| histone-histone interactions in a lower eukaryote, tetrahymena thermophila. | the six pairwise interactions of tetrahymena macronuclear histones h2a (formerly hx), h2b, h3, and h4 have been studied using the techniques of circular dichroism and continuous variation. parallel experiments have been performed with calf thymus histones as controls, and the 12 possible interspecies pairs have also been examined. the behavior of three of the ciliate histones, h2a, h2b, and h3 is virtually identical with that of their vertebrate counterparts. tetrahymena h4 exhibits a pattern of ... | 1978 | 728429 |
| isoleucyl-trna synthetase from the ciliated protozoan tetrahymena thermophila. dna sequence, gene regulation, and leucine zipper motifs. | we have determined the nucleotide sequence of a protozoan aminoacyl-trna synthetase. the isoleucyl-trna synthetase (ilers) gene [ilsa; formerly cupc, martindale, d. w., martindale, h. m., and bruns, p. j. (1986) nucleic acids res. 14, 1341-1354] from the ciliate tetrahymena thermophila was sequenced and found to have eight introns, four transcription start sites, and a putative polypeptide of 1081 amino acids. a polypeptide 20 amino acids longer could be made if a transcribed in-frame atg close ... | 1992 | 1371507 |
| stochastic developmental variation in the ratio of allelic rdnas among newly differentiated, heterozygous macronuclei of tetrahymena thermophila. | ciliates possess nuclear dimorphism, i.e., they carry two structurally and functionally differentiated types of nuclei. the micronucleus and macronucleus serve as the germline and somatic nuclei, respectively, of the cell. the macronucleus differentiates from a mitotic sister of the micronucleus once per life cycle. macronuclear differentiation is accompanied by a developmentally programmed set of dna rearrangements, including chromosome fragmentation, telomere addition, and amplification. given ... | 1992 | 1395146 |
| an assessment of proteolytic enzymes in tetrahymena thermophila. | cellular extracts of tetrahymena thermophila were found to contain substantial levels of proteolytic activity. protein digestion occurred over broad ranges of ph, ionic strength, and temperature and was stimulated by treatment with thiol reductants, edta and sodium dodecyl sulfate. incubation at temperatures > or = 60 degrees c or with high concentrations of chaotropic reagents such as 10 m urea or 6 m guanidine-hcl caused an apparent irreversible loss of activity. activity was also strongly dim ... | 1992 | 1453353 |
| tetrahymena gene encodes a protein that is homologous with the liver-specific f-antigen and associated with membranes of the golgi apparatus and transport vesicles. | the f-antigen is a prominent liver protein which has been extensively used in studies on natural and induced immunological tolerance. however, its intracellular localization and biological function have remained elusive. it has generally been assumed that the f-antigen is confined phylogenetically to vertebrates. now we have cloned and characterized a gene from the ciliated protozoan tetrahymena thermophila encoding a protein which clearly is homologous with the rat f-antigen. the coding region ... | 1992 | 1469718 |
| chemotactic properties, cellular binding and uptake of peptides and peptide derivatives: studies with tetrahymena thermophila. | receptor-mediated binding of leukocyte chemotactic peptide, n-formylmet-leu-phe (fmlp), occurs in the ciliated protozoon tetrahymena thermophila. in vivo labelling of the cells with n-formylmet-leu-[3h]phe ([3h]fmlp) shows that the cells bind the ligand with high affinity (kd = 4 x 10(-9) m to 1 x 10(-8) m). moreover, scatchard transformations of the binding data show that there are about 5 x 10(5) binding sites per cell on the cell surface. two fluorescent derivatives of leukocyte chemotactic p ... | 1992 | 1478955 |
| cellular uptake and degradation of phosphorothioate oligonucleotides by marine and freshwater ciliates. | to date, no antisense studies have been reported with either ciliated protozoa or marine organisms. this study examines the feasibility of using antisense oligonucleotides to alter gene expression in marine and freshwater ciliates. radiolabeled, phosphorothioate-modified oligonucleotides were used to investigate whether ciliates take up and degrade oligonucleotides present in the culture medium. with all three ciliates examined, euplotes crassus, tetrahymena thermophila, and oxytricha nova, the ... | 1992 | 1490074 |
| immunocytochemical analysis of secretion mutants of tetrahymena using a mucocyst-specific monoclonal antibody. | dense-core granules represent an adaptation of specialized secretory cells to facilitate stimulus-regulated release of stored proteins. such granules are a prominent feature of mammalian neuroendocrine and exocrine cells and are also well developed in the ciliates. in tetrahymena thermophila, the ability to generate mutants in dense-core granule biosynthesis and fusion presents a versatile system for dissecting steps in regulated exocytosis. we have previously shown that defective granules in su ... | 1992 | 1499156 |
| exceptions to mutual exclusion among cell surface i-antigens of tetrahymena thermophila during salt stress and stationary phase. | in ciliates, only one of the alternative forms of the immunodominant membrane glycoprotein usually coats the external surface of the cell. such mutual exclusion is regulated at the pretranslational level by mechanisms that result in the expression of a single protein gene. in the holotrich tetrahymena thermophila five alternative cell surface immobilization proteins (i-antigens) are expressed under different conditions of temperature (l, h, t) and culture media (i, s). using polyclonal and monoc ... | 1992 | 1522546 |
| characterization of a cdna clone from the haemoparasite babesia bovis encoding a protein containing an "hmg-box". | the complete nucleotide sequence of a babesia bovis cdna clone encoding a protein containing an hmg-box has been determined. the predicted protein of 97 amino acids has a molecular weight of 11,116. it exhibits approximately 45% overall amino acid identity with the saccharomyces cerevisiae non-histone protein 6a (nhp6a) and approximately 57% identity in the hmg-box. the b. bovis protein has been designated nhp1. like hnp6a, and unlike most other hmg1 homologues, nhp1 does not have a basic or an ... | 1992 | 1567437 |
| tetrahydropyran ring-containing fatty acid-combined taurine (tetrathermoyltaurine) in the taurolipid fraction of tetrahymena thermophila. | a tetrahydropyran ring-containing fatty acid-combined taurine (tetrathermoyltaurine) was found in the taurolipid fraction of tetrahymena thermophila. tetrathermoyltaurine accounted for about 0.6% of the total taurolipid of the cells. the compound was subjected to methanolic hydrochloric acid hydrolysis, and the structures of the hydrolysis products were identified by nuclear magnetic resonance and mass spectrometries, as taurine and 2,3-dihydroxy-9,13-oxy-7-trans-octadecenoic acid (tetrathermic ... | 1992 | 1627630 |
| characterization of the t, l, i, s, m and p cell surface (immobilization) antigens of tetrahymena thermophila: molecular weights, isoforms, and cross-reactivity of antisera. | in the ciliate protist tetrahymena thermophila the l, h, t, i, s, m and p cell surface proteins (immobilization antigens) are expressed under different conditions of temperature (l, h, t), culture media (i, s), and mutant genotype (m, p). immunoblot and autoradiographic studies using antisera to purified protein show that the molecular weights of these proteins range from 25,000 to 59,000. the h, t, s, m and p antigens are recognized as single polypeptides, whereas l, i, and one allelic form of ... | 1992 | 1640388 |
