into dna by the reverse transcriptase, a trna primer is elongated into dna. the primer is near the 5' end of the virus genome; the first major dna made is a "run-off" product extending 101 bases from the primer to the 5' end of the template. we have studied this dna molecule to determine the sequence of the first 101 bases at the 5' end of the rous sarcoma virus genome (prague strain, subgroup c). twenty-one bases at the extreme 5' end are also at the 3 ... | 1977 | 66683 |
| rous sarcoma virus genome is terminally redundant: the 3' sequence. | a sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(a) in rous sarcoma virus (prague strain, subgroup c) 35s rna has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(a) with purified reverse transcriptase (rna-directed dna polymerase; deoxynucleosidetriphosphate:dna deoxynucleotidyltransferase, ec 2.7.7.7) from avian myeloblastosis virus. the sequence is 5'gccauuuuaccauucaccac ... | 1977 | 66684 |
| [differential expression of relevant rous sarcoma tumor antigens in cultured cells]. | chickens bearing tumours induced by rous sarcoma virus (rsv) are able to mount a cellular immune response against antigens associated with these neoplasms. cultured rous sarcoma (rs) cells, derived from the wings of chickens bearing tumors induced by rsv, were consistently more susceptible in cytotoxicity assays to killing by the splenic lymphocytes of rs-bearing chickens than were chicken embryo fibroblast (cef) cells which had been transformed in vitro by rsv. in contrast, extracts (3m kci-der ... | 1977 | 66892 |
| tumor growth and antibodies after rsv-challenge in normal chickens and in chickens congenitally infected with avian leukosis virus. | normal chickens and chickens congenitally infected with an avian leukosis virus (alv) of antigenic subgroup a were challenged with strains of rous sarcoma virus (rsv) of two different antigenic subgroups (b and c) and tumor induction and growth as well as humoral antibody to viral envelope antigen (vea) and tumor-specific surface antigen (tssa) were measured. there was no effect of congenital alv infection on rsv tumor incidence or latent period but the growth rate and size of the tumors were mu ... | 1977 | 67140 |
| new procedure for the direct analysis of in vitro reverse transcription of rous sarcoma virus rna. | based on the observation that in vitro transcription of rous sarcoma virus (rsv) rna by avian myeloblastosis virus dna polymerase renders the rna progressively more sensitive to escherichia coli rnase h digestion, a new procedure for the in situ analysis of this process has been developed. in vitro transcription products of 32p-labeled rsv rna are first treated with rnase h, the resistant fraction is then digested to completion with rnase t1, and the oligonucleotides are analyzed by a fingerprin ... | 1977 | 67218 |
| a mutant of rous sarcoma virus with a conditional defect in the determinant(s) of viral host range. | | 1977 | 67701 |
| a new replication-defective variant of the bryan high-titer strain rous sarcoma virus. | | 1977 | 67703 |
| cellular and humoral anti-tumor immune responsiveness in chickens bearing tumors induced by avian sarcoma virus. | a systematic comparison was undertaken of the respective abilities of normal chicken embryo fibroblast (cef) cells, rous sarcoma virus (rsv)- transformed cef cells, avian rous sarcoma (rs) tumor cells and murine rs cells to serve as targets and antigen donors in various assays for the detection of cellular and humoral anti-tumor immunity in chickens bearing tumors induced by rous sarcoma virus. as measured by a cytotoxicity procedure, avian and murine rs cells were more susceptible to the killin ... | 1977 | 68016 |
| assay of noninfectious fragments of dna of avian leukosis virus-infected cells by marker rescue. | a marker rescue assay of noninfectious fragments of avian leukosis virus dnas is describe. dna fragments were prepared either by sonication of ecori-digestion of dnas of chicken cells infected with wild-type rous sarcoma virus, with a nontransforming avian leukosis virus, and with a mutant of rous sarcoma virus temperature sensitive for transformation. recipient cultures of chicken embryo fibroblasts were treated with noninfectious dna fragments and infected with temperature-sensitive mutants of ... | 1977 | 68125 |
