Publications

TitleAbstractYear
Filter
PMID
Filter
on the dna binding protein ii from bacillus stearothermophilus. ii. the amino acid sequence and its relation to those of homologous proteins from other prokaryotes.the complete amino acid sequence of dna binding protein ii from bacillus stearothermophilus has been determined. the protein contains 90 amino acid residues and has a calculated mr of 9716. the sequence is compared to homologous molecules from escherichia coli, thermoplasma acidophilum, and pseudomonas aeruginosa (where only a partial sequence is available). the b. stearothermophilus molecule has 58% and 59% residues identical with the two forms of the e. coli protein and 32% with the t. acidoph ...19836300069
ribosome specificity of archaebacterial elongation factor 2. studies with hybrid polyphenylalanine synthesis systems.polyphenylalanine synthesis with ribosomes and two separated, partially purified elongation factors (ef) was measured in cell-free systems from the archaebacteria thermoplasma acidophilum and methanococcus vannielii, in an eukaryotic system from rat liver and an eubacterial one with escherichia coli ribosomes and factors from thermus thermophilus. by substitution of heterologous ef-2 or ef-g, respectively, for the homologous factors, ribosome specificity was shown to be restricted to factors fro ...19836341085
physiology of acidophilic and alkalophilic bacteria. 19836364726
lipoglycans from mycoplasmas.lipoglycans , distinguishable from bacterial lipopolysaccharides, are associated with the cytoplasmic membranes of several genera of mollicutes, namely acholeplasma, mycoplasma neurolyticum , anaeroplasma , and thermoplasma. structurally, the lipoglycans are long heteropolysaccharides covalently linked to a lipid. the exact structures of three have been determined. thermoplasma oligosaccharide is attached to a diglycerol tetraether ; a. granularum to a diacyl glycerol. the lipoglycan from a. axa ...19846375975
structural requirements for the interaction of 5s rrna with the eukaryotic transcription factor iiia.in order to study the binding of the eukaryotic transcription factor iiia to heterologous 5s rrnas with a low degree of overall sequence conservation (less than 20%) we have utilized a transcription competition assay involving eubacterial, archaebacterial and eukaryotic 5s rrnas. all the molecules inhibit xenopus 5s rrna transcription specifically, which suggests that only a small amount of specific conserved rna sequences, if indeed any, are essential for the interaction of the transcription fa ...19846390342
occurrence of diphthamide in archaebacteria.we examined the nature of the diphtheria toxin fragment a recognition site in the protein synthesis translocating factor present in cell-free preparations from the archaebacteria thermoplasma acidophilum and halobacterium halobium. in agreement with earlier work (m. kessel and f. klink, nature (london) 287:250-251, 1980), we found that extracts from these organisms contain a protein factor which is a substrate for the adp-ribosylation reaction catalyzed by diphtheria toxin fragment a. however, t ...19836402493
histone-like protein in the archaebacterium sulfolobus acidocaldarius.the archaebacterium thermoplasma acidophilum contains a basic chromosomal protein remarkably similar to the histones of eukaryotes. therefore, it was of interest to examine a different archaebacterium for similar proteins. we chose to examine sulfolobus acidocaldarius because it is thermophilic, like t. acidophilum, but nevertheless the two organisms are not particularly closely related. two major chromosomal proteins were found in s. acidocaldarius. the smaller of these was soluble in 0.2 m h2s ...19836418207
on the memory of modern metabolism. 19846462691
the primary structure of the dna-binding protein ii from clostridium pasteurianum.the complete amino acid sequence of the clostridium pasteurianum dna-binding protein ii (dnab-ii) has been determined. the molecule contains 91 amino acid residues and has an mr of 10 133. sequence data were obtained from manual edman degradation, using the dabitc/pitc double-coupling of the tryptic, peptic, chymotryptic and staphylococcus protease peptides. a comparison of the amino acid sequence of the c. pasteurianum dnab-ii with those of the dnab-ii from escherichia coli, bacillus stearother ...19846541161