| native yeast telomeres are sufficient to stabilize linear dna in xenopus laevis oocytes. | we have constructed a linear plasmid in yeast containing the entire bovine papillomavirus genome and tested its physical stability following microinjection into stage vi oocytes of xenopus laevis. our results show that unmodified telomeres, in contrast to the yeast-passaged telomeres, drastically affect the stability of the injected linear plasmid. plasmids carrying unmodified tetrahymena thermophila telomeric sequences are rapidly degraded in oocytes. when these plasmids are passed through yeas ... | 1991 | 1657721 |
| folding of group i introns from bacteriophage t4 involves internalization of the catalytic core. | fe(ii)-edta, a solvent-based cleavage reagent that distinguishes between the inside and outside surfaces of a folded rna molecule, has revealed some of the higher-order folding of the group ib intron from tetrahymena thermophila pre-rrna. this reagent has now been used to analyze the bacteriophage t4 suny and td introns, both of which are members of the group ia subclass. significant portions of the phylogenetically conserved secondary structure are protected from fe(ii)-edta cleavage. however, ... | 1991 | 1763026 |
| the main regulatory region of mammalian mitochondrial dna: structure-function model and evolutionary pattern. | the evolution of the main regulatory region (d-loop) of the mammalian mitochondrial genome was analyzed by comparing the sequences of eight mammalian species: human, common chimpanzee, pygmy chimpanzee, dolphin, cow, rat, mouse, and rabbit. the best alignment of the sequences was obtained by optimization of the sequence similarities common to all these species. the two peripheral left and right d-loop domains, which contain the main regulatory elements so far discovered, evolved rapidly in a spe ... | 1991 | 1909377 |
| evaluation of seven in vitro alternatives for ocular safety testing. | seven in vitro assays were evaluated to determine if any were useful as screening procedures in ocular safety assessment. seventeen test materials (chemicals, household cleaners, hand soaps, dishwashing liquids, shampoos, and liquid laundry detergents) were tested in each assay. in vivo ocular irritation scores for the materials were obtained from existing rabbit low volume eye test (lvet) data. the seven assays evaluated included the silicon microphysiometer (sm), luminescent bacteria toxicity ... | 1991 | 1916072 |
| tetrahymena 14-nm filament-forming protein has citrate synthase activity. | the tetrahymena 14-nm filament-forming protein (49k protein) is a structural protein involved in oral morphogenesis and in pronuclear behavior during conjugation. cloning the 49k protein gene from a tetrahymena thermophila cdna library, we found that its primary structure exhibits a high sequence identity (51.5%) with porcine heart citrate synthase and retains functional domains. the 49k protein actually possesses citrate synthase activity, and is detected in mitochondria. these results suggest ... | 1991 | 1993043 |
| polyamine biosynthesis in arginine-starved and refed rats. | growth of rats fed with a synthetic diet was studied under control conditions (arginine-rich), arginine starvation, and arginine starvation/refeeding. hepatic polyamine concentrations and ornithine decarboxylase (odc-)activity were determined for each population. in the livers of arginine-starved rats putrescine was decreased to half the control content within 8 days; upon refeeding, it returned to control levels within another 8 days. spermidine content in liver tissue of arginine-starved rats ... | 1991 | 2039602 |
| a paper membrane filter assay for ciliate chemoattraction. | a quantitative bioassay for ciliate chemoattraction based on the boyden assay is described with the ciliates tetrahymena thermophila and tetrahymena pyriformis as test organisms. a chamber is separated into two compartments by a whatman 3mm filter, and a suspension of starved cells (approximately 10(5) cells/ml) is placed in one compartment and a solution containing attractant in the other. the gradient of chemoattractant across the filter causes the cells to swim through the filter into the att ... | 1990 | 2108589 |
| a conjugation-specific gene (cnjc) from tetrahymena encodes a protein homologous to yeast rna polymerase subunits (rpb3, rpc40) and similar to a portion of the prokaryotic rna polymerase alpha subunit (rpoa). | the cnjc gene from the protozoan tetrahymena thermophila was completely sequenced. the deduced gene product was found to have significant sequence similarity to the yeast and prokaryotic rna polymerase subunits involved with subunit assembly. since cnjc is active only during the sexual stage (conjugation) of tetrahymena's life cycle, these results indicate it may be part of a novel type of transcriptional control. the yeast proteins to which the tetrahymena cnjc is homologous are the 40 kd prote ... | 1990 | 2112240 |
| the controlling sequence for site-specific chromosome breakage in tetrahymena. | site-specific chromosome breakage occurs in many ciliated protozoa during nuclear differentiation. we have determined the cis-acting sequence that controls this process in tetrahymena thermophila. the tetrahymena ribosomal rna gene is bounded by two breakage sites. injection of this gene into developing macronuclei leads to breakage at these sites. deletion analysis has localized the sequences essential for breakage to a 28 bp region that includes a 15 bp sequence (cbs) known to be present in ot ... | 1990 | 2225076 |
| a programmed site-specific dna rearrangement in tetrahymena thermophila requires flanking polypurine tracts. | during macronuclear development in ciliates, precise deletion events eliminate thousands of specific dna segments. each segment is bounded by a unique pair of short direct repeats, but no other common feature has been reported. to determine the critical cis-acting sequences, we developed an in vivo system for analyzing this process in tetrahymena. we show that sequences essential for recognition and excision of one such region are located within the 70 bp of dna flanking either side of it. three ... | 1990 | 2364428 |
| effect of growth rate and hydrophobicity on bacteria surviving protozoan grazing. | measurements were made of the predation by tetrahymena thermophila on several bacterial species in media containing heat-killed escherichia coli cells to serve as an alternative prey. if grazing pressure was initially not intense on a mixture of bacterial species, the species that survived protozoan feeding at greater densities were those that grew quickly before the onset of active predation. if members of several species were incubated individually at similar initial densities with actively gr ... | 1990 | 2383007 |
| nuclear pre-mrna introns: analysis and comparison of intron sequences from tetrahymena thermophila and other eukaryotes. | we have sequenced 14 introns from the ciliate tetrahymena thermophila and include these in an analysis of the 27 intron sequences available from seven t. thermophila protein-encoding genes. consensus 5' and 3' splice junctions were determined and found to resemble the junctions of other nuclear pre-mrna introns. unique features are noted and discussed. overall the introns have a mean a + t content of 85% (21% higher than neighbouring exons) with smaller introns tending towards a higher a + t con ... | 1990 | 2402440 |
