
TitleAbstractYear(sorted descending)
expression of functional thermoplasma acidophilum proteasomes in escherichia coli.the two genes encoding the constituent subunits of the thermoplasma acidophilum proteasome were expressed in escherichia coli yielding fully assembled molecules as shown by electron microscopy. the recombinant proteasomes were purified to homogeneity and were shown to have proteolytic activity indistinguishable from proteasomes isolated from t. acidophilum.19921426246
purification and properties of pyruvate kinase from thermoplasma acidophilum.thermoplasma acidophilum is a thermoacidophilic archaebacterium occupying a paradoxical place in phylogenetic trees (phenotypically it is a thermoacidophile but phylogenetically it classifies with the methanogens). to better understand its phylogeny, the pyruvate kinase from this organism is being investigated as a molecular marker. the enzyme has been purified and has a native m(r) of 250,000. it consists of four, apparently identical subunits each of m(r) 60,000. no remarkable kinetic differen ...19921426985
nucleotide sequence of the gene coding for ribosomal protein s10 from the archaeum thermoplasma acidophilum. 19921508693
conversion, by limited proteolysis, of an archaebacterial citrate synthase into essentially a citryl-coa hydrolase.1. limited proteolysis of citrate synthase from sulfolobus solfataricus by trypsin reduced the rate of the overall reaction (acetyl-coa + oxaloacetate + h2o----citrate + coash) to 4% but did not affect the hydrolysis of citryl-coa. experimental results indicate that a connecting link between the enzyme's ligase and hydrolase activity becomes impaired specifically on treatment with trypsin. other proteolytic enzymes like chymotrypsin and subtilisin inactivated catalytic functions of citrate synth ...19921521537
calorimetry of tetraether lipids from thermoplasma acidophilum: incorporation of alamethicin, melittin, valinomycin, and nonactin.the development and application of model membrane systems on the basis of tetraether lipids from thermoplasma acidophilum has been proposed. in this respect incorporation of membrane proteins and ionophores is indispensable and is demonstrated in the case of alamethicin, melittin, nonactin, and valinomycin by calorimetry. dipalmitoylphosphatidylcholine (dppc) and dihexadecylmaltosylglycerol (dhmg) were chosen for comparison. melittin and alamethicin prove to broaden the lipid phase transition an ...19921567197
transcription in vivo and in vitro of the histone-encoding gene hmfb from the hyperthermophilic archaeon methanothermus fervidus.immediately upstream of the hmfb gene, in a dna fragment cloned from methanothermus fervidus, are two identical tandemly repeated copies of a 73-bp sequence that contain the sequence 5'tttatata, which conforms precisely to the consensus tata box element proposed for methanogen promoters. by using this duplicated region as the template dna and a cell-free transcription system derived from methanococcus thermolithotrophicus, transcription in vitro was found to initiate at two identical sites 73 bp ...19921592806
early evolutionary relationships among known life forms inferred from elongation factor ef-2/ef-g sequences: phylogenetic coherence and structure of the archaeal domain.phylogenies were inferred from both the gene and the protein sequences of the translational elongation factor termed ef-2 (for archaea and eukarya) and ef-g (for bacteria). all treeing methods used (distance-matrix, maximum likelihood, and parsimony), including evolutionary parsimony, support the archaeal tree and disprove the "eocyte tree" (i.e., the polyphyly and paraphyly of the archaea). distance-matrix trees derived from both the amino acid and the dna sequence alignments (first and second ...19921602493
the pyruvate kinase of thermoplasma acidophilum: purification, kinetic characterisation & use as a phylogenetic marker. 19921633935
primary structure of the thermoplasma proteasome and its implications for the structure, function, and evolution of the multicatalytic proteinase.the proteasome or multicatalytic proteinase is a high molecular mass multisubunit complex ubiquitous in eukaryotes but also found in the archaebacterial proteasome is made of two different subunits only, and yet the complexes are almost identical in size and shape. cloning and sequencing the gene encoding the small (beta) subunit of the t. acidophilum complex completes the primary structure of the archaebacterial proteasome. the similarity of the derived amino acid sequences of 233 (alpha) and 2 ...19921734972
the multicatalytic proteinase (prosome, proteasome): comparison of the eukaryotic and archaebacterial enzyme.proteasomes isolated and purified from rat muscle tissue and from the archaebacterium thermoplasma acidophilum have a very similar size and shape, but the subunit composition is less complex in the archaebacterium as compared to the eukaryotic particle. the archaebacterial enzyme contains a catalytic site with chymotryptic specificity, which is inhibited by serine proteinase inhibitors and clearly differs from the eukaryotic particle which has a minimum of three catalytic sites for peptide bond ...19911801710
one-step purification of bacterial lipid macroamphiphiles by hydrophobic interaction chromatography.bacterial lipid macroamphiphiles extracted with phenol/water can be purified in one step by hydrophobic interaction chromatography. lipids and the major part of protein are separated from macroamphiphiles during phenol/water extraction. coextracted nucleic acids, polysaccharides, and residual protein are effectively removed by column chromatography on octyl-sepharose whereby macroamphiphiles are primarily adsorbed and later eluted with a buffered propanol gradient. the procedure is applicable to ...19911862938
characterization of a quinole-oxidase activity in crude extracts of thermoplasma acidophilum and isolation of an 18-kda cytochrome.a quinol-oxidase activity was detected in crude extracts of the thermoacidophilic archaebacterium thermoplasma acidophilum. the activity was optimal at ph 5.4 and 50 degrees c. the km for ubiquinol-10 was 18 microm. the enzyme was inhibited by 2n-heptyl-4-hydroxyquinoline n-oxide with a ki of 150 nm. ubiquinols with different side-chain lengths were oxidized at similar rates, whereas menaquinols were converted at 6-12-fold higher rates compared to ubiquinols. membranes from t. acidophilum contai ...19911879426