some properties of the histone-like protein from crypthecodinium cohnii (hcc).the histone-like protein from crypthecodinium cohnii (hcc) was examined in regard to its amino acid composition and the peptide pattern resulting from protease digestion. a revised amino acid composition indicated a higher lysine and arginine content and a lower glycine content than that determined previously. comparative peptide mapping of hcc with hta, a histone-like protein from thermoplasma acidophilum, and with a histone-like protein from the dinoflagellate gyrodinium dorsum showed signific ...19836687044
archaebacterial elongation factor is adp-ribosylated by diphtheria toxin.archaebacteria have been defined as a 'third primary kingdom' of cells in addition to the urkaryotes and the eubacteria. while the latter two correspond approximately to the conventional categories eukaryotes and prokaryotes respectively, the archaebacteria have up to now comprised four groups of microorganisms: the methanogenic bacteria, the extremely halophilic bacteria and the two thermoacidophilic genera sulfolobus and thermoplasma. based on ribosomal rna sequence homologies and lipid compos ...19806776409
dna-dependent rna polymerase of thermoacidophilic archaebacteria.the component compositions of the dna-dependent rna polymerases of the extremely thermophilic, anaerobic sulfur-respiring archaebacteria thermoproteus tenax and desulfurococcus mucosus strongly resemble each other but also that of the rna polymerase of sulfolobus acidocaldarius suggesting that both organisms belong to the same novel order thermoproteales, which together with the order represented by sulfolobus, forms the thermoacidophilic branch of archaebacteria. the component pattern of the rn ...19826800790
thermoacidophilic archaebacteria contain bacterial-type ferredoxins acting as electron acceptors of 2-oxoacid:ferredoxin oxidoreductases.thermoplasma acidophilum and sulfolobus acidocaldarius contain coenzyme a-acylating 2-oxoacid:ferredoxin oxidoreductases similar to those found in halophilic archaebacteria. a common feature of these enzymes is the formation of a free radical intermediate in the course of the catalytic cycle. the electron-accepting ferredoxins and a similar protein from desulfurococcus mobilis have been purified and characterized. in contrast to the [2fe-2s] ferredoxin of halobacterium halobium, the ferredoxins ...19826816594
[archbacteria: living traces of primeval times]. 19826819474
the nucleotide sequence of the trnammet from the archaebacterium thermoplasma acidophilum.using in vitro labelling techniques, a trnammet from thermoplasma acidophilum, a member of the archaebacteriae, has been shown to have the sequence: pgccggg gs4uggcucancuggaggagc m2(2)gccggacmucaut6aauccggaggucucggg psi psi cmgauccccgaucccggcaccaoh. despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. there is no ...19816913864
phylogenetic analysis of the mycoplasmas.the phylogenetic relationships between the mycoplasmas and bacteria have been established from a comparative analysis of their 16s rrna oligonucleotide catalogs. the genera mycoplasma, spiroplasma, and acholeplasma arose by degenerative evolution, as a deep branch of the subline of clostridial ancestry that led to bacillus and lactobacillus. thermoplasma has no specific relationship to the other mycoplasmas; it belongs with the archaebacteria.19806928642
a mycoplasma-like archaebacterium possibly related to the nucleus and cytoplasms of eukaryotic cells. 19816941726
a histone-like protein (hta) from thermoplasma acidophilum. ii. complete amino acid sequence.the complete amino acid sequence of the dna-binding histone-like protein (hta) from thermoplasma acidophilum has been established by sequence studies directly on the protein and on tryptic, chymotryptic, and thermolysin peptides derived from the protein. the sequence of the 89-residue form of hta is: h2n-val-gly-ile-ser-glu-leu-ser-lys-glu-val-ala-lys-lys-ala-asn-thr-thr-gln-lys -val-ala-arg-thr-val-ile-lys-ser-phe-leu-asp-glu-ile-val-ser-glu-ala-asn-gly-gl y-gln-lys-ile-asn-leu-ala-gly-phe-gly- ...19817005226
low-angle x-ray scattering analysis of the thermoplasma acidophilum nucleoprotein subunit. 19827059610