| comparative structural analysis of calmodulins from trypanosoma brucei, t. congolense, t. vivax, tetrahymena thermophila and bovine brain. | calmodulin is an intracellular calcium receptor protein utilized extensively by eukaryotic cells to mediate responsiveness to calcium signals. the present study evaluates the effects on protein structure of amino acid substitutions in trypanosome calmodulin. calmodulin conformation, hydrophobicity and antigenic determinants are compared among trypanosoma brucei, trypanosoma congolense, trypanosoma vivax, tetrahymena thermophila and bovine brain. trypanosome calmodulin differs from brain and tetr ... | 1985 | 2417117 |
| ion permeability of ciliary membrane vesicles isolated from tetrahymena. single-channel recording study on the membrane reconstituted into a planar lipid bilayer. | an ion channel in ciliary membrane vesicles isolated from tetrahymena pyriformis nt-1 was characterized with a single-channel recording technique applied to the membrane reconstituted into a planar lipid bilayer made of soybean phospholipid. the gating of this channel is independent of membrane potential and it spends most of the time in its open-channel state. it is selective for metal cations over gluconate anion although it little distinguishes cations, ca2+, ba2+, mg2+, and k+. this channel ... | 1986 | 2437103 |
| small rnas of tetrahymena thermophila. | highly purified nuclear and cytoplasmic rnas were obtained from tetrahymena thermophila bvii containing only a minimal amount of cross-contamination. in the nuclear rna fraction we have detected at least 6 distinct snrnas. some of the rna species showed microheterogeneity. snrnas of tetrahymena thermophila are very similar to rat snrnas, as far as length is concerned. our cytoplasmic small rna fraction contained two rnas, 7s and t7, reported recently as nuclear, particularly nucleolar rnas. more ... | 1987 | 2442596 |
| covalent cross-linking of acval-trna to tetrahymena thermophila cytoplasmic ribosomes and two of its 17s rrna mutants. | tetrahymena thermophila 80s ribosomes have been cross-linked to non-enzymatically bound acval-trna, presumably at the ribosomal p-site. like the ribosomes from escherichia coli, yeast, and artemia salina, cross-linking is exclusively to c-1609, the equivalent of the e. coli c-1400 residue. mutation of the rna from g-1707 to a or from u-1711 to c which results in resistance to paromomycin or hygromycin, respectively, failed to affect the rate, yield, or site of cross-linking. the presence of the ... | 1987 | 2450591 |
| polyamine effects on dna-directed rna polymerases in the ciliate tetrahymena thermophila. in vivo- and in vitro-experiments suggesting highly specific regulative interactions. | stimulation of growth in resting cultures of the ciliated protozoan tetrahymena thermophila stimulated putrescine formation in a manner coordinated to transcription and partly to dna-polymerisation. the stimulation of polyamine biosynthesis involved increased formation of the precursor l-ornithine from l-arginine as well as stimulation of the regulative key enzyme ornithine decarboxylase. in order to characterize the interrelationships between polyamines and transcription, which were suggested b ... | 1989 | 2472814 |
| nucleus-specific and temporally restricted localization of proteins in tetrahymena macronuclei and micronuclei. | labeled nuclear proteins were microinjected into the cytoplasm of tetrahymena thermophila. macronuclear h1, calf thymus h1, and the sv40 large t antigen nuclear localization signal linked to bsa accumulated specifically in macronuclei, even if cells were in micronuclear s phase or were nonreplicating. the way in which histone h4 localized to either the macronucleus or the micronucleus suggested that it accumulates in whichever nucleus is replicating. the inability of the micronucleus to accumula ... | 1989 | 2553740 |
| characterization of the yeast hsp60 gene coding for a mitochondrial assembly factor. | the hsp60 protein isolated from the protozoan tetrahymena thermophila is induced in response to heat stress and is a member of an immunologically conserved family represented in escherichia coli and in mitochondria of plants and animals. we report here the cloning and characterization of a nuclear gene, hsp60, which codes for the hsp60 homologue from the yeast saccharomyces cerevisiae. nucleotide sequence analysis revealed that yeast hsp60 is related to the groel protein of e. coli and the rubis ... | 1989 | 2563898 |
| stimulation of growth and polyamine biosynthesis of the ciliated protozoan tetrahymena thermophila. regulation by l-arginine. | tetrahymena thermophila cells grown in a synthetic nutrient medium for 9 h removed 97% of the free l-arginine but less than 50% of any of the other essential amino acids. the major portion of the arginine was degraded rapidly (76-92%) whereas 5-15% was conserved as intact and only 2.5-10% were incorporated into protein. however, if bovine serum albumin (bsa) was present in the medium as a macromolecular arginine source the incorporation of free arginine into protein was reduced to less than 1% b ... | 1989 | 2610929 |
| non-genic inheritance of cellular handedness. | ciliates exhibit an asymmetry in arrangement of surface structures around the cell which could be termed handedness. if the usual order of placement of structures defines a 'right-handed' (rh) cell, then a cell with this order reversed would be 'left-handed' (lh). such lh forms appear to be produced in tetrahymena thermophila through aberrant reorganization of homopolar doublets back to the singlet condition. four clones of lh forms were selected and subjected to genetic analysis to test whether ... | 1989 | 2612360 |
| nucleocytoplasmic transport of ribosomes in a eukaryotic system: is there a facilitated transport process? | we have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from x. laevis, tetrahymena thermophila, or escherichia coli. microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are ... | 1989 | 2648382 |
| tetrahymena micronuclear sequences that function as telomeres in yeast. | we explored the ability of s. cerevisiae to utilize heterologous dna sequences as telomeres by cloning germline (micronuclear) dna from tetrahymena thermophila on a linear yeast plasmid that selects for telomere function. the only tetrahymena sequences that functioned in this assay were (c4a2)n repeats. moreover, these repeats did not have to be derived from tetrahymena telomeres, although we show that micronuclear telomeres (like macronuclear telomeres) of tetrahymena terminate in (c4a2)n repea ... | 1989 | 2657657 |
| isolation and complete sequence of the yeast isoleucyl-trna synthetase gene (ils1). | the isoleucyl-trna synthetase gene (ils1) from the yeast saccharomyces cerevisiae was cloned and sequenced. this gene was initially cloned because it cross-hybridizated to what is now presumed to be the isoleucyl-trna synthetase gene (cupc) from the protozoan tetrahymena thermophila. the ils1 gene was determined to be 1,072 amino acids in length. a comparison with a recently published sequence of ils1 from another laboratory (englisch et al. 1987) was made and differences noted. two promoter ele ... | 1989 | 2663194 |
| transformation of tetrahymena thermophila with a mutated circular ribosomal dna plasmid vector. | a circular plasmid containing a complete tetrahymena thermophila rrna gene (rdna), with a tandem repeat of a 1.9-kilobase-pair segment encompassing the replication origin and the rrna promoter, and a polylinker in the 3' nontranscribed spacer, was used to transform t. thermophila by microinjection. most (20/21) stable transformants contained only recombinant linear palindromic rdna molecules carrying rdna sequences from both the donor plasmid and the recipient cell, as shown previously. however, ... | 1989 | 2813408 |