| terminal redundancy and the origin of replication of rous sarcoma virus rna. | in vitro synthesis of rous sarcoma virus dna by the virion endogenous dna polymerase activity is initiated on a trnatrp primer located near the 5' end of the genome. a major product of such synthesis is a piece of dna 101 nucleotides long (strong stop dna) which can be isolated covalently bound to the trna primer. here we show that the strong stop dna is complementary to the extreme 5' end of the genome. we also show that the 5' and 3' termini of the rous sarcoma virus genome, excluding the cap ... | 1977 | 68472 |
| presence of dna polymerase in lymphosarcoma in northern pike (esox lucius). | northern poke lymphosarcoma dna polymerase was partially purified from particulate fractions banding at 1.15 to 1.16 g/ml from homogenates prepared from frozen necropsies of tumor-bearing pike. the enzyme behaves as a typical reverse transcriptase, in that it prefers ribotemplates to deoxytemplates. the isoelectric point (pl 5.5) is similar to that of avian myeloblastosis virus polymerase. the pike enzyme elutes from a phosphocellulose column at 0.22 m potassium phosphate, the same as avian myel ... | 1977 | 69492 |
| extensive in vitro transcription of rous sarcoma virus rna by avian myeloblastosis virus dna polymerase and concurrent activation of the associated rnase h. | conditions are described that promote the efficient reverse transcription of most of rous sarcoma virus (rsv) rna sequences by avian myeloblastosis virus dna polymerase in vitro. a detailed analysis of the reverse transcription reaction was carried out using two procedures: in situ analysis of the rna sequences transcribed and dna-rna annealing studies. under optimal conditions, after 1 h of reaction, practically all rsv rna sequences were transcribed with a frequency varying from 30 to 90%. the ... | 1977 | 70539 |
| [properties of pigeon sera containing complement-fixing antibodies to the gs-antigen of the avian leukosis-sarcoma complex]. | pigeons bearing tumors caused by the schmidt-ruppin strain of rous sarcoma virus were used for withdrawing sera containing complement-fixing (cf) antibody to the gs-antigen of avian leukosis-sarcoma complex. in the course of this study it was found that some of these sera, while having a high titer of cf antibody to the gs-antigen of the tumor tissue, did not detect this antigen in chicken embryonal tissue and feather follicles. it is suggested that these sera distinguish different components of ... | 1977 | 72455 |
| rous sarcoma virus p19 binds to specific double-stranded regions of viral rna: effect of p19 on cleavage of viral rna by rnase iii. | | 1978 | 74124 |
| in vitro translation of a 180,000-dalton rous sarcoma virus precursor polypeptide containing both the dna polymerase and the group-specific antigens. | | 1978 | 74900 |
| inhibition of rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. | the tridecamer d(a-a-t-g-g-t-a-a-a-a-t-g-g), which is complementary to 13 nucleotides of the 3'- and 5'-reiterated terminal sequences of rous sarcoma virus 35s rna, was added to chick embryo fibroblast tissue cultures infected with rous sarcoma virus. inhibition of virus production resulted. the inference emerges that the tridecamer and its counterpart with blocked 3'- and 5'-hydroxyl termini enter the chick fibroblast cells, hybridize with the terminal reiterated sequences at the 3' and 5' ends ... | 1978 | 75545 |
| inhibition of rous sarcoma viral rna translation by a specific oligodeoxyribonucleotide. | a tridecamer oligodeoxynucleotide, d(a-a-t-g-g-t-a-a-a-a-t-g-g), which is complementary to reiterated 3'- and 5'-terminal nucleotides of rous sarcoma virus 35s rna, is an efficient inhibitor of the translation of proteins specified by the viral rna in the wheat embryo cell-free system. the inhibition specificity for oncornavirus rna is greater than for rabbit reticulocyte mrna or brome mosaic virus rna. other oligodeoxynucleotides of similar size have little or no specific effect on the rna-dire ... | 1978 | 75546 |