evolution of major metabolic innovations in the precambrian.a combination of the information on the metabolic capabilities of prokaryotes with a composite phylogenetic tree depicting an overview of prokaryote evolution based on the sequences of bacterial ferredoxin, 2fe-2s ferredoxin, 5s ribosomal rna, and c-type cytochromes shows three zones of major metabolic innovation in the precambrian. the middle of these, which reflects the genesis of oxygen-releasing photosynthesis and aerobic respiration, links metabolic innovations of the anaerobic stem on the ...19827133672
component e of the dna-dependent rna polymerase of the archaebacterium thermoplasma acidophilum is required for the transcription of native dna.the role of component e of the dna-dependent rna polymerase of the archaebacterium thermoplasma acidophilum in the transcription of thermoplasma dna has been analyzed. component e (mr 22000) is released upon formation of the binary complex of the polymerase with the dna. enzyme not containing component e is inactive on dna but active on poly[d(a-t) x d(a-t)]. the activity on dna can be restored by addition of component e. two states of the binding complex between rna polymerase and dna, differin ...19827151810
organization of rrna structural genes in the archaebacterium thermoplasma acidophilum.in the archaebacterium thermoplasma acidophilum, each of the structural genes for 5s, 16s and 23s rrna occur once per genome. in contrast to those of eubacteria and eukaryotes, they appear unlinked. the distance between the 16s and the 23s rdna is at least 7.5 kb, that between 23s and 5s rdna at least 6 kb and that between 16s and 5s rdna at least 1.5 kb. no linkage between those genes has been found by the analysis of recombinant plasmids carrying bam hi and hind iii rdna fragments as by hybrid ...19827155894
the nucleotide sequence of the 5s rrna from the archaebacterium thermoplasma acidophilum.the complete nucleotide sequence of the 5s ribosomal rna isolated from the archaebacterium thermoplasma acidophilum has been determined. the sequence is: pg gcaacggucauagcagcagggaaacaccagaucccauuccgaacucgacgguuaagccugcugcguauugcguuguacu guaugccgcgaggguacgggaagcgcaauaugcuguuaccac(u)oh. the homology with the 55 rrna from another archaebacterial species, halobacterium cutirubrum, is only 60.6% and other 55 rrnas are even less homologous. examination of the potential for forming secondary structure ...19817232209
superoxide dismutase from the archaebacterium thermoplasma acidophilum.thermoplasma acidophilum is a mycoplasma-like thermophilic organism that has been classified with the archaebacteria. it has a single superoxide dismutase (superoxide : superoxide oxidoreductase, ec 1.15.1.1) which is composed of four identically sized subunits. it has a metal content per molecule of two atoms of iron and probably one of zinc and a molecular weight of 82 000. the amino acid composition is rich in tryptophan and is typical of the manganese or iron superoxide dismutases found in o ...19817272329
nucleoprotein subunit structure in an unusual prokaryotic organism: thermoplasma acidophilum.the freeliving thermophilic mycoplasma, thermoplasma acidophilum, has a small acid-soluble protein tightly bound to its dna. this protein is similar to eukaryotic histones in both size and amino acid composition. here we report that the protein condenses dna into globular particles that are about half the size of eukaryotic nucleosomes. our conclusions are based primarily upon the following observations: (1) nuclease digestion produced dna fragments of 40 base-pairs. (2) the ratio of protein to ...19807407183
thermoplasma acidophilum histone-like protein. partial amino acid sequence suggestive of homology to eukaryotic histones.thermoplasma acidophilum is a freeliving mycoplasma-like organism that has a small basic protein tightly bound to its dna. the n-terminal sequence of this protein has been determined. it has a distanct but statistically significant homology to eukaryotic histones h2a, h3, and to escherichia coli protein hu.19807407184
sequence and glycosidic bond arrangement of sugars in lipopolysaccharide from thermoplasma acidophilum.the lipopolysaccharide from thermoplasma acidophilum is a linear polymer with the structure [manp-(alpha 1 leads to 2)-manp-(alpha 1 leads to 4)-manp-(alpha 1 leads to 3)]8-glcp-(alpha 1 leads to 1)-diglycerol tetraether as established by smith degradation, methylation, acetolysis and cro3 oxidation.19807407218