thermotropic properties of dispersions of cholesterol with tetraether lipids from thermoplasma acidophilum.the main glycophospholipid from thermoplasma acidophilum is composed of a diisopranol-2,3-glycerotetraether. the fraction of pentane cyclizations of its hydrocarbon chains increases with the growth temperature of the source organism (39-59 degrees c). hydrated mixtures of these lipids together with cholesterol have been studied by calorimetry. with the reduction of the phase transition temperatures and enthalpy changes of the transitions, cholesterol is readily incorporated into lipid monolayers ...19911898093
localization of subunits in proteasomes from thermoplasma acidophilum by immunoelectron microscopy.the subunit topography of the thermoplasma acidophilum proteasome was determined by immunoelectron microscopy using monospecific antibodies directed against the two constituent subunits (alpha,beta). anti-alpha-subunit igg was found to bind to the outer disks of the cylinder- or barrel-shaped molecule, while the binding sites of the anti-beta-subunit igg were mapped on the two inner rings. probably the homologues of the two subunits in the compositionally more complex but isomorphous eukaryotic ...19911915873
purification and characterisation of an archaebacterial succinate dehydrogenase complex from the plasma membrane of the thermoacidophile sulfolobus acidocaldarius.a succinate dehydrogenase complex was isolated in a three-step purification from plasma membranes of the thermoacidophilic archaebacterium sulfolobus acidocaldarius. it consists of four subunits: a, 66 kda; b, 31 kda; c, 28 kda and d, 12.8 kda. in the 141-kda native protein, the four subunits are present in an equimolar stoichiometry. the complex contains acid-non-extractable flavin, iron and acid-labile sulphide. maximal succinate dehydrogenase activities were recorded at ph 6.5, which coincide ...19911935955
crystallization and preliminary crystallographic study of glucose dehydrogenase from the archaebacterium thermoplasma acidophilum.single crystals of glucose dehydrogenase from the archaebacterium thermoplasma acidophilum were obtained using the hanging-drop vapour diffusion method and polyethylene glycol as a precipitant in the presence of nadp+ at ph 5.4. the crystals belong to the hexagonal space group p6122 or p6522, with unit cell dimensions a = b = 121.9 angstrom, c = 229.6 angstrom and with two molecules in the asymmetric unit.19911960718
cloning and sequencing of the gene encoding the large (alpha-) subunit of the proteasome from thermoplasma acidophilum.the gene encoding the alpha-subunit of the proteasome from the archaebacterium thermoplasma acidophilum was cloned and sequenced. the gene encodes for a polypeptide with 233 amino acid residues and a calculated molecular weight of 25870. sequence similarity of the alpha-subunit with the saccharomyces cerevisiae wild-type suppressor gene scll+ encoded polypeptide, which is probably identical with the subunit yc7-alpha of the yeast proteasome, lends support to a putative role of proteasomes in the ...19911991516
expression and purification of plasmid-encoded thermoplasma acidophilum citrate synthase from escherichia coli.the citrate synthase gene from the thermophilic archaebacterium thermoplasma acidophilum was expressed in escherichia coli, yielding an active product of the expected molecular weight. manipulation of the citrate synthase gene in a series of puc19 constructs showed that the presumed thermoplasma ribosome binding site is recognized by the e. coli ribosome. a rapid purification of the expression product to homogeneity was achieved, based on the thermostability of thermoplasma citrate synthase.19912026248
the three-dimensional structure of proteasomes from thermoplasma acidophilum as determined by electron microscopy using random conical tilting.the three-dimensional structure of proteasomes from the archaebacterium thermoplasma acidophilum has been determined to a resolution of approximately 2 nm from electron micrographs of negatively stained preparations using the method of 'random conical tilting'. the particles turn out to be essentially cylinder-shaped barrels, 15 nm long and 11 nm wide, enclosing a tripartite inner compartiment. an account is given of some of the present limitations which prevent to attain a higher resolution and ...19912037064
cloning and sequencing of the fus-gene encoding elongation factor 2 in the archaebacterium thermoplasma acidophilum.we have cloned a 1.6-kb region of chromosomal dna from thermoplasma acidophilum into escherichia coli using as a probe part of the methanococcus vannielii fus-gene. the sequence of the clone was highly homologous to part of the corresponding methanococcus vannielii gene. by chromosome walking, a 4.7-kb ecori fragment containing the complete gene was isolated. nucleotide sequencing revealed an open reading frame of 2196 nucleotides. the deduced amino acid sequence contains the known peptide seque ...19912044939
incorporation of synthetic peptide helices in membranes of tetraether lipids from thermoplasma acidophilum. a calorimetric study.four analogues of the membrane-modifying, alpha-helical polypeptide antibiotic alamethicin were synthesized. the alpha-helical deca-, undeca-, heptadeca-, and icosapeptides were mixed with the main tetraether lipid of the archaebacterium thermoplasma acidophilum (mpl), dipalmitoylphosphatidylcholine (dppc) and dihexadecylmaltosylglycerol (dhmg) in various ratios and the modification of the lipid phase transition was determined by differential thermal analysis (dta). the polypeptides form mixed p ...19912059650
posttranscriptional modification of trna in thermophilic archaea (archaebacteria).nucleoside modification has been studied in unfractionated trna from 11 thermophilic archaea (archaebacteria), including phylogenetically diverse representatives of thermophilic methanogens and sulfur-metabolizing hyperthermophiles which grow optimally in the temperature range of 56 (thermoplasma acidophilum) to 105 degrees c (pyrodictium occultum), and for comparison from the most thermophilic bacterium (eubacterium) known, thermotoga maritima (80 degrees c). nine nucleosides are found to be un ...19911708763
small ribosomal subunit rna sequences, evolutionary relationships among different life forms, and mitochondrial origins.a tree was constructed from a structurally conserved area in an alignment of 83 small ribosomal subunit sequences of eukaryotic, archaebacterial, eubacterial, plastidial, and mitochondrial origin. the algorithm involved computation and optimization of a dissimilarity matrix. according to the tree, only plant mitochondria belong to the eubacterial primary kingdom, whereas animal, fungal, algal, and ciliate mitochondria branch off from an internal node situated between the tree primary kingdoms. t ...19902111858