| anti-tumor virus activity of copper-binding drugs. | several, structurally different, copper-binding ligands can inhibit the rna-dependent dna polymerase of rous sarcoma virus (rsv) and can inactivate the ability of the virus to malignantly transform chick embryo cells. these ligands include the anti-microbial agents, thiosemicarbazones, 8-hydroxyquinolines, isonicotinic acid hydrazide, and others. many of these compounds bind to dna and rna in the presence of copper, which may play a role in their anti-viral activity. however, not all agents acti ... | 1977 | 75679 |
| molecular mechanism for the specific inhibition of reverse transcriptase of rous sarcoma virus by the copper complexes of isonicontinic acid hydrazide. | | 1978 | 75732 |
| marker rescue of endogenous cellular genetic information related to the avian leukosis virus gene encoding rna-directed dna polymerase. | endogenous cellular genetic information related to the avian leukosis virus gene encoding rna-directed dna polymerase was studied, using a marker rescue assay to detect biological activity of subgenomic fragments of virus-related dnas of uninfected avian cells. recipient cultures of chicken embryo fibroblasts were treated with sonicated dna fragments and were infected with a temperature-sensitive mutant of rous sarcoma virus that encoded a thermolabile dna polymerase. wild-type progeny viruses w ... | 1978 | 76685 |
| inhibition of the rna dependent dna polymerase and the malignant transforming ability of rous sarcoma virus by thiosemicarbazone-transition metal complexes. | several thiosemicarbazone-metal complexes inhibit the rna dependent dna polymerase and the transforming ability of rous sarcoma virus. some complexes are equally as active as the free ligand whereas the activity of others is greatly enhanced. the 2-formyl pyridine thiosemicarbazone copper (ii) complex is the most potent compound of this class that we tested. some copper complexes of salicylaldehyde derivatives are very active also, particularly n-n-butyl, n-n-hexyl and n-benzylsalicylaldimine; n ... | 1978 | 77167 |
| dna methylase activity associated with rous sarcoma virus. | | 1978 | 77797 |
| unwinding-like activity associated with avian retrovirus rna-directed dna polymerase. | the avian retrovirus rna-directed dna polymerase contains an activity that is capable of removing hydrogen bonds from duplex nucleic acid molecules. this "unwinding-like" activity appears to be specific in its action, affecting rna.dna and dna.dna duplex molecules but not rna.rna duplexes. studies with defined rna.dna hybrid molecules (e.g., rous sarcoma virus rna and complementary dnas representing specific regions of the rous sarcoma virus genome) and dna.dna duplexes indicate that, although t ... | 1978 | 77911 |
| a nonconditional mutant of rous sarcoma virus containing defective polymerase. | | 1978 | 78571 |
| effect of antabuse (disulfiram) on rous sarcoma virus and on eukaryotic cells. | antabuse (disulfiram) is widely used in the treatment of chronic alcoholism. we have examined the effect of this drug on malignant transformation by rous sarcoma virus, on eukaryotic cell synthesis, and on nucleic acid binding. it was found that: (1) disulfiram inhibits the activity of the rna dependent dna polymerase of rous sarcoma virus and inactivates the ability of the virus to malignantly transform chick embryo cells. the monomer of disulfiram, diethyldithiocarbamate does not affect the vi ... | 1978 | 78722 |
| decreased levels of collagen mrna in rous sarcoma virus-transformed chick embryo fibroblasts. | we have found that double-stranded cdna synthesized in extended reactions by avian myeloblastosis virus reverse transcriptase is suitable substrate for a variety of restriction endonucleases. experiments in which rabbit reticulocyte mrna was reverse-transcribed and restricted to generate beta-globin-specifihe nucleotide sequence of beta-globin mrna. this method has been applied to study collagen mrna synthesis in normal and rous sarcoma virus (rsv)-transformed chick embryo fibroblasts. character ... | 1978 | 78927 |