endotoxin-like activities of mycoplasmal lipopolysaccharides (lipoglycans).lipoglycans (previously designated lipopolysaccharides) from several species of acholeplasma and from thermoplasma acidophilum were examined for endotoxin-like activities as measured by the standard rabbit fever test and the limulus amoebocyte lysate assay. the lipoglycans from acholeplasma granularum, achloplasma laidlawii, acholeplasma modicum, and acholeplasma oculi caused a febrile response at concentrations of 1 ng/ml per kg or greater, whereas with control escherichia coli ec-2 lipopolysac ...19807429642
a histone-like protein (hta) from thermoplasma acidophilum. i. purification and properties.a histone-like protein (hta) has been isolated from cell extracts of thermoplasma acidophilum by column chromatography on dna-cellulose, hydroxylapatite, and sephadex g-75, hta elutes from dna-cellulose in two fractions, one of which contains an 80-residue form of the protein with an nh2-terminal sequence of val-gly. the other fraction apparently contains the 89-residue species, in addition to a 90-residue form of the protein with the nh2-terminal sequence met-val. the sequence of 47 residues fr ...19817451480
an archaebacterial elf-1a: new grist for the mill. 19957494488
a proteasome from the methanogenic archaeon methanosarcina thermophila.a 645-kda proteasome was purified from methanosarcina thermophila which had chymotrypsin-like and peptidylglutamyl-peptide hydrolase activities and contained alpha (24-kda) and beta (22-kda) subunits. processing of both subunits was suggested by comparison of n-terminal sequences with the sequences deduced from the alpha- and beta-encoding genes (psma and psmb). alignment of deduced sequences for the alpha and beta subunits revealed high similarity; however, the n-terminal sequence of the alpha ...19957499378
proteasome-associated rnas are non-specific.the rna isolated from rnase-treated proteasome preparations from human erythrocytes, hela cells, the archaeon thermoplasma acidophilum and also from recombinant proteasomes of t. acidophilum expressed in escherichia coli was characterized. the rna associated with structurally similar protein particles, namely with the two molecular chaperones, groel from e. coli and with the thermosome from t. acidophilum, served as controls. electrophoretic analysis on polyacrylamide gels of the radioactively e ...19947525280
life at extremely low ph. 19957541113
epr characterization of an archaeal succinate dehydrogenase in the membrane-bound state.the membrane-bound succinate dehydrogenase from the thermoacidophilic archaeon thermoplasma acidophilum was characterized by epr spectroscopy and its functional properties were determined. the highest turnover values of succinate dehydrogenase activity were observed at ph 7.4, which is somewhat above the internal ph value of t. acidophilum. the temperature optimum of the reaction was determined as 78 degrees c and the km value for succinate using phenazine methosulfate as the electron acceptor a ...19957556208
structural features of archaebacterial and eukaryotic proteasomes.the 26s proteasome is the central protease of the ubiquitin-dependent pathway of protein degradation. the molecule has a molecular mass of approximately 2000 kd and has a highly conserved structure in eukaryotes. the 26s proteasome is formed by a barrel-shaped 20s core complex and two polar 19s complexes. the 20s complex has c2 symmetry and is formed by four seven-membered rings of which the outer rings (alpha-type subunits) are rotated by 25.7 degrees relative to the inner rings while the inner ...19957565658
catalytic components of proteasomes and the regulation of proteinase activity.the proteasome (multicatalytic proteinase complex) is a large multimeric complex which is found in the nucleus and cytoplasm of eukaryotic cells. it plays a major role in both ubiquitin-dependent and ubiquitin-independent nonlysosomal pathways of protein degradation. proteasome subunits are encoded by members of the same gene family and can be divided into two groups based on their similarity to the alpha and beta subunits of the simpler proteasome isolated from thermoplasma acidophilum. proteas ...19957565662
morphological variation of new thermoplasma acidophilum isolates from japanese hot springs.we isolated 12 strains of thermoplasma acidophilum from hot springs in hakone, japan. t. acidophilum strains showed morphological variation in the crystal-like structure in the cell and the fibrous structure on the cell surface. two strains tested were sensitive to novobiocin. however, a novobiocin-resistant mutant was obtained by spontaneous mutation.19957574659