| the telomeres of tetrahymena ribosomal dna are not sufficient for stabilizing linear dna in xenopus oocytes. | restriction fragments that include the telomeres of ribosomal dna from tetrahymena thermophila (ttrdna) were ligated to the ends of linearized simian virus 40 (sv40) dna. the linear sv40 dna with ttrdna ends, circular sv40 dna, linear sv40 dna, and intact ttrdna were injected into the nuclei of xenopus laevis oocytes and assayed for stability. the intact linear 21-kb ttrdna and circular sv40 dna were maintained stably for at least 72 h after injection while the linearized sv40 dna, either with o ... | 1987 | 2824294 |
| two-dimensional dna gel electrophoresis as a method for analysis of eukaryotic genome structure: evaluation using tetrahymena thermophila dna. | there is growing interest in mapping and analyzing complete eukaryotic genomes. yee and inouye (in experimental manipulation of gene expression, pp. 279-290, academic press, new york) demonstrated that bacterial chromosomes can be resolved into interpretable patterns of dna fragments by means of restriction enzyme digestion and electrophoresis in two dimensions. we have begun to explore applications of this procedure to analysis of eukaryotic genomes, which are far more complex. tetrahymena ther ... | 1988 | 2831989 |
| telomeric repeat from t. thermophila cross hybridizes with human telomeres. | the ends (telomeres) of eukaryotic chromosomes must have special features to ensure their stability and complete replication. studies in yeast, protozoa, slime moulds and flagellates show that telomeres are tandem repeats of simple sequences that have a g-rich and a c-rich strand. mammalian telomeres have yet to be isolated and characterized, although a dna fragment within 20 kilobases of the telomeres of the short arms of the human sex chromosomes has been isolated. recently we showed that a ch ... | 1988 | 2833706 |
| yeast centromere sequences do not confer mitotic stability on circular plasmids containing ars elements of tetrahymena thermophila rdna. | we have previously demonstrated that a 657 bp taqi-xbai and a 427 bp xbai-xbai fragment from the 5' non-transcribed spacer of the extrachromosomal ribosomal dna of tetrahymena thermophila function as autonomously replicating sequences (ars) in saccharomyces cerevisiae. these fragments are adjacent to each other in a region that encompasses the in vivo origin of bidirectional replication of rdna. the presence of a yeast centromere (cen) fragment does not confer mitotic stability on these plasmids ... | 1987 | 2836076 |
| naloxone-reversible inhibition by opiates of phagocytosis in tetrahymena thermophila and mouse macrophages. | | 1988 | 2847209 |
| a highly evolutionarily conserved mitochondrial protein is structurally related to the protein encoded by the escherichia coli groel gene. | we recently reported that a tetrahymena thermophila 58-kilodalton (kda) mitochondrial protein (hsp58) was selectively synthesized during heat shock. in this study, we show that hsp58 displayed antigenic similarity with mitochondrially associated proteins from saccharomyces cerevisiae (64 kda), xenopus laevis (60 kda), zea mays (62 kda), and human cells (59 kda). furthermore, a 58-kda protein from escherichia coli also exhibited antigenic cross-reactivity to an antiserum directed against the t. t ... | 1988 | 2892128 |
| a high affinity topoisomerase i binding sequence is clustered at dnaase i hypersensitive sites in tetrahymena r-chromatin. | topoisomerase i is associated with dnaase i hypersensitive sites in the nontranscribed spacers flanking the rrna genes in tetrahymena thermophila. the endogenous topoisomerase i introduces site and strand specific single-strand cleavages in the rdna spacers in situ. the cleavages occur base specifically within a hexadecameric sequence element present in two or three direct repeats at the hypersensitive sites. the sequence specificity and polarity of the cleavage reaction are identical when the e ... | 1985 | 2985282 |
| autonomously replicating sequences from the non transcribed spacers of tetrahymena thermophila ribosomal dna. | the non-transcribed spacer (nts) regions of the linear extrachromosomal palindromic rdna from the ciliated protozoan tetrahymena thermophila contain, in addition to sequences regulating transcription, the origin(s) of bidirectional replication as well as telomere associated sequences. these nts regions function as autonomous replication sequences (ars) in the yeast saccharomyces cerevisiae (kiss, g.b., amin, a.a. and pearlman, r.e., mol. cell biol. 1: 535-543, 1981). we have now identified in th ... | 1985 | 2987861 |
| characterization of the macronuclear dna of different species of tetrahymena. | the macronuclear dnas from 20 different species of tetrahymena were characterized using alternating orthogonal field (aof) gel electrophoresis. each species has approximately 300 different macronuclear dna molecules that range in size from about 100-2000 kb pairs. although the individual macronuclear dna molecules are not well resolved on an aof gel, most species have a unique profile of macronuclear dna. the sequences that hybridize with histone h4 (tetrahymena) and ubiquitin (yeast) genes were ... | 1986 | 3031319 |
| comparison of tetrahymena ars sequence function in the yeasts saccharomyces cerevisiae and schizosaccharomyces pombe. | we have isolated several tetrahymena thermophila chromosomal dna fragments which function as autonomously replicating sequences (ars) in the heterologous saccharomyces cerevisiae and schizosaccharomyces pombe selection systems. the tetrahymena ars sequences were first isolated in s. cerevisiae and were derived from non-ribosomal micro- and macronuclear dna. sequence analysis of the ars elements identified either perfect or close matches with the 11 bp s. cerevisiae ars core consensus sequence. s ... | 1988 | 3058332 |
| molecular genetics of group i introns: rna structures and protein factors required for splicing--a review. | in vivo and in vitro genetic techniques have been widely used to investigate the structure-function relationships and requirements for splicing of group-i introns. analyses of group-i introns from extremely diverse genetic systems, including fungal mitochondria, protozoan nuclei, and bacteriophages, have yielded results which are complementary and highly consistent. in vivo genetic studies of fungal mitochondrial systems have served to identify cis-acting sequences within mitochondrial introns, ... | 1988 | 3072260 |
| conservation of sequences adjacent to the telomeric c4a2 repeats of ciliate macronuclear ribosomal rna gene molecules. | we sequenced and compared the telomeric regions of linear rdnas from vegetative macronuclei of several ciliates in the suborder tetrahymenina. all telomeres consisted of tandemly repeated c4a2 sequences, including the 5' telomere of the 11 kb rdna from developing macronuclei of tetrahymena thermophila. our sequence of the 11 kb 5' telomeric region shows that each one of a previously described pair of inverted repeats flanking the micronuclear rdna (yao et al., mol. cell. biol. 5: 1260-1267, 1985 ... | 1986 | 3092184 |
| in situ dot blots: quantitation of mrna in intact cells. | a rapid, simple and reproducible dot blot method is described for quantitating the amounts of specific messages in small numbers of intact cells. the method has been used to accurately determine the number of histone h4 mrna molecules in growing (approximately 40,000) and in starved (approximately 1600) tetrahymena thermophila, and to measure the amount of message contributed by an e. coli plasmid containing part of the s10 ribosomal operon. use of the method is illustrated to optimize in situ h ... | 1986 | 3095789 |