| tumor-specific and tumor-associated membrane antigens of rous sarcoma virus transformed hamster fibroblasts. | hamster fibroblasts transformed by an env- strain of rous sarcoma virus (rsv) express at their surface tumor-associated antigens of unknown origin and a tumor-specific antigen (vcsa) which is not expressed by hamster fibroblasts transformed by unrelated dna or rna oncogenic viruses. this antigen was detectable by rabbit antibodies and a complement-dependent 51cr-release cytotoxicity assay and is common to rsv-transformed cells of different animal species. by comparing the anti-vcsa serum which a ... | 1978 | 79559 |
| effect of isonicotinic acid hydrazide-copper complex on rous sarcoma virus and its genome rna. | the copper complex of the antituberculous drug, insonicotinic acid hydrazide (inh), inhibits the rna-dependent dna polymerase of rous sarcoma virus and inactivates its ability to malignantly transform chick embryo cells. the inh-copper complex binds to the 70s genome rna of rous sarcoma virus (rsv), which may account for its ability to inhibit the rna-dependent dna polymerase. the complex binds rna more effectively than dna in contrast to m-ibt-copper complexes, which bind both types of nucleic ... | 1978 | 80234 |
| virus-like particles associated with the mitochondria of ethidium bromide treated transformed cells. | a cell line resistant to ethidium bromide has been developed from baby hamster kidney cells transformed by rous sarcoma virus. the parental cells are normally non-producers but the resistant cell line appears to produce virus-like particles that are associated with the mitochondria as visualized by electron microscopy and determined biochemically. | 1978 | 80445 |
| n-methyl isatin beta-thiosemicarbazone-copper complex inhibits rna-dependent dna polymerase but not ribonuclease h of rous sarcoma virus. | | 1978 | 81073 |
| inactivation and inhibition of rous sarcoma virus by copper-binding ligands: thiosemicarbazones, 8-hydroxyquinolines, and isonicotinic acid hydrazide. | we have shown that three types of copper-binding ligands, thiosemicarbazones, 8-hydroxyquinolines, and isonicotinic acid hydrazide and their copper complexes, inactivate the transforming ability of rsv and inhibit its rna-dependent dna polymerases. three other compounds, 2-pyridine thiosemicarbazone, 1-formyl isoquinoline thiosemicarbazone, and diphenyl thiocarbazone inhibit transformation by rsv intracellularly. most but not all of these compounds bind to nucleic acids in the presence of copper ... | 1977 | 81642 |
| [oncornavirus activation and accumulation in cell cultures under the influence of hormones]. | sex hormones (testosterone, estradiol) and thyroxine would activate irregularly the production of the specific group antigen (gs-antigen) of avian ribodesoxyviruses in the culture of "normal" chick embryonal cells (cec, phenotype c/o, gs-). the mentioned hormones as well as hydrocortisone and insulin would not prevent the rous sarcoma virus (rsv) infecting of cec, render no essential action on the accumulation of rsv in the infected cec culture, and failed to activate the formation of mature rsv ... | 1979 | 85368 |
| in vitro synthesis of infectious transforming dna by the avian sarcoma virus reverse transcriptase. | infectious dna molecules, capable of transforming chicken embryo fibroblasts, can be synthesized by the rous sarcoma virus-associated reverse transcriptase in vitro. the optimal enzymatic conditions employed for infectious dna synthesis also facilitate maximum synthesis of genome length dna. analysis of the dna product synthesized by detergent-disrupted rous sarcoma virus under these conditions indicates that dna complementary to viral rna (minus-strand dna) is genome length in size, whereas dna ... | 1979 | 85719 |
| antiserum to murine leukemia virus recognizes novel cell surface molecules associated with growth control and transformation. | antiserum directed against murine leukemia virus also reacts with several external proteins present in rat cells transformed by a temperature-sensitive rous sarcoma virus. reaction of iodinated cell extracts with anti-mlv (murine leukemia virus) serum revealed the presence of a 200,000 dalton iodinated component detectable also by metabolic labelling with glucosamine only in serum-starved cultures restricted in the expression of transformation. a similar assay with iodinated cells that express t ... | 1979 | 86526 |