purification and characterization of a dna polymerase from the archaebacterium thermoplasma acidophilum.a thermophilic dna polymerase has been purified to near homogeneity from the archaebacterium thermoplasma acidophilum. analysis of the purified enzyme by sodium dodecyl sulfate gel electrophoresis revealed a single polypeptide of 88 kda which co-sediments with the dna polymerase activity on sucrose gradients. combination of sedimentation and gel filtration analyses indicates that this dna polymerase is an 88-kda monomeric enzyme in its native form. the dna polymerase is resistant to aphidicolin, ...19902115439
[the archaebacterial ribosome]. 19902181533
the primary structure of dna binding protein ii from the extreme thermophilic bacterium thermus thermophilus.the primary structure of dna binding protein ii (dna bp ii) from the extreme thermophilic bacterium thermus thermophilus has been established by combination of manual and automated techniques. the protein has 95 residues and a molecular mass of 11,843. comparison of the primary structure with the known sequence data of dna bp ii from clostridium pasteurineum, baccillus stearothermophilus, escherichia coli, rhizobium meliloti, anabena, thermoplasma acidophilum, pseudomonas aeruginosa and bacillus ...19902226865
citrate synthase from the thermophilic archaebacterium thermoplasma acidophilium. cloning and sequencing of the gene.the gene encoding the citric acid cycle enzyme, citrate synthase, has been cloned from the thermoacidophilic archaebacterium, thermoplasma acidophilum. we report the sequencing of this gene and its flanking regions, and the derived amino acid sequence of the enzyme is compared by multiple-sequence alignment analysis with those of citrate synthases from eubacterial and eukaryotic organisms. the similarity is less than 30% between the archaebacterial and non-archaebacterial sequences, although the ...19902269303
cloning and sequencing of the gene coding for the elongation factor 1 alpha from the archaebacterium thermoplasma acidophilum.the gene which encodes the elongation factor 1 alpha (ef-1 alpha) of the archaebacterium thermoplasma acidophilum (tuf-gene) has been cloned and sequenced. the gene coding for elongation factor ef-2 was found downstream from the 3' end of the tuf-gene. comparison of the predicted amino acid sequence of thermoplasma ef-1 alpha with ef-1 alpha sequences of other organisms showed that the highest similarity values were found between t. acidophilum and methanococcus vannielii.19902272495
physicochemical characterization of tetraether lipids from thermoplasma acidophilum. v. evidence for the existence of a metastable state in lipids with acyclic hydrocarbon chains.the main glycophospholipid of thermoplasma acidophilum, grown at 39 degrees c, is composed of a di-isopranol-2,3-glycerotetraether. it has been characterized in hydrated systems by calorimetry. unlike its equivalent grown at 59 degrees c, it shows complex phase properties, which include at least three different phases, (1) a liquid-analogue state (c), which is stable above 20 degrees c, (2) a metastable solid-analogue state (a) formed by supercooling of the liquid-analogue state (c) and (3) a st ...19902337621
organization and expression of the 16s, 23s and 5s ribosomal rna genes from the archaebacterium thermoplasma elucidate the organization of the transcription units encoding the 16s, 23s and 5s rrnas in the archaebacterium thermoplasma acidophilum, the nucleotide sequences flanking the three rrna genes were determined, and the 5' and 3' termini of the rrna transcripts were mapped by primer extension and nuclease s1 protection. the results show that each of the rrnas is transcribed separately, consistent with the lack of physical proximity among them in the t. acidophilum genome. the transcription init ...19901697064
the structure and organization of the 16s ribosomal rna gene from the archaebacterium thermoplasma acidophilum.the complete nucleotide sequence of the 16s rrna gene from thermoplasma acidophilum, as well as its 5' and 3' flanking regions, were determined by the dideoxynucleotide chain termination method. the 16s rrna gene encodes 1471 nucleotides. the primary and secondary structures of t. acidophilum 16s rrna both exhibit typical archaebacterial features. the sequence appears to be more closely related to 16s rrnas of the methanogen--halophile group than to those of the thermoacidophile group. secondary ...19892470478
phylogenetic conservation of antigenic determinants in archaebacterial elongation factors (tu proteins).by using affinity chromatography methods, we have purified elongation factor tu (ef-tu) proteins from a host of archaebacteria covering all known divisions in the archaebacterial tree except halophiles, and from such distantly related eubacteria as thermotoga maritima and escherichia coli. polyclonal antibodies were raised against the tu proteins of sulfolobus solfataricus, thermoproteus tenax, thermococcus celer, pyrococcus wosei, archaeoglobus fulgidus, methanococcus thermolitotrophicus, therm ...19892470483
the structure and evolution of archaebacterial ribosomal rnas.a cladistic analysis of 553 5s rrna sequences has revealed a ur-5s rrna, the ancestor of all present-day 5s rrna molecules. previously stated characteristic differences between the eubacterial and eukaryotic molecules, namely, the length base-pairing schemes of helices d, can be used as a marker for the various archaebacterial branches. one model comprises thermococcus, thermoplasma, methanobacteria, and halobacteria; a second comprises the sulfolobales; and a third is represented only by the si ...19892470487
comparison of initiating abilities of primers of different length in polymerization reactions catalyzed by dna polymerases from thermoacidophilic archaebacteria.optimal conditions for polymerization reaction catalyzed on poly(da) and poly(dt) templates by dna polymerases from thermoacidophilic archaebacteria--dna polymerase a from sulfolobus acidocaldarius and dna polymerase b from thermoplasma acidophilum--have been established. values of km and vmax (60 degrees c) for a set of primers d(pa)n and d(pt)n have been estimated. minimal primers for both enzymes are dnmp. lengthening of primers by each mononucleotide increases their affinity about 2.16-fold. ...19892497779