| the simple repeat poly(dt-dg).poly(dc-da) common to eukaryotes is absent from eubacteria and archaebacteria and rare in protozoans. | genomic dna from a wide variety of prokaryotic and eukaryotic organisms has been assayed for the simple repeat sequence poly(dt-dg).poly(dc-da) by southern blotting and dna slot blot hybridizations. consistent with findings of others, we have found the simple alternating sequence to be present in multiple copies in all organisms in the animal kingdom (e.g., mammals, reptiles, amphibians, fish, crustaceans, insects, jellyfish, nematodes). the tg element was also found in lower eukaryotes (sacchar ... | 1986 | 3127653 |
| role of protozoa in microbial acclimation for mineralization of organic chemicals in sewage. | the role of protozoa in affecting the length of the acclimation period for the mineralization of organic compounds in sewage was investigated. the acclimation periods for the mineralization of 2 ng of p-nitrophenol, 100 ng of 2,4-dichlorophenoxyacetic acid, and 100 ng of 2,4-dichlorophenol per milliliter were markedly shortened or eliminated when the indigenous protozoa were inhibited with cycloheximide and nystatin. the extent of mineralization of the test compounds decreased when the protozoa ... | 1988 | 3208203 |
| rna splicing in the t-even bacteriophage. | group 1 introns, first demonstrated in the nuclear large rrna of tetrahymena thermophila and subsequently in many yeast, fungal mitochondrial, and chloroplast precursor rnas, are capable of intron excision and exon ligation in vitro, although this process occurs much more rapidly in vivo. the discovery and characterization of a similar intron in the t4 phage thymidylate synthase gene (td) led to the finding of additional group 1 introns in other t4 genes and in genes of the related t2 and t6 pha ... | 1988 | 3280375 |
| identification of a vegetative promoter in myxococcus xanthus. a protein that has homology to histones. | a physical map of 330 x 10(3) base-pairs near the replication origin of myxococcus xanthus chromosome has been established already. using dna fragments from this region, northern blot hybridization analysis was carried out in order to identify the genes expressed during vegetative growth. one of the genes, tentatively designated as vega, was cloned and its entire dna sequence was determined. the amino acid sequence of the gene product deduced from the dna sequence reveals that the vega protein i ... | 1987 | 3316662 |
| immunological homologies between ribosomal proteins amongst lower eukaryotes. | polyclonal antibodies were raised against the purified ribosomal proteins l1 and l2, the 5s rrna binding protein l3, all from saccharomyces cerevisiae, and against l1 and l2 from schizosaccharomyces pombe (numbering according to otaka and osawa 1981; otaka et al. 1983, respectively). for clarity prefixes sc and sp have been added to the numbering of proteins derived from s. cerevisiae and s. pombe, respectively. ribosomal proteins from these yeasts and from kluyveromyces marxianus, rhodotorula g ... | 1986 | 3327609 |
| the secondary structure of large-subunit rrna divergent domains, a marker for protist evolution. | the secondary structure of the large-subunit ribosomal rna (24-26s rrna) has been studied with emphasis on comparative analysis of the folding patterns of the divergent domains in the available protist sequences, that is prorocentrum micans (dinoflagellate), saccharomyces carlsbergensis (yeast), tetrahymena thermophila (ciliate), physarum polycephalum and dictyostelium discoideum (slime moulds), crithidia fasciculata and giardia lamblia (parasitic flagellates). the folding for the d3, d7a and d1 ... | 1988 | 3395681 |
| proteolytic response to nutritional step-down in tetrahymena. | the ciliate tetrahymena thermophila is usually grown in a medium containing proteose peptone and yeast extract as organic nutrients. when the ciliate is transferred to step-down conditions, i.e., an inorganic medium, it is shown that the cells respond by rapidly and drastically increasing their rate of protein degradation. a method for measuring the response to step-down conditions is presented, and the response is characterized. the types of proteinases involved are indicated by the use of spec ... | 1986 | 3510885 |
| tetrahymena contain two distinct and unusual high mobility group (hmg)-like proteins. | previous studies have described the existence of high mobility group (hmg)-like proteins in macronuclei of the ciliated protozoan, tetrahymena thermophila (hamana, k., and k. iwai, 1979, j. biochem. [tokyo], 69:1097-1111; levy-wilson, b., m. s. denker, and e. ito, 1983, biochemistry, 22:1715-1721). in this report, two of these proteins, lg-1 and lg-2, have been further characterized. polyclonal antibodies raised against lg-1 and lg-2 fail to cross react with each other or any other macronuclear ... | 1987 | 3584238 |
| nonintegrative transformation in the filamentous fungus podospora anserina: stabilization of a linear vector by the chromosomal ends of tetrahymena thermophila. | the effect of the chromosomal ends of tetrahymena thermophila on the stability of linear transforming molecules in the filamentous fungus podospora anserina was tested. a derivative of an integrative vector for this fungus has been constructed, so that after linearization, the ends of the plasmid are the telomeric sequences of t. thermophila. after transformation, this linear molecule was maintained as an extrachromosomal plasmid with no integrated copies in about 50% of the transformants. under ... | 1987 | 3600642 |
| pathway of taurolipid b formation from exogenous taurolipid a by tetrahymena thermophila. | when tetrahymena thermophila was incubated with taurolipid a isolated from t. pyriformis nt-1, the exogenously added taurolipid a was deacylated rapidly, and taurolipid b content in the cells was increased. the deacylated taurolipid a (lysotaurolipid a) content reached a maximum early on during incubation, and then declined. taurolipid b and lysotaurolipid b contents in the cells were increased continuously during the incubation. these observations suggest that lysotaurolipid a was an intermedia ... | 1987 | 3620489 |
| unusual ciliate-specific codons in tetrahymena mrnas are translated correctly in a rabbit reticulocyte lysate supplemented with a subcellular fraction from tetrahymena. | the codon usage of tetrahymena thermophila and other ciliates deviates from the 'universal genetic code' in that uaa and probably uag are not translational termination signals but code for glutamine. therefore, translation in vitro of mrna from tetrahymena in a reticulocyte lysate is prematurely terminated if a uaa or uag triplet is present in the reading frame of the mrna. we show that the addition of a subcellular fraction from tetrahymena thermophila enables a rabbit reticulocyte lysate to tr ... | 1987 | 3663125 |
| purification and characterization of an inducible mitochondrial dna polymerase from tetrahymena thermophila. | treatment of the eukaryotic organism tetrahymena with various types of dna-damaging agents has been reported to cause a 35-fold induction of a mitochondrial dna polymerase. we here report that the enzyme can be induced in large-scale cultures by exposure of the cells to thymine starvation and/or intercalating agents. the induced dna polymerase has been purified to near homogeneity, with a specific activity of approx. 300,000 units/mg protein. the relative molecular mass of the active form of the ... | 1987 | 3814602 |