| genome of avian myelocytomatosis virus mc29: analysis by heteroduplex mapping. | the virion rna of avian myelocytoma virus mc29 was hybridized to full genome length dna of the prague strain of rous sarcoma virus and analyzed by heteroduplex mapping in the electron microscopy. the results show that mc29 specific sequences for which there are no homologous counterparts in the rous sarcoma virus genome make up a contiguous stretch of rna about 1.8 kilobases long. these sequences are located approximately in the middle of the genome, replacing the 3' half of the gag gene, the en ... | 1979 | 86989 |
| formation of rous associated virus-60: origin of the polymerase gene. | the dna of normal chicken embryos contains sequences related to the avian leukosis-sarcoma viruses. rna-dependent dna polymerase of these viruses is encoded by a genetic element known as the pol gene. the nature of the endogenous virus pol gene in chicken cells was investigated by testing its ability to participate in genetic recombination. rous-associated virus-60-type recombinant viruses isolated after infection of chicken cells with strains tsla337pr-b or tsny21sr-a, both of which produce a t ... | 1979 | 87520 |
| comparison of the small rnas of polymerase-deficient and polymerase-positive rous sarcoma virus and another species of avian retrovirus. | the small rnas contained in virions of avian leukosis and sarcoma viruses are a virus-specific subset of the total small rna population of the host cell. the reverse transcriptase protein must be present in the budding virion for this selection to take place. virions of the alpha form of the bryan strain of rous sarcoma virus, which lack detectable reverse transcriptase, incorporated an unselected population of small rnas identical to total chicken cell small rna. virions of reticuloendotheliosi ... | 1979 | 87521 |
| genetic recombination in rous sarcoma virus: the genesis of recombinants and lack of evidence for linkage between pol, env and src genes in three factor crosses. | three factor crosses were performed between rouse sarcoma virus mutants with temperature-sensitive markers in the pol and src genes and host range markers in the env gene. a number of recombinant viruses appeared to segregate from virus particles which were heterozygous for all three genes under study. the frequency of various recombinant genotypes in the progeny was consistent with there being no greater linkage between the neighbouring gene pairs of pol and env and env and src than between the ... | 1979 | 90114 |
| biosynthesis of an unglycosylated envelope glycoprotein of rous sarcoma virus in the presence of tunicamycin. | cells stably infected with rous sarcoma virus were treated with tunicamycin to prevent the glycosylation of the precursor (pr92gp) to the two viral envelope glycoproteins gp85 and gp35. pretreatment of the cells for 4 h with the antibiotic resulted in a 90% reduction in [3h]mannose incorporation into total cellular glycoproteins, intracellular viral glycoproteins, and released virus particles. protein synthesis and virus particle formation were not significantly affected by the treatment. a new ... | 1979 | 90167 |
| circular forms of dna synthesized by rous sarcoma virus in vitro. | electron microscopic analysis of the dna product synthesized by detergent-disrupted preparations of rous sarcoma virus in vitro revealed the presence of several interesting molecular forms including covalently closed circular dna. the identification of such circular dna indicates that virions of retroviruses contain all the components necessary to facilitate the complete synthesis of mature forms of viral dna and therefore provide a useful system to delineate the molecular mechanisms involved in ... | 1979 | 91199 |