the multicatalytic proteinase (prosome) is ubiquitous from eukaryotes to archaebacteria.from the thermoacidophilic archaebacterium, thermoplasma acidophilum, a proteolytically active particle has been isolated which is almost identical in size and shape with the multicatalytic proteinase (prosome) from rat. this result indicates that prosomes have been developed early in evolution and that they possibly serve functions common to all living cells.19892502434
preliminary x-ray crystallographic study of malate dehydrogenases from the thermoacidophilic archaebacteria thermoplasma acidophilum and sulfolobus acidocaldarius.malate dehydrogenases from the thermoacidophilic archaebacteria thermoplasma acidophilum and sulfolobus acidocaldarius have been crystallized and characterized by x-ray diffraction measurements. crystals of the enzyme from t. acidophilum display space-group symmetry p2(1), a = 63 a, b = 135 a, c = 83 a and beta = 105 degrees; they scattered to approximately 4 a resolution. two crystal modifications of malate dehydrogenase from s. acidocaldarius were characterized; one displayed trigonal symmetry ...19892507788
phenotypic characterization of the archaebacterial genus sulfolobus: comparison of five wild-type strains.though amenable to routine manipulation and a popular subject of molecular genetic and biochemical studies on archaebacteria, the genus sulfolobus has remained poorly described in phenotypic terms. to delineate their physiological capabilities and diversity, five laboratory strains, including type strains of the described species sulfolobus acidocaldarius and s. solfataricus, were compared with respect to a variety of growth and biochemical parameters, including component profile of the surface- ...19892512283
phenylalanine-to-tyrosine singlet energy transfer in the archaebacterial histone-like protein hta.the archaebacterium thermoplasma acidophilum has a histone-like protein (hta) abundantly associated with its deoxyribonucleic acid. each native tetrameric complex of hta contains 20 phenylalanine residues, 4 tyrosine residues, and no tryptophan. when the protein was excited by radiation at 252 nm, which is a wavelength absorbed predominantly by phenylalanine, the fluorescent emission was mostly from tyrosine. according to the excitation spectrum for this tyrosine fluorescence, the cause was ener ...19892513885
studies on dna polymerases and topoisomerases in archaebacteria.we have isolated dna polymerases and topoisomerases from two thermoacidophilic archaebacteria: sulfolobus acidocaldarius and thermoplasma acidophilum. the dna polymerases are composed of a single polypeptide with molecular masses of 100 and 85 kda, respectively. antibodies against sulfolobus dna polymerase did not cross react with thermoplasma dna polymerase. whereas the major dna topoisomerase activity in s. acidocaldarius is an atp-dependent type i dna topoisomerase with a reverse gyrase activ ...19892541877
purification and characterization of glucose dehydrogenase from the thermoacidophilic archaebacterium thermoplasma acidophilum.glucose dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium thermoplasma acidophilum. the enzyme is a tetramer of polypeptide chain mr 38,000 +/- 3000, it is catalytically active with both nad+ and nadp+ cofactors, and it is thermostable and remarkably resistant to a variety of organic solvents. the amino acid composition was determined and compared with those of the glucose dehydrogenases from the archaebacterium sulfolobus solfataricus and the eubacteria bacill ...19892803257
archaebacteria: their phylogenetic relationship with the eubacterial and eukaryotic microbiology the discovery of archaebacteria ten years ago has wrought a profound change in the concepts of physiology, taxonomy, ecology, biochemistry, molecular biology, genetics and phylogeny. this review offers a concise summary of the state of the art in this field with special reference to taxonomy and ecology as well as to the different methodologies used to study the phylogeny of this unusual group of microorganisms that question many well established biological concepts.19882481476
5'-methylbenzimidazolyl-cobamides are the corrinoids from some sulfate-reducing and sulfur-metabolizing bacteria.the sulfate-reducing bacteria desulfobacterium autotrophicum, desulfobulbus propionicus and archaeoglobus fulgidus (vc-16) and the sulfur-metabolizing archaebacteria desulfurolobus ambivalens and thermoplasma acidophilum were found to contain considerable amounts of corrinoids, that were isolated and crystallized in their co beta-cyano form. in three other sulfur-metabolizing archaebacteria, thermoproteus neutrophilus, pyrodictium occultum and staphylothermus marinus significant amounts of corri ...19883416881
[biology of chemoautotrophs]. 19883150584
aminoglycoside-induced mistranslation in thermophilic archaebacteria.the effect of selected aminoglycoside antibiotics on the translational accuracy of poly(u) programmed ribosomes derived from the thermophilic archaebacteria thermoplasma acidophilum, sulfolobus solfataricus, thermococcus celer and desulfurococcus mobilis has been determined. under optimum temperature and ionic conditions for polyphenylalanine synthesis, the four species investigated are found to be markedly diverse in their response to the miscoding-inducing action of aminoglycoside antibiotics. ...19882465484
bacterial bedfellows: a microscopic menage a trois may be responsible for a major step in evolution. 198711542100
archaebacterial phylogeny: perspectives on the urkingdoms.comparisons of complete 16s ribosomal rna sequences have been used to confirm, refine and extend earlier concepts of archaebacterial phylogeny. the archaebacteria fall naturally into two major branches or divisions, i--the sulfur-dependent thermophilic archaebacteria, and ii--the methanogenic archaebacteria and their relatives. division i comprises a relatively closely related and phenotypically homogeneous collection of thermophilic sulfur-dependent species--encompassing the genera sulfolobus ...198611542063
characteristic archaebacterial 16s rrna oligonucleotides.a method of analyzing 16s rrna catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. this approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. this signature approach has been applied to forty archaebacterial catalogs and every oligonucleot ...198611542064
[prospects for using thermoacidophilic bacteria in biotechnology]. 19863078176
differential features of ribosomes and of poly(u)-programmed cell-free systems derived from sulphur-dependent archaebacterial species.the properties of poly(u)-directed cell-free systems developed from the sulphur-dependent, thermophilic archaebacteria desulfurococcus mobilis, thermoproteus tenax, sulfolobus solfataricus, thermococcus celer and thermoplasma acidophilum have been compared. all systems are truly thermophilic in requiring incubation at temperatures close to the physiological optimum for cell growth. under optimized conditions the error frequency in trna selection is less than 0.4% at 80 degrees c, and synthetic e ...19863087750