molecular cloning of two types of cdna encoding subunit rc6-i of rat proteasomes.a new subunit, named rc6-i, of the rat 20 s proteasome was purified and the partial amino acid sequences of several peptide fragments obtained by digestion with lysyl-endopeptidase were determined by edman degradation. amplification of cdnas encoding rc6-i by the polymerase chain reaction (pcr) technique revealed two types of cdna, tentatively designated as rc6-il and rc6-is in order of size. the nucleotide sequences of the two cdnas are identical except that rc6-il contains an insertion of 18 n ...19957578256
proteolysis. the proteasome: a protein-degrading organelle?the crystal structure of the proteasome suggests that degradation of ubiquitin-protein conjugates is achieved by unfolding the protein substrate and translocating it through a channel into a peptidase-containing chamber.19957583140
critical elements in proteasome assembly.coexpression of both subunits of the thermoplasma proteasome in escherichia coli yields fully assembled and proteolytically active proteasomes. post-translational processing of the beta-subunit occurs in e. coli as it does in thermoplasma. coexpression of the alpha-subunit and the beta delta pro-subunit, a mutant beta-subunit lacking the propeptide, also yields fully assembled and active proteasomes. this indicates that the beta-propeptide is not essential for the folding and assembly of thermop ...19947634086
structure of the archaeal transfer rna nucleoside g*-15 (2-amino-4,7-dihydro- 4-oxo-7-beta-d-ribofuranosyl-1h-pyrrolo[2,3-d]pyrimidine-5-carboximi dam ide (archaeosine)).a number of post-transcriptional modifications in trna are phylogenetically characteristic of the bacterial, eukaryal, or archaeal domains, both with respect to sequence location and molecular structure at the nucleoside level. one of the most distinct such modifications is nucleoside g*, located in archaeal trna at position 15, which in bacterial and eukaryal trnas is a conserved site involved in maintenance of the dihydrouridine loop-t-loop tertiary interactions. g* occurs widely in nearly eve ...19937683667
structural features of 26s and 20s proteasomes.the 26s proteasome is the central protease of the ubiquitin-dependent pathway of protein degradation and has a highly conserved structure from slime molds to humans. the elongated molecule which has a molecular mass of approximately 2,000 kd is formed by a barrel-shaped 20s core complex and two polar 19s complexes. the 20s complex has c2 symmetry and is built by four seven-membered rings of which the outer rings are rotated by 26 degrees relative to the inner rings while the inner rings are in r ...19937697124
the crystal structure of citrate synthase from the thermophilic archaeon, thermoplasma acidophilum.the archaea constitute a phylogenetically distinct, evolutionary domain and comprise organisms that live under environmental extremes of temperature, salinity and/or anaerobicity. different members of the thermophilic archaea tolerate temperatures in the range 55-110 degrees c, and the comparison of the structures of their enzymes with the structurally homogolous enzymes of mesophilic organisms (optimum growth temperature range 15-45 degrees c) may provide important information on the structural ...19947704526
phylogenetic analysis of 70 kd heat shock protein sequences suggests a chimeric origin for the eukaryotic cell nucleus.the evolutionary relationships between archaebacteria, eubacteria and eukaryotic cells are of central importance in biology. the current view is that each of these three groups of organisms constitutes a monophyletic domain, and that eukaryotic cells have evolved fom an archaebacterial ancestor. recent studies on a number of highly conserved protein sequences do not, however, support this view and raise important questions concerning the evolutionary relationships between all extant organisms, p ...19947704574
gene of heat shock protein of sulfur-dependent archaeal hyperthermophile desulfurococcus.to elucidate thermoresistance, a gene of a hyperthermophilic heat shock protein (hhsp) was isolated from the hyperthermophile desulfurococcus strain sy which grows at 95 degrees c. the molecular weight of hhsp deduced from the open reading frame was 59,137 (545 amino acid residues). sequence alignments of peptides reveal similarities (evolutionary distances) to the alpha (0.279) and beta (0.296) subunits of thermosome, tf55 (0.343) and human t-complex polypeptide 1. the structure of a thermophil ...19957677788