| deletion mutant of the bratislava-77 strain of rous sarcoma virus containing a fusion of the group-specific antigen and envelope genes. | the genetic compositions of two independently derived preparations of the bratislava-77 strain (b77) of rous sarcoma virus were analyzed after each was passaged seven or more times in duck embryo fibroblasts. rnase, t1-resistant oligonucleotide fingerprint analysis of virion rna from both preparations of duck-passaged b77 revealed the presence of two large noncontiguous deletions. approximately 75% of the rnas contained a deletion which spans oligonucleotides 304 to 4 on the viral genome (about ... | 1979 | 91686 |
| identification of a rous sarcoma virus transformation-related protein in normal avian and mammalian cells. | avian sarcoma viruses (asv) contain a gene (src) whose protein product mediates sarcomagenic transformation. this product is a 60,000-mr phosphoprotein designated pp60src. we have found that normal uninfected frog, chicken, rat, and human cells contain a 60,000-mr phosphoprotein related to the product of the asv src gene and have designated that protein pp60. a phosphoprotein of similar size was not detectable in drosophila cells. the pp60 proteins were detected by immunoprecipitation with rabbi ... | 1979 | 92031 |
| fourteen temperature-sensitive replication mutants of rous sarcoma virus. | | 1979 | 92853 |
| in vitro stimulation of natural killer (nk) cells by soluble factor(s) generated in antigen-stimulated rhesus monkey peripheral blood lymphocyte cultures. | peripheral blood lymphocytes from rhesus monkeys (macaca mulatta) sensitized to keyhole limpet hemocyanin (klh), when stimulated in vitro with klh, developed natural killer (nk) cell activity that was assayed with rous sarcoma virus-transformed marmoset fibroblasts as targets in a 4-hr 51cr-release assay. the supernatant fluids from 24- to 25-hr klh-activated cultures were capable of stimulating nk development in nonsensitive lymphocyte cultures. the effector cells were neither macrophages nor b ... | 1979 | 109523 |
| specific increase in polyamine levels in chick embryo cells transformed by rous sarcoma virus. | chick embryo fibroblasts and chorioallantoic membranes of chick embryos infected with oncogenic or nononcogenic viruses were analyzed for polyamines. nononcogenic viruses (influenze, newcastle disease, or vaccinia virus) had no effect on the polyamine content of chorioallantoic membranes. transformation of chorioallantoic membranes by a wild-type or temperature-sensitive mutant strain of rous sarcoma virus under permissive conditions (37 degrees) caused a 2- to 4-fold increase in cellular spermi ... | 1975 | 162861 |
| immunization of rous sarcoma virus-inoculated marmosets with bcg and transformed allogeneic cells. | the effects of specific immunotherapy with allogeneic cells transformed by schmidt-ruppin rous sarcoma virus (sr-rsv), of treatment with bcg, and of surgery on the growth of sr-rsv-induced sarcomas in white-lipped marmosets were studied. tumor incidence, tumor progression, and survival did not differ between control and treated animals. animals immunized with bcg developed lymphocyte reactivity to tuberculin, which remained until the animals died. bcg was isolated from the spleen of one tumor-be ... | 1975 | 163312 |
| a quantitative autoradiographic study of nucleolus-associated rna and dna synthesis during the eclipse phase in rous sarcoma virus-infected chicken fibroblasts. | functional and morphologic differences between the sensitivity of nucleoli of rous sarcoma virus-transformed cells and that of newly infected cells to the action of actinomycin d (ad) have been demonstrated by quantitative light and electron microscope autoradiography and utilized to investigate the function of the nucleolus in the early stages of infection. after a pulse exposure to low doses of ad, increased rna synthesis is induced within 80 minutes in the fibrillar portion of the nucleolus b ... | 1975 | 163331 |
| molecular weight of rna subunits of rous sarcoma virus determined by electron microscopy. | secondary cultures of chicken embryo fibroblasts were infected with the schmidt ruppin strain of rous sarcoma virus (rsv). five days after infection, the medium was replaced at 2-h intervals with phosphate-free eagle medium containing 50 muci of [32p]orthophosphate per ml. virus was collected by centrifugation, and the rna was extracted and denatured with dimethyl sulfoxide, and the 33s subunit rna was isolated by sucrose gradient centrifugation. the molecular weight of the rsv subunit rna was d ... | 1975 | 163340 |