occurrence of coenzyme f420 and its gamma-monoglutamyl derivative in nonmethanogenic archaebacteria.analysis of the fluorescent compounds extracted from six different species of halobacteria and one species each of sulfolobus and thermoplasma revealed the universal occurrence of coenzyme f420, (n-[n-[o-[5-(8-hydroxy-5-deazaisoalloxazin-10-yl)-2,3,4-trihydroxy -4-pentoxyhydroxyphosphinyl]-l-lactyl]-l-gamma-glutamyl]-l -glutamic acid), or its gamma-monoglutamyl derivative or both. the total amount (approximately 100 pmol/mg [dry weight]) of these compounds found in the halobacteria studied was a ...19863093465
purification and properties of malate dehydrogenase from the thermoacidophilic archaebacterium thermoplasma acidophilum.malate dehydrogenase from the thermoacidophilic archaebacterium thermoplasma acidophilum is purified 50-fold to electrophoretic homogeneity. the purified enzyme crystallizes readily. native malate dehydrogenase shows a relative molecular mass of 144 000. it is a tetramer of identical subunits with a relative molecular mass of 36 600. malate dehydrogenase from thermoplasma uses both nadh and nadph as coenzyme to reduce oxaloacetate. the enzyme shows a-side (pro-r) stereospecificity for both coenz ...19863741624
glucose dehydrogenase from the thermoacidophilic archaebacterium sulfolobus solfataricus.glucose dehydrogenase has been purified to homogeneity from cell extracts of the extreme thermoacidophilic archaebacterium sulfolobus solfataricus. the enzyme utilizes both nad+ and nadp+ as coenzyme and catalyses the oxidation of several monosaccharides to the corresponding glyconic acid. substrate specificity and oxidation rate depend on the coenzyme present; when nad+ is used, the enzyme binds and oxidizes specifically sugars presenting equatorial orientation of hydroxy groups at c-2, c-3 and ...19863827812
improved procedure for the isolation of a double-strand-specific ribonuclease and its application to structural analysis of various 5s rrnas and improved method for the isolation of a double-strand-specific rnase from snake venom is presented. this rnase, called csv, was used to cleave yeast trnaphe and trna2glu and trnafmet from escherichia coli. in addition these rnas and e. coli trnaphe were examined with the single-strand-specific nuclease s1. the results are discussed in terms of the specificity of csv rnase and the structure of trnas. s1 nuclease digestions at increasing temperatures allowed the melting of tertiary and secondary ...19862417836
generation of a large, protonophore-sensitive proton motive force and ph difference in the acidophilic bacteria thermoplasma acidophilum and bacillus acidocaldarius.the mechanism by which acidophilic bacteria generate and maintain their cytoplasmic ph close to neutrality was investigated. for this purpose we determined the components of proton motive force in the eubacterium bacillus acidocaldarius and the archaebacterium thermoplasma acidophilum. after correction for probe binding, the proton motive force of untreated cells was 190 to 240 mv between external ph 2 and 4. anoxia diminished total proton motive force and the transmembrane ph difference by 60 t ...19852981803
archaebacterial malate dehydrogenases. the enzymes from the thermoacidophilic organisms sulfolobus acidocaldarius and thermoplasma acidophilum show a-side stereospecificity for nad+.the stereoselective transfer of hydrogen from nadh to oxaloacetate catalysed by malate dehydrogenases (ec from the thermoacidophilic archaebacteria sulfolobus acidocaldarius and thermoplasma acidophilum was studied by the p.m.r. method described by zhou & wong [(1981) j. biochem. biophys. methods 4, 329-338]. both enzymes are a-side (pro-r) stereospecific for nadh.19852985051
[evolutionary status of acids-thermophilie archaebacteria]. 19853906775
crystallization of a fe,zn superoxide dismutase from the archaebacterium thermoplasma acidophilium.the novel fe,zn superoxide dismutase from the archaebacterium thermoplasma acidophilium has been crystallized in space groups p1, p2(1) and p2(1)2(1)2, with 2,4 and 1/2 of an 84,000 mr tetramer, respectively, estimated to be in the asymmetric unit of the unit cell. the orthorhombic crystals, which have unit cell dimensions a = 84.2 a, b = 72.7 a, c = 67.8 a, diffract x-rays to at least 2.0 a and are suitable for a determination of the three-dimensional structure of the fe,zn superoxide dismutase ...19853935799
primary structure of elongation factor 2 around the site of adp-ribosylation is highly conserved from archaebacteria to eukaryotes.elongation factor 2 (ef-2) from eukaryotes and archaebacteria can be adp-ribosylated by diphtheria toxin (dt) [(1977) annu. rev. biochem. 46, 69-94; (1980) nature 287, 250-251]. the primary structure of the adp-ribose accepting region in efs from the archaebacteria thermoplasma acidophilum halobacterium cutirubrum and methanococcus vannielli was determined in order to elucidate the degree of conservation compared with 4 previously established eukaryotic sequences [(1971) febs lett. 103, 253-255] ...19853996598
preliminary x-ray diffraction studies on a ferredoxin from the thermophilic archaebacterium, thermoplasma acidophilum.a ferredoxin from the thermophilic archaebacterium, thermoplasma acidophilum, is supposed to contain two (4fe-4s) active centers; one center could be linked by four cysteine residues to the protein and the other bonded with three cysteines and an unknown group. this ferredoxin has been crystallized by salting-out against 2.3 m-ammonium sulfate solution. the space group is p21212 with cell dimensions of a = 59.20 a, b = 52.77 a and c = 41.28 a. four molecules pack in the unit cell with vm = 2.03 ...19854087301
membrane-bound atpase of a thermoacidophilic archaebacterium, sulfolobus acidocaldarius.the membranes of sulfolobus, a thermoacidophilic archaebacterium showed two types of atp hydrolyzing activity. one was that of a neutral atpase at an optimum ph around 6.5. this enzyme was activated by 10 mm sulfate with a shift of optimum ph to 5. in these respects, the enzyme was similar to membrane-bound atpase of thermoplasma, another thermoacidophilic archaebacterium, reported by searcy and whatley [1982) zbl. bakt. hyg., i. abt. orig. c3, 245-257). the enzyme hydrolyzed atp and other ntps, ...19853159431