| unusual features of transcribed and translated regions of the histone h4 gene family of tetrahymena thermophila. | the complete dna sequence is presented of h4-ii, the second of the pair of histone h4 genes of the ciliated protozoan, tetrahymena thermophila. both h4 genes code for the same protein. codon usage in these and other tetrahymena genes is severely restricted and is similar to that in yeast. flanking regions are at-rich (greater than or equal to 75%), relative to coding sequences (approximately 45% gc). except for small, similarly positioned homologies, flanking sequences of the two genes are diffe ... | 1987 | 3822803 |
| infection and maintenance of holospora obtusa, a macronucleus-specific bacterium of the ciliate paramecium caudatum. | the gram-negative bacterium holospora obtusa is a macronucleus-specific symbiont of the ciliate paramecium caudatum, which invades the host cell via a food vacuole, infects its macronucleus and grows exclusively in the nucleus. from infection experiments, we showed that a property of the macronucleus that is necessary for it to be recognized and infected by h. obtusa is commonly provided by p. caudatum, p. multimicronucleatum and 14 species of the p. aurelia complex, but not by p. jenningsi, p. ... | 1985 | 3905836 |
| a modified two primer approach to oligonucleotide-directed in vitro mutagenesis. | using oligonucleotide-directed mutagenesis, we are trying to define the features of the protein structure that are important for the dna and c-amp binding by cap from e. coli, the enzymic activity and putative dna binding of dihydrofolate reductase of l. casei, and the functionally important regions of the self-splicing rna of the r-rna intron of tetrahymena thermophila. we have used a modification of the method described by norris et al. [1]. a mutagenic primer and an m13 universal sequencing p ... | 1985 | 3910112 |
| expression of a cell surface immobilization antigen during serotype transformation in tetrahymena thermophila. | a temperature shift from 40 to 28 degrees c rapidly induced expression of a specific immobilization antigen at the cell surface in tetrahymena thermophila. this transformation was inhibited by actinomycin d and cycloheximide but not by colchicine or cytochalasin b. the major surface antigen expressed at 28 degrees c in cells homozygous for the serh3 allele was partially purified, and an antiserum against this preparation was raised in rabbits. electrophoresis, immunoblot, and [35s]methionine inc ... | 1985 | 3915784 |
| formation and stability of linear plasmids in a recombination deficient strain of yeast. | natural termini from macronuclear dna of the ciliated protozoans tetrahymena thermophila and oxytricha fallax can support telomere formation yeast. however, plasmids carrying these ciliate termini are modified by the addition of dna which hybridizes to the synthetic oligonucleotide poly [d(c-a]), a sequence which also hybridizes to terminal restriction fragments from yeast chromosomes but not to tetrahymena or oxytricha macronuclear dnas. thus, in yeast, the creation of new telomeres on ciliate ... | 1985 | 3916729 |
| the tetrahymena rrna intron self-splices in e. coli: in vivo evidence for the importance of key base-paired regions of rna for rna enzyme function. | we have developed an in vivo rna splicing assay for the self-splicing rrna intron of tetrahymena thermophila using e. coli as the host. a dna fragment containing the intron sequence has been cloned into m13mp83 so that expression of the beta-galactosidase alpha-fragment is dependent upon intron excision from the mrna precursor. plaque phenotypes correlate well with levels of excised intron rna. point mutations were made by oligonucleotide-directed mutagenesis in conserved sequences p, q, and s. ... | 1985 | 3917861 |
| an unusual genetic code in nuclear genes of tetrahymena. | we have cloned and partially sequenced two histone h3 genes of tetrahymena thermophila. the dna sequences strongly suggest that both genes are active in the vegetatively growing cell. comparison of the derived amino acid sequences of these two genes with the actual sequence of tetrahymena histone h3 results in the surprising conclusion that taa codes for glutamine. this represents the first demonstration of a coding function for this termination codon of the "universal" code. this observation ha ... | 1985 | 3921962 |
| in vitro deletion analysis of ars elements spanning the replication origin in the 5' non-transcribed spacer of tetrahymena thermophila ribosomal dna. | two adjacent but non-overlapping restriction fragments that encompass the replication origin of the macronuclear copy of rdna from tetrahymena thermophila allow autonomous replication of plasmids in the yeast saccharomyces cerevisiae; i.e. they function as autonomously replicating segments (ars). deletions generated in vitro into these fragments yield an 82 bp segment from each as the smallest sequence specifying ars function. these 82 bp segments are at the 5' end of a 220 bp region of homology ... | 1986 | 3960733 |
| macronuclear dna of tetrahymena thermophila exists as defined subchromosomal-sized molecules. | using the method of orthogonal-field-alternation gel electrophoresis, we have resolved the macronuclear dna of tetrahymena thermophila into a series of distinct bands. using electrode switching intervals ranging from 10 to 70 seconds we have resolved dna bands ranging in size from about 21 kb up to and beyond the size of yeast chromosomes vii and xv. hybridization of southern blots from these gels to both unique and repetitive dna sequences shows that the macronuclear genome of t. thermophila ha ... | 1985 | 4034396 |
| an organofluorophosphate-hydrolyzing activity in tetrahymena thermophila. | an enzymatic activity that hydrolyzes o,o-diisoproplyphosphofluoridate (dfp) and o-1,2,2-trimethylpropylmethylphosphonofluoridate (soman) was discovered in the ciliate protozoan tetrahymena thermophila. the enzymatic activity classifies the protein as mazur-type similar to that found in hog kidney and escherichia coli. the rate of hydrolysis of soman by the tetrahymena-extract is the highest, on a per gram of extract basis, of any eucaryote. the molecular weight is approximately 75,400 as determ ... | 1985 | 4045763 |
| isolation of a stearoyl coa desaturase form tetrahymena thermophila. | cell free preparations of tetrahymena thermophila contain an enzyme that catalyzes the direct desaturation of stearoyl coa to octadecenoic acid. the enzyme is associated with the microsomal fraction of the ciliate. substrate of the enzyme consists of either free stearic acid or stearoyl coa. both atp and coa are required when free stearate is the substrate and are also highly stimulatory when stearoyl coa is the substrate. with stearoyl coa as the substrate, either nadh or nadph are required for ... | 1981 | 6114174 |
| rna structure analysis using t2 ribonuclease: detection of ph and metal ion induced conformational changes in yeast trnaphe. | we describe the use of an enzymic probe of rna structure, t2 ribonuclease, to detect alterations of rna conformation induced by changes in mg2+ ion concentration and ph. t2 rnase is shown to possess single-strand specificity similar to s1 nuclease. in contrast to s1 nuclease, t2 rnase does not require divalent cations for activity. we have used this enzyme to investigate the role of mg2+ ions in the stabilization of rna conformation. we find that, at neutral ph, drastic reduction of the availabl ... | 1984 | 6207483 |
| calmodulin in the ciliates paramecium tetraurelia and tetrahymena thermophila. | | 1980 | 6263158 |