| the methionyl transfer rnas of rous sarcoma virus. | | 1975 | 163534 |
| [effect of rous sarcoma virus on the acid phosphatase activity in cells sensitive and naturally resistant to the virus]. | | 1975 | 163552 |
| cell surface changes and rous sarcoma virus gene expression in synchronized cells. | we have investigated whether cell surface changes associated with growth control and malignant transformation are linked to the cell cycle. chicken embryo cells synchronized by double thymidine block were examined for cell-cycle-dependent alterations in membrane function (measured by transport of 2-deoxyglucose, uridine, thymidine, and mannitol), in cell surface morphology (examined by scanning electron microscopy), and in the ability of tumor virus gene expression to induce a transformation-spe ... | 1975 | 163832 |
| effects of glucose starvation on normal and rous sarcoma virus-transformed chick cells. | we studied the effect of glucose starvation on glucose uptake and thymidine uptake and incorporation in cultures of normal chicken embryo cells and those transformed by rous sarcoma virus. resting normal fibroblasts increased the rate of glucose transport up to tenfold when they were starved for glucose, whereas fast-growing normal cells doubled the rate of uptake after starvation. transformed cells did not show any change in the rate of glucose uptake during starvation. thymidine uptake and inc ... | 1975 | 163906 |
| a primer ribonucleic acid for initiation of in vitro rous sarcarcoma virus deoxyribonucleic acid synthesis. | the nucleotide sequence of an rna primer molecule for initiation of rous sarcoma virus dna synthesis in vitro has been determined. the sequence can be drawn in a cloverleaf structure typical of trnas with an anticodon for tryptophan. aminoacylation of the molecule confirms that it is trna-trp. the same sequence and aminoacylation results are obtained regardless of whether the rna is isolated from virions or from cells of chickens, the natural host for this virus. it is the only species of trna-t ... | 1975 | 164470 |
| translation of rous sarcoma virus rna in a cell-free system from ascites krebs ii cells. | the template activities of the 60-70s rna complex and of the 30-40s subunit rna species of rous sarcoma virus were tested in a cell-free protein-synthesizing system from mouse ascites krebs ii cells. stimulation of protein synthesis over the endogenous background was about 2-fold with 30-40s viral rna and about 1.3-fold with 60-70s viral rna as template. analysis by sodium dodecyl sulfate-gel electrophoresis showed that the predominant polypeptide synthesized in vitro in response to 30-40s rna o ... | 1975 | 164661 |
| viral-related information in oncornavirus-lik particles isolated from cultures of marrow cells from leukemic patients in relapse and remission. | characterization of ribonucleic acid content of particles released from cultures of marrow cells of leukemic patients indicates the presence of rna molecules of size and base sequence characteristic of oncornarviruses. seventeen marrow samples obtained from leukemic patients in relapse or in a chronic phase of the disease yielded particles containing high-molecular-weight rna with a sedimentation velocity (about 70 s) similar to that obtained for murine oncornavirus rna. eight of nine marrow sam ... | 1975 | 164662 |
| decrease in membrane-associated actin of fibroblasts after transformation by rous sarcoma virus. | the actin content of membranes prepared from cultured chick embryo fibroblasts has been measured on polyacrylamide gels. the actin was identified by tryptic peptide mapping. after transformation of the cells by rous sarcoma virus, the amount of actin associated with the membranes is decreased by 30-50%. this result is not due to infection per se, since infection by a temperature-sensitive strain of the virus decreases membrane-associated actin only at the permissive temperature. a shift from the ... | 1975 | 164667 |