symbiosis as a mechanism of evolution: status of cell symbiosis theory.several theories for the origin of eukaryotic (nucleated) cells from prokaryotic (bacterial) ancestors have been published: the progenote, the direct filiation and the serial endosymbiotic theory (set). compelling evidence for two aspects of the set is now available suggesting that both mitochondria and plastids originated by symbioses with a third type of microbe, probably a thermoplasma-like archaebacterium ancestral to the nucleocytoplasm. we conclude that not enough information is availab ...198511543608
cell symbiosis [correction of symbioisis] theory: status and implications for the fossil record.recent geological treatises have presented three alternative models of the origins of eukaryotes as if they merited equal treatment. however, modern biological techniques, especially nucleic acid and protein sequencing, have clearly established the validity of the symbiotic theory of the origin of eukaryotic organelles. the serial endosymbiotic theory in its most extreme form states that three classes of eukaryotic cell organelles (mitochondria, plastids and undulipodia) originated as free-liv ...198411537775
the phylogenetic relationships of three sulfur dependent archaebacteria.oligonucleotide catalogs have been determined for the 16s ribosomal rnas of three sulfur dependent (i.e. "thermoacidophilic") archaebacteria--sulfolobus acidocaldarius, s. solfataricus, and thermoproteus tenax. the three form a group specifically related to one another, but are only distantly related to the other archaebacteria--i.e. the group comprising the methanogens, extreme halophiles, and (peripherially) the genus thermoplasma. the three catalogs exhibit two features unique among bacteri ...198411541975
genome organization and transcription in archaebacteria.the genome organization of the archaebacteria is investigated in three model systems: a) rrna genes of various archaebacteria, b) a plasmid of 15.6 kb from sulfolobus acidocaldarius which exists in free or integrated form, c) the 59 kb genome of phage phi h of halobacterium halobium as a model for the unusual structural variability of dna in this organism. several variants of this phage have been isolated, their genomes differ by several insertions, a deletion, and an inversion. the frequent inv ...19846202564
lipoglycans from mycoplasmas.lipoglycans , distinguishable from bacterial lipopolysaccharides, are associated with the cytoplasmic membranes of several genera of mollicutes, namely acholeplasma, mycoplasma neurolyticum , anaeroplasma , and thermoplasma. structurally, the lipoglycans are long heteropolysaccharides covalently linked to a lipid. the exact structures of three have been determined. thermoplasma oligosaccharide is attached to a diglycerol tetraether ; a. granularum to a diacyl glycerol. the lipoglycan from a. axa ...19846375975
structural requirements for the interaction of 5s rrna with the eukaryotic transcription factor order to study the binding of the eukaryotic transcription factor iiia to heterologous 5s rrnas with a low degree of overall sequence conservation (less than 20%) we have utilized a transcription competition assay involving eubacterial, archaebacterial and eukaryotic 5s rrnas. all the molecules inhibit xenopus 5s rrna transcription specifically, which suggests that only a small amount of specific conserved rna sequences, if indeed any, are essential for the interaction of the transcription fa ...19846390342
on the memory of modern metabolism. 19846462691
the primary structure of the dna-binding protein ii from clostridium pasteurianum.the complete amino acid sequence of the clostridium pasteurianum dna-binding protein ii (dnab-ii) has been determined. the molecule contains 91 amino acid residues and has an mr of 10 133. sequence data were obtained from manual edman degradation, using the dabitc/pitc double-coupling of the tryptic, peptic, chymotryptic and staphylococcus protease peptides. a comparison of the amino acid sequence of the c. pasteurianum dnab-ii with those of the dnab-ii from escherichia coli, bacillus stearother ...19846541161
some properties of the histone-like protein from crypthecodinium cohnii (hcc).the histone-like protein from crypthecodinium cohnii (hcc) was examined in regard to its amino acid composition and the peptide pattern resulting from protease digestion. a revised amino acid composition indicated a higher lysine and arginine content and a lower glycine content than that determined previously. comparative peptide mapping of hcc with hta, a histone-like protein from thermoplasma acidophilum, and with a histone-like protein from the dinoflagellate gyrodinium dorsum showed signific ...19836687044
occurrence of diphthamide in archaebacteria.we examined the nature of the diphtheria toxin fragment a recognition site in the protein synthesis translocating factor present in cell-free preparations from the archaebacteria thermoplasma acidophilum and halobacterium halobium. in agreement with earlier work (m. kessel and f. klink, nature (london) 287:250-251, 1980), we found that extracts from these organisms contain a protein factor which is a substrate for the adp-ribosylation reaction catalyzed by diphtheria toxin fragment a. however, t ...19836402493
histone-like protein in the archaebacterium sulfolobus acidocaldarius.the archaebacterium thermoplasma acidophilum contains a basic chromosomal protein remarkably similar to the histones of eukaryotes. therefore, it was of interest to examine a different archaebacterium for similar proteins. we chose to examine sulfolobus acidocaldarius because it is thermophilic, like t. acidophilum, but nevertheless the two organisms are not particularly closely related. two major chromosomal proteins were found in s. acidocaldarius. the smaller of these was soluble in 0.2 m h2s ...19836418207
mycoplasma evolution: a review of the use of ribosomal and transfer rna nucleotide sequences in the determination of phylogenetic relationships.comparison of the nucleotide sequences of "structural" rnas (ribosomal and transfer rna) has enabled the construction of phylogenetic trees to be achieved. data from 16s rrna, 5s rrna, and trna from a total of eight mollicutes (excluding t. acidophilum) including representatives of the families mycoplasmataceae, spiroplasmataceae, and acholeplasmataceae, show that these families share a close relationship and a common ancestor with the gram-positive eubacteria. thermoplasma acidophilum is a memb ...19836206653