sighting the cellular shredder. 19957664100
proteasome: a complex protease with a new fold and a distinct mechanism.the structure of the proteasome from thermoplasma acidophilum introduces threonine proteases as a fifth class of proteolytic enzymes, and offers insights into the catalytic activity of this complicated piece of molecular machinery with its 14 active sites.19957663937
the 1.5-nm projection structure of hela cell prosome-mcp (proteasome) provided by two-dimensional crystals.we grew two-dimensional crystals of hela cell prosomes, also called multicatalytic proteinases (mcp) and proteasomes, for a structure determination by electron microscopy. the molecules were arranged in side views in these crystals. the crystals have p21 plane group symmetry with one particle per unit cell. this symmetry confirms previously published evidence indicating that eukaryotic prosome-mcps are dimers of two identical halves. structure factors from six crystals each comprising more than ...19947718362
proteasome from thermoplasma acidophilum: a threonine protease.the catalytic mechanism of the 20s proteasome from the archaebacterium thermoplasma acidophilum has been analyzed by site-directed mutagenesis of the beta subunit and by inhibitor studies. deletion of the amino-terminal threonine or its mutation to alanine led to inactivation of the enzyme. mutation of the residue to serine led to a fully active enzyme, which was over ten times more sensitive to the serine protease inhibitor 3,4-dichloroisocoumarin. in combination with the crystal structure of a ...19957725107
functions of the proteasome: the lysis at the end of the tunnel. 19957725095
archaebacterial and eukaryotic proteasomes prefer different sites in cleaving gonadotropin-releasing hormone.thermoplasma 20 s proteasomes are composed of only two different types of subunits (designated as alpha and beta) but are nearly indistinguishable in their quaternary structure from eukaryotic 20 s proteasomes consisting of 14 distinct subunits. in this study, we compared both the nature and the rate of the proteolytic activities of thermoplasma and of granulosa cell proteasomes on the neurohormone, gonadotropin-releasing hormone (gnrh), the degradation products of which can be unequivocally ide ...19957744730
conformational constraints in protein degradation by the 20s proteasome.conformationally stabilized peptides and unfolding intermediates of bovine alpha-lactalbumin have been used to define the degree of unfolding required for degradation by 20s proteasomes. it appears that complete unfolding and the absence of disulphide bonds are prerequisites for degradation, suggesting that a relatively narrow opening controls access to the inner proteolytic compartment of the barrel-shaped proteasome. this is corroborated by electron microscopy studies showing that the insulin ...19957773788
from the cradle to the grave: ring complexes in the life of a protein. 19957725096
crystal structure of the 20s proteasome from the archaeon t. acidophilum at 3.4 a resolution.the three-dimensional structure of the proteasome from the archaebacterium thermoplasma acidophilum has been elucidated by x-ray crystallographic analysis by means of isomorphous replacement and cyclic averaging. the atomic model was built and refined to a crystallographic r factor of 22.1 percent. the 673-kilodalton protease complex consists of 14 copies of two different subunits, alpha and beta, forming a barrel-shaped structure of four stacked rings. the two inner rings consist of seven beta ...19957725097
the thermoplasma acidophilum rpl15 gene encodes a homologue of eukaryotic ribosomal proteins l15/yl10.a gene has been cloned from the archaebacterium, thermoplasma acidophilum, which, on the basis of the deduced amino acid sequence, encodes a homologue of the eukaryotic large subunit ribosomal proteins, l15/yl10. this gene, rpl15, was identified as an open reading frame (orf) located 2.3 kb upstream of the gene encoding the alpha-subunit of the t. acidophilum proteasome. the putative translation product of rpl15 (rpl15) contains 197 amino acid residues, with a m(r) of 22,928 and a basic pi of 11 ...19957733938