| plasminogen-independent fibrinolysis by proteases produced by transformed chick embryo fibroblasts. | the fibrinolytic activity of proteases secreted by chick embryo fibroblasts infected with rous sarcoma virus was studied by use of a procedure in which a fibrin clot was formed with highly purified fibrinogen and thrombin above the cell layer. this procedure results in the formation of fibrin that is apparently a more suitable substrate for studies on fibrinolysis than is fibrin prepared by other methods. since neither plasminogen nor serum were included in the assay system in the present studie ... | 1975 | 165484 |
| rna of replication-defective strains of rous sarcoma virus. | the rna of a replication-defective (rd) mutant, isolated from stocks of nondefective (nd) schmidt-ruppin rous sarcoma virus of subgroup a (sr-a) and termed sr-n8, was compared to the rnas of sr-a, of a transformation-defective derivative of sr-a (td sr-a) and of rd bryan rous sarcoma virus, rsv (minus). the molecular mass of the 30-40s species of sr-n8 rna was estimated to be 21% (congruent to 7.5 to 8 times 10-5 daltons) smaller than that of sr-a by (i) electrophoresis in polyacrylamide gels an ... | 1975 | 165514 |
| comparisons of major cell-surface proteins of normal and transformed cells. | transformation of the chick fibroblast surface has been studied in cells infected with schmidt-ruppin rous sarcoma virus and the temperature-sensitive mutant of this virus, ts-68. major findings following transformation induced by a shift from nonpermissive (41 c.) to permissive (36 c.) temperature in ts-68 infected cells were: (1) rapid cessation or slowing of the synthesis of a protein, m.w. 100-200,000, localization uncertain; (2) cessation or slowing of the synthesis of a plasma membrane pro ... | 1975 | 165707 |
| effect of regression of rous sarcoma tumors upon egg production in an inbred line of white leghorns. | reserach was conducted to determine whether development and subsequent regression of a rous sarcoma virus (rsv) induced wing-web tumor influenced egg production. fifty-seven six-week old pullet chicks of inbred line 6 of the united states department of agriculture, regional poultry research laboratory, east lansing, michigan, were inoculated subcutaneously in the left wing-web with 0.1 ml. of a 10-minus 3 dilution of a pseudotype of bryan high titer rsv designated bh-rsv (rav-1). thirty chicks ... | 1975 | 166364 |
| alterations in surface proteins in chicken cells transformed by temperature-sensitive mutants of rous sarcoma virus. | | 1975 | 166490 |
| inhibition of rous sarcoma virus by alpha-amanitin: possible role of cell dna-dependent rna polymerase form ii. | | 1975 | 166495 |
| changes in the deoxyadenylate regions of rat dna in sarcomas induced by 7,12-dimethylbenz(alpha)anthracene and rous sarcoma virus. | | 1975 | 166964 |
| increased ouabain-sensitive 86rb+ uptake and sodium and potassium ion-activated adenosine triphosphatase activity in transformed cell lines. | during the log phase of growth both the active, ouabain-sensitive k+ uptake, measured as 86rb+, and the sodium and potassium ion-activated atpase ((na+ + k+)-atpase) activity of sv40-transformed 3t3 cells were 2.5-and 5,5-fold higher, respectively, than in untransformed 3t3 cells. a similar higher active k+ uptake was found for rous sarcoma virus and sv40-transformed baby hamster kidney cells compared with untransformed bhk cells. the active k+ uptake in sv403t3 and normal 3t3 cells decreased wh ... | 1975 | 166982 |
| transformation by a temperature sensitive mutant of rous sarcoma virus in the absence of serum. | cultures of chicken embryo fibroblasts infected with the temperature-sensitive transformation mutant of rous sarcoma virus, tsla24pr-a, were arrested between mitosis and s phase by exposure to serum-free medium at the non-permissive temperature (41degree c) for 2 days. on shifting to the permissive temperature (35degree c) the cells assumed a transformed morphology and increased uptake of [2minus 3h]-deoxy-glucose. there was a concomitant increase in acid insoluble [3h]-thymidine. this suggests ... | 1975 | 167110 |