| self-splicing rna: autoexcision and autocyclization of the ribosomal rna intervening sequence of tetrahymena. | in the macronuclear rrna genes of tetrahymena thermophila, a 413 bp intervening sequence (ivs) interrupts the 26s rrna-coding region. a restriction fragment of the rdna containing the ivs and portions of the adjacent rrna sequences (exons) was inserted downstream from the lac uv5 promoter in a recombinant plasmid. transcription of this template by purified escherichia coli rna polymerase in vitro produced a shortened version of the pre-rrna, which was then deproteinized. when incubated with mono ... | 1982 | 6297745 |
| tetrahymena h4 genes: structure, evolution and organization in macro- and micronuclei. | the ciliated protozoan tetrahymena thermophila contains two types of h4 histone genes (h4-i and h4-ii). southern blotting and analysis of dna from nullisomic strains indicate that h4-i and h4-ii are on different chromosomes and that only h4-ii is closely linked to an h3 gene. no dna sequence rearrangements are observed for either of the h4 genes when the transcriptionally inert, germ line, micronucleus is compared to the transcriptionally active, somatic macronucleus. comparison of the h4-i gene ... | 1984 | 6322129 |
| mitotic and meiotic stability of linear plasmids in yeast. | circular recombinant dna plasmids that contain autonomously replicating sequences (arss) are maintained in extrachromosomal form in transformed yeast cells. however, these plasmids are unstable, being rapidly lost from cells growing without selection. although the stability of such a plasmid can be increased by the presence of yeast centromere dna (cen), even cen plasmids are lost at a high rate compared to a bona fide yeast chromosome. natural yeast chromosomes are linear molecules; therefore, ... | 1983 | 6344082 |
| [microbiological assay of pantothenic acid in rat liver using tetrahymena]. | microbiological assay of pantothenic acid in rat liver using tetrahymena. the quantitative determination of total pantothenic acid in rat liver using tetrahymena was carried out in the same way as a microbiological assay. the strain selected was tetrahymena thermophila grown on rat liver. inoculum was obtained from a commercial medium. the assay medium consisted of a dry powder to be rehydrated and heated to boiling, and then adjusted to ph 7. liver pantothenic acid was extracted by autolysis. t ... | 1983 | 6421766 |
| a quantitative assay for ciliate chemotaxis. | a quantitative bioassay for ciliate chemotaxis based on the capillary principle is described using tetrahymena thermophila as test organism. the attractant-containing assay tube designed for the bioassay attracts up to 4 x 10(4) cells in 2 h which makes electronic cell counting of the chemotactic response feasible. the attractants used are solutions of proteose peptone and yeast extract which also are growth media for this organism. | 1983 | 6660520 |
| tetrahymena. adaptation to high iron. | fe-starved ciliates tetrahymena thermophila cease to multiply at fe(iii) concentrations above 10 microm in a synthetic nutrient medium lacking a good iron chelator such as citrate. if, however, the fe(iii) concentration is gradually increased over a series of subcultivations the cells will tolerate up to 300 microm fe(iii). our experiments rule out the possibility of genetic selection of fe-tolerant clones and suggest a physiological type of adaptation. | 1984 | 6734739 |
| two separate regions of the extrachromosomal ribosomal deoxyribonucleic acid of tetrahymena thermophila enable autonomous replication of plasmids in saccharomyces cerevisiae. | plasmids containing the nontranscribed central and terminal, but not the coding, regions of the extrachromosomal ribosomal deoxyribonucleic acid (rdna) of tetrahymena thermophila are capable of autonomous replication in saccharomyces cerevisiae. these plasmids transform s. cerevisiae at high frequency; transformants are unstable in the absence of selection, and plasmids identical to those used for transformation were isolated from the transformed yeast cells. one plasmid contains a 1.85-kilobase ... | 1981 | 6765606 |
| production of melanin precursors by a mutant of tetrahymena thermophila. | a mutant of tetrahymena thermophila, "pig," excretes melanin precursors into the culture medium where spontaneous polymerization to melanin occurs. the precursors, probably oxidation products of catecholamines, are produced in large amounts by the mutant by decarboxylation of tyrosine and hydroxylation of the resulting tyramine. overproduction and excretion of precursors by the mutant appears to result from elevated specific activity of l-aromatic amino acid decarboxylase (dopa decarboxylase) ( ... | 1980 | 6778998 |
| preliminary findings on the use of protozoa (tetrahymena thermophila) as models for ocular irritation testing in rabbits. | the ciliated protozoan tetrahymena thermophila (atcc 30008) was used as an indicator organism in the development of an in vitro test to replace in vivo testing of chemicals in the eyes of rabbits. fifty microliters of tetrahymena suspension were mixed with fifty microliters of varying dilutions of test chemicals. after 2 minutes, a bacteriological loopful of the mixture was examined microscopically to evaluate the motility of the organism. the minimum dilution allowing nearly 100% typical cell m ... | 1983 | 6834775 |
| investigation of actin in tetrahymena cells. a comparison with skeletal muscle actin by a devised two-dimensional gel electrophoresis method. | total protein constituents of tetrahymena thermophila strain b1868 iii were studied by two-dimensional agarose-polyacrylamide gel electrophoresis to detect actin among the constituents. in the attempts to prepare a whole-cell extract of tetrahymena, it was found that protease activity in the extract was so high that high molecular components were quickly digested with the endogenous protease into small peptides unless the homogenization and heat-treatment in a sodium dodecylsulfate solution were ... | 1983 | 6841346 |
| sequence specificity of dna adenine methylase in the protozoan tetrahymena thermophila. | the sequence specificity of the tetrahymena dna-adenine methylase was determined by nearest-neighbor analyses of in vivo and in vitro methylated dna. in vivo all four common bases were found to the 5' side of n6-methyladenine, but only thymidine was 3'. homologous dna already methylated in vivo and heterologous micrococcus luteus dna were methylated in vitro by a partially purified dna-adenine methylase activity isolated from tetrahymena macronuclei. the in vitro-methylated sequence differed fro ... | 1982 | 6950932 |
| on the phylogeny of phycomyces blakesleeanus. nucleotide sequence of 5 s ribosomal rna. | the nucleotide sequence of the major 5 s ribosomal rna from the lower fungus phycomyces blakesleeanus has been determined. the sequence is 5' aaucuacggccauacagauaguaacacaccggaucccgucugaucuccgcaguuaagucucuccugguagcgucaguac uauggugggggaccacaugggaauacgcuaugucguagguu3'oh. the phycomyces 5 s rna sequence has invariant nucleotide positions characteristic of other eukaryotic 5 s rnas and fits currently proposed secondary structural models. the phycomyces of 5 s rna shows relatively low overall sequence ... | 1982 | 7096355 |
| the intervening sequence excised from the ribosomal rna precursor of tetrahymena contains a 5-terminal guanosine residue not encoded by the dna. | the ribosomal rna precursor of tetrahymena thermophila contains a 0.4 kilobase intervening sequence that is excised as a linear rna molecule ("ivs rna") and subsequently cyclized. in vitro transcription in isolated nuclei was used to accumulate the ivs rna labeled at its 5' end was subjected to sequencing gel analysis and terminal nucleotide analysis. in addition, uniformly labeled ivs rna was cleaved with rnaase t1, and the resulting oligonucleotides were studied by two-dimensional fingerprint ... | 1982 | 7099968 |