on the dna binding protein ii from bacillus stearothermophilus. ii. the amino acid sequence and its relation to those of homologous proteins from other prokaryotes.the complete amino acid sequence of dna binding protein ii from bacillus stearothermophilus has been determined. the protein contains 90 amino acid residues and has a calculated mr of 9716. the sequence is compared to homologous molecules from escherichia coli, thermoplasma acidophilum, and pseudomonas aeruginosa (where only a partial sequence is available). the b. stearothermophilus molecule has 58% and 59% residues identical with the two forms of the e. coli protein and 32% with the t. acidoph ...19836300069
ribosome specificity of archaebacterial elongation factor 2. studies with hybrid polyphenylalanine synthesis systems.polyphenylalanine synthesis with ribosomes and two separated, partially purified elongation factors (ef) was measured in cell-free systems from the archaebacteria thermoplasma acidophilum and methanococcus vannielii, in an eukaryotic system from rat liver and an eubacterial one with escherichia coli ribosomes and factors from thermus thermophilus. by substitution of heterologous ef-2 or ef-g, respectively, for the homologous factors, ribosome specificity was shown to be restricted to factors fro ...19836341085
physiology of acidophilic and alkalophilic bacteria. 19836364726
taxonomic relations between archaebacteria including 6 novel genera examined by cross hybridization of dnas and 16s rrnas.dnas from 16 species of archaebacteria including 6 novel isolates were hybridized with 16s rrnas from 7 species representing different orders or groups of the urkingdom of archaebacteria. the yields, normalized for the number of genes per microgram of dna, and the temperature stabilities of all hybrids were determined and related to each other. a taxonomic tree constructed from such fractional stability data reveals the same major divisions as that derived from comparative cataloging of 16s rrna ...19826178834
dna-dependent rna polymerase of thermoacidophilic archaebacteria.the component compositions of the dna-dependent rna polymerases of the extremely thermophilic, anaerobic sulfur-respiring archaebacteria thermoproteus tenax and desulfurococcus mucosus strongly resemble each other but also that of the rna polymerase of sulfolobus acidocaldarius suggesting that both organisms belong to the same novel order thermoproteales, which together with the order represented by sulfolobus, forms the thermoacidophilic branch of archaebacteria. the component pattern of the rn ...19826800790
thermoacidophilic archaebacteria contain bacterial-type ferredoxins acting as electron acceptors of 2-oxoacid:ferredoxin oxidoreductases.thermoplasma acidophilum and sulfolobus acidocaldarius contain coenzyme a-acylating 2-oxoacid:ferredoxin oxidoreductases similar to those found in halophilic archaebacteria. a common feature of these enzymes is the formation of a free radical intermediate in the course of the catalytic cycle. the electron-accepting ferredoxins and a similar protein from desulfurococcus mobilis have been purified and characterized. in contrast to the [2fe-2s] ferredoxin of halobacterium halobium, the ferredoxins ...19826816594
[archbacteria: living traces of primeval times]. 19826819474
low-angle x-ray scattering analysis of the thermoplasma acidophilum nucleoprotein subunit. 19827059610
evolution of major metabolic innovations in the precambrian.a combination of the information on the metabolic capabilities of prokaryotes with a composite phylogenetic tree depicting an overview of prokaryote evolution based on the sequences of bacterial ferredoxin, 2fe-2s ferredoxin, 5s ribosomal rna, and c-type cytochromes shows three zones of major metabolic innovation in the precambrian. the middle of these, which reflects the genesis of oxygen-releasing photosynthesis and aerobic respiration, links metabolic innovations of the anaerobic stem on the ...19827133672
component e of the dna-dependent rna polymerase of the archaebacterium thermoplasma acidophilum is required for the transcription of native dna.the role of component e of the dna-dependent rna polymerase of the archaebacterium thermoplasma acidophilum in the transcription of thermoplasma dna has been analyzed. component e (mr 22000) is released upon formation of the binary complex of the polymerase with the dna. enzyme not containing component e is inactive on dna but active on poly[d(a-t) x d(a-t)]. the activity on dna can be restored by addition of component e. two states of the binding complex between rna polymerase and dna, differin ...19827151810
organization of rrna structural genes in the archaebacterium thermoplasma the archaebacterium thermoplasma acidophilum, each of the structural genes for 5s, 16s and 23s rrna occur once per genome. in contrast to those of eubacteria and eukaryotes, they appear unlinked. the distance between the 16s and the 23s rdna is at least 7.5 kb, that between 23s and 5s rdna at least 6 kb and that between 16s and 5s rdna at least 1.5 kb. no linkage between those genes has been found by the analysis of recombinant plasmids carrying bam hi and hind iii rdna fragments as by hybrid ...19827155894
the nucleotide sequence of the 5s rrna from the archaebacterium thermoplasma acidophilum.the complete nucleotide sequence of the 5s ribosomal rna isolated from the archaebacterium thermoplasma acidophilum has been determined. the sequence is: pg gcaacggucauagcagcagggaaacaccagaucccauuccgaacucgacgguuaagccugcugcguauugcguuguacu guaugccgcgaggguacgggaagcgcaauaugcuguuaccac(u)oh. the homology with the 55 rrna from another archaebacterial species, halobacterium cutirubrum, is only 60.6% and other 55 rrnas are even less homologous. examination of the potential for forming secondary structure ...19817232209
superoxide dismutase from the archaebacterium thermoplasma acidophilum.thermoplasma acidophilum is a mycoplasma-like thermophilic organism that has been classified with the archaebacteria. it has a single superoxide dismutase (superoxide : superoxide oxidoreductase, ec which is composed of four identically sized subunits. it has a metal content per molecule of two atoms of iron and probably one of zinc and a molecular weight of 82 000. the amino acid composition is rich in tryptophan and is typical of the manganese or iron superoxide dismutases found in o ...19817272329
the nucleotide sequence of the trnammet from the archaebacterium thermoplasma acidophilum.using in vitro labelling techniques, a trnammet from thermoplasma acidophilum, a member of the archaebacteriae, has been shown to have the sequence: pgccggg gs4uggcucancuggaggagc m2(2)gccggacmucaut6aauccggaggucucggg psi psi cmgauccccgaucccggcaccaoh. despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. there is no ...19816913864