the thermosome of thermoplasma acidophilum and its relationship to the eukaryotic chaperonin tric.a high molecular-mass protein complex from the archaebacterium thermoplasma acidophilum, referred to here as the 'thermosome', is built from two subunits (m(r) 58 and 60). the thermosome has been purified to homogeneity. the molecular mass of the native complex was determined to be 1061 +/- 30 da by scanning transmission electron microscopy. it shows a weak atpase activity and is able to bind denatured polypeptides. averages obtained from electron micrographs of negatively stained molecules in t ...19957867646
the proteasome from thermoplasma acidophilum is neither a cysteine nor a serine protease.the 20 s proteasome, found in eukaryotes and in the archaebacterium thermoplasma acidophilum, forms the proteolytic core of the 26 s proteasome which is the central protease of the non-lysosomal protein degradation pathway. inhibitor studies have indicated that the 20 s proteasome may be an unusual type of cysteine or serine protease and a recent study of the thermoplasma beta subunit has indicated that it carries the proteolytic activity. we have attempted to obtain information on the nature of ...19957867793
primary structure of the thermosome from thermoplasma acidophilum.the thermosome, a chaperonin from the archaebacterium thermoplasma acidophilum, consists of two subunits (m(r) 58,000 and 60,000) which assemble into a cylindrical complex of pseudo eight-fold rotational symmetry. the sequences of the two subunits are approximately 60% identical to each other and to tf55 from sulfolobus shibatae, and are 30-40% identical to the subunits of the tcp1 containing ring complex (tric) from the eukaryotic cytosol. a dendrogram of this family of chaperonins contains eig ...19957794526
occurrence of tertiary and quaternary branched polyamines in thermophilic archaebacteria.polyamines of thermophilic archaebacteria were analysed by high-performance liquid chromatography and gas chromatography. thermoplasma acidophilum and thermoplasma volcanium ubiquitously contained spermidine and spermine. four species of sulfolobus, s. acidocaldarius, s. solfataricus, s. metallicus and s. shibatae, two species of acidianus, a. brierleyi and a. infernus, and metallosphaera sedula, contained norspermidine and norspermine in addition to spermidine and spermine, but quantitative dis ...19947968661
[a new species of thermoplasma].an extremely thermoacidophilic strain, es-23, was isolated from a self-heating coal spoil pile, sichuan, china. the new isolate grows between 50 and 75 degrees c with optimum 70 degrees c and ph 1.0-5.0 with optimum 2.0. strain es-23 is aerobic and facultative autotrophic depending both heterotrophically on organic compounds and autotrophically on elemental sulfur as energy source and co2 as carbon source. g-, spherical or oval with 0.9-1.5 microns in diameter. the autotrophic growth showed peri ...19947801633
proteasome sequences in eubacteria. 19947846763
molecular characterization of the "26s" proteasome complex from rat liver.the molecular properties of an atp/ubiquitin-dependent "26s" proteasome complex purified from rat liver were examined by physicochemical, biochemical, and morphological analyses. on ultracentrifugation, the proteasome complex sedimented as almost a single component with a sedimentation coefficient of 30.3s. dynamic light-scattering measurements indicated that it has a diffusion coefficient of 1.38 x 10(-7) cm2/sec and a stokes radius of 15.5 nm. from these two coefficients, the protein complex w ...19938003381
existence of a molecular ruler in proteasomes suggested by analysis of degradation products.analysis of the degradation products from two proteins, the insulin b-chain and human hemoglobin, generated by archaebacterial thermoplasma acidophilum 20 s proteasomes, revealed an unexpectedly broad specificity. in spite of the vast number of different peptides found, they fell into a rather narrow size range. this suggests that a molecular ruler exists which determines the length of the cleavage products.19948050567
the crystal structure of glucose dehydrogenase from thermoplasma acidophilum.the archaea are a group of organisms distinct from bacteria and eukaryotes. structures of proteins from archaea are of interest because they function in extreme environments and because structural studies may reveal evolutionary relationships between proteins. the enzyme glucose dehydrogenase from the thermophilic archaeon thermoplasma acidophilum is of additional interest because it is involved in an unusual pathway of sugar metabolism.19