| purification and properties of galactokinase from tetrahymena thermophila. | galactokinase (ec 2.7.1.6; atp: d-galactose-1-phosphototransferase) was purified 152-fold with an 11% yield from tetrahymena thermophila maximally derepressed for enzyme synthesis in late stationary phase. the purification procedure utilized sequential acid precipitation, batch deae-sephacel chromatography, differential ammonium sulfate precipitation and narrow range electrofocusing. the apparent molecular weight of the holoenzyme as determined by gel filtration on sephadex g-200 is 50000-55000. ... | 1982 | 7104394 |
| regulation of the pattern of basal bodies within the oral apparatus of tetrahymena thermophila. | the number and arrangement of basal bodies included in the four compound ciliary organelles making up the mature oral apparatus of tetrahymena thermophila ordinarily vary only slightly. severe starvation brings about formation of oral structures with a reduced number of basal bodies within these organelles, and sometimes with a complete loss of one of the component organelles. such reductions are stringently specified in spatial terms, but they do not represent simple and proportional shrinkage ... | 1982 | 7119675 |
| the nucleotide sequences of 5s rrnas from three ciliated protozoa. | the nucleotide sequences of 5s rrnas from three ciliated protozoa, paramecium tetraurelia, tetrahymena thermophila and blepharisma japonicum have been determined. all of them are 120 nucleotides long and the sequence of probable trna binding site of position 41-44 is gaac which is characteristic of the plant 5s rrnas. the sequence similarity percents are 87% (paramecium/tetrahymena), 86% (paramecium/blepharisma) and 79% (tetrahymena/blepharisma), suggesting a close relationship of these three ci ... | 1982 | 7122243 |
| identification of ribozymes within a ribozyme library that efficiently cleave a long substrate rna. | positions 2-6 of the substrate-binding internal guide sequence (igs) of the l-21 sca i form of the tetrahymena thermophila intron were mutagenized to produce a gn5 igs library. ribozymes within the gn5 library capable of efficient cleavage of an 818-nt human immunodeficiency virus type 1 vif-vpr rna, at 37 degrees c, were identified by ribozyme-catalyzed guanosine addition to the 3' cleavage product. three ribozymes (igs = ggggcu, ggcucc, and guggcu) within the gn5 library that actively cleaved ... | 1995 | 7489519 |
| model for an rna tertiary interaction from the structure of an intermolecular complex between a gaaa tetraloop and an rna helix. | in large structured rnas, rna hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-gnra (where n is any nucleotide, and r is either g or a) are unusually frequent. in group i introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative rna duplex stems: gnaa loops correlate with successive 5'-c-c.g-c base pairs in stems, whereas gnga loops correlate w ... | 1994 | 7526219 |
| dissecting and analyzing the secondary structure domains of group i introns through the use of chimeric intron constructs. | the mitochondrial genes of the yeast saccharomyces cerevisiae are often interrupted by introns defined as either group i or group ii. some of the introns contained within the precursor rnas of these genes will self splice in vitro. the fourth introns of apocytochrome b (bi4) and cytochrome oxidase (ai4) are group i introns that do not self splice in vitro, even though they can fold into the same rna secondary structures that are characteristic of the self-splicing introns. they require an intron ... | 1995 | 7563076 |
| high frequency of sex and equal frequencies of mating types in natural populations of the ciliate tetrahymena thermophila. | in ciliate protists, sex involves the temporary joining of two cells of compatible mating type, followed by meiosis and exchange of gametic nuclei between conjugants. reproduction is by asexual binary fission following conjugation. for the many ciliates with fixed multiple mating types, frequency-dependent sex-ratio theory predicts equal frequencies of mating types, if sex is common in nature. here, we report that in natural populations of tetrahymena thermophila sexually immature cells, indicat ... | 1995 | 7568003 |
| structure and evolution of paramecium hemoglobin genes. | hemoglobin (hb) genes have been cloned from three different species of ciliated protists, p. multimicronucleatum, p. triaurelia and p. jenningsi. southern blotting of the genomic dnas using the p. caudatum hb cdna showed both intraspecies variation in different stocks of p. caudatum and interspecies variation within the genus paramecium. the isolated hb genes were composed of 118, 117 and 117 codons, and interrupted by a short intron with 27, 29 and 29 bp at the same position, in p. multimicronu ... | 1995 | 7578257 |
| enhanced self-splicing of physarum polycephalum intron 3 by a second group i intron. | the third group i intron of physarum polycephalum is found at the same site in the large subunit rrna as the well-characterized intron from tetrahymena thermophila. formation of alternative structures in the rrna can inhibit self-splicing of the tetrahymena intron. we report that splicing of physarum intron 3 is also influenced by adjacent sequences. in this case, however, splicing is stimulated by the presence of a second group i intron 24 nucleotides downstream. in vitro, intron 3 self-splices ... | 1995 | 7585248 |
| an activity gel assay detects a single, catalytically active histone acetyltransferase subunit in tetrahymena macronuclei. | macronuclei of the ciliated protozoan tetrahymena thermophila possess a histone acetyltransferase activity closely associated with transcription-related histone acetylation. nothing definitive is known concerning the polypeptide composition of this activity in tetrahymena or any comparable activity from any cellular source. an acetyltransferase activity gel assay was developed which identifies a catalytically active subunit of this enzyme in tetrahymena. this activity gel assay detects a single ... | 1995 | 7603997 |
| gel shift and uv cross-linking analysis of tetrahymena telomerase. | telomerase is an unusual ribonucleoprotein that synthesizes new telomeres onto chromosome ends. the enzyme has been most extensively characterized in ciliates, where the rna component has been cloned from several species, and its elongation properties have been characterized in detail. to understand the substrate specificity and protein composition of telomerase, we have used gel shift and uv cross-linking to characterize the enzyme from the ciliate tetrahymena thermophila. in a mobility shift a ... | 1995 | 7721797 |
| cellular polarity in ciliates: persistence of global polarity in a disorganized mutant of tetrahymena thermophila that disrupts cytoskeletal organization. | much of the cell surface on the ciliate tetrahymena thermophila is covered by a polarized lattice of cytoskeletal structures that are associated with basal bodies of the ciliary rows. unique structural landmarks, including an oral apparatus and contractile vacuole pores, develop before cell division in localized domains located, respectively, posterior and anterior to the transverse fission zone. all of these structures can be visualized by specific monoclonal antibodies. a single-locus recessiv ... | 1995 | 7781905 |