a mycoplasma-like archaebacterium possibly related to the nucleus and cytoplasms of eukaryotic cells. 19816941726
a histone-like protein (hta) from thermoplasma acidophilum. ii. complete amino acid sequence.the complete amino acid sequence of the dna-binding histone-like protein (hta) from thermoplasma acidophilum has been established by sequence studies directly on the protein and on tryptic, chymotryptic, and thermolysin peptides derived from the protein. the sequence of the 89-residue form of hta is: h2n-val-gly-ile-ser-glu-leu-ser-lys-glu-val-ala-lys-lys-ala-asn-thr-thr-gln-lys -val-ala-arg-thr-val-ile-lys-ser-phe-leu-asp-glu-ile-val-ser-glu-ala-asn-gly-gl y-gln-lys-ile-asn-leu-ala-gly-phe-gly- ...19817005226
a histone-like protein (hta) from thermoplasma acidophilum. i. purification and properties.a histone-like protein (hta) has been isolated from cell extracts of thermoplasma acidophilum by column chromatography on dna-cellulose, hydroxylapatite, and sephadex g-75, hta elutes from dna-cellulose in two fractions, one of which contains an 80-residue form of the protein with an nh2-terminal sequence of val-gly. the other fraction apparently contains the 89-residue species, in addition to a 90-residue form of the protein with the nh2-terminal sequence met-val. the sequence of 47 residues fr ...19817451480
phylogenetic analysis of the mycoplasmas.the phylogenetic relationships between the mycoplasmas and bacteria have been established from a comparative analysis of their 16s rrna oligonucleotide catalogs. the genera mycoplasma, spiroplasma, and acholeplasma arose by degenerative evolution, as a deep branch of the subline of clostridial ancestry that led to bacillus and lactobacillus. thermoplasma has no specific relationship to the other mycoplasmas; it belongs with the archaebacteria.19806928642
nucleoprotein subunit structure in an unusual prokaryotic organism: thermoplasma acidophilum.the freeliving thermophilic mycoplasma, thermoplasma acidophilum, has a small acid-soluble protein tightly bound to its dna. this protein is similar to eukaryotic histones in both size and amino acid composition. here we report that the protein condenses dna into globular particles that are about half the size of eukaryotic nucleosomes. our conclusions are based primarily upon the following observations: (1) nuclease digestion produced dna fragments of 40 base-pairs. (2) the ratio of protein to ...19807407183
thermoplasma acidophilum histone-like protein. partial amino acid sequence suggestive of homology to eukaryotic histones.thermoplasma acidophilum is a freeliving mycoplasma-like organism that has a small basic protein tightly bound to its dna. the n-terminal sequence of this protein has been determined. it has a distanct but statistically significant homology to eukaryotic histones h2a, h3, and to escherichia coli protein hu.19807407184
sequence and glycosidic bond arrangement of sugars in lipopolysaccharide from thermoplasma acidophilum.the lipopolysaccharide from thermoplasma acidophilum is a linear polymer with the structure [manp-(alpha 1 leads to 2)-manp-(alpha 1 leads to 4)-manp-(alpha 1 leads to 3)]8-glcp-(alpha 1 leads to 1)-diglycerol tetraether as established by smith degradation, methylation, acetolysis and cro3 oxidation.19807407218
endotoxin-like activities of mycoplasmal lipopolysaccharides (lipoglycans).lipoglycans (previously designated lipopolysaccharides) from several species of acholeplasma and from thermoplasma acidophilum were examined for endotoxin-like activities as measured by the standard rabbit fever test and the limulus amoebocyte lysate assay. the lipoglycans from acholeplasma granularum, achloplasma laidlawii, acholeplasma modicum, and acholeplasma oculi caused a febrile response at concentrations of 1 ng/ml per kg or greater, whereas with control escherichia coli ec-2 lipopolysac ...19807429642
archaebacterial elongation factor is adp-ribosylated by diphtheria toxin.archaebacteria have been defined as a 'third primary kingdom' of cells in addition to the urkaryotes and the eubacteria. while the latter two correspond approximately to the conventional categories eukaryotes and prokaryotes respectively, the archaebacteria have up to now comprised four groups of microorganisms: the methanogenic bacteria, the extremely halophilic bacteria and the two thermoacidophilic genera sulfolobus and thermoplasma. based on ribosomal rna sequence homologies and lipid compos ...19806776409
physiology of thermophilic bacteria. 197995242
structure of membrane lipids and physico-biochemical properties of the plasma membrane from thermoplasma acidophilum, adapted to growth at 37 degrees c.thermoplasma acidophilum, a mycoplasma-like organism, grows optimally at 56 degrees c and ph2. the low temperature extreme of growth is 37 degrees c. the plasma membrane of cells grown at 37 degrees c was isolated and characterized physicobiochemically. membrane lipids which comprise 25% of the membrane dry weight consist mainly of two repetitively methyl-branched c40 side chains that were ether-linked to two glycerol molecules. the lipid structures were elucidated by combined gas chromatography ...1979221032
squalenes, phytanes and other isoprenoids as major neutral lipids of methanogenic and thermoacidophilic "archaebacteria".the neutral lipids of nine species of methanogenic bacteria including five methanobacilli, two methanococci, a methanospirillum, one methanosarcina as well as two thermoacidophilic bacteria, thermoplasma and sulfolobus, were analyzed. the major components were c30, c25 and/or c20 acylic isoprenoid hydrocarbons with a continuous range of hydroisoprenoid homologues. the range of acyclic isoprenoids detected were from c14 to c30. apart from methanosarcina barkeri, squalene and/or hydrosqualene deri ...1979458874
purification and partial characterization of a procaryotic glycoprotein from the plasma membrane of thermoplasma acidophilum.the obligate, thermophilic, acidophilic mycoplasma, thermoplasma acidophilum, grows optimally at 56 degrees c and ph 2.0. its plasma membrane possessed 21--22 protein bands that were resolved by polyacrylamide gel electrophoresis. one major membrane protein, molecular weight 152 000, which stained for carbohydrate with periodic acid-schiff reagent, accounted for 32% (w/w) of the total membrane proteins. it was isolated and further purified by concanavalin a affinity chromatography. the carbohydr ...1979534627
the evolution of histones in relationship to recent advances in elucidating chromatin structure. 1979555823
Displaying items 401 - 500 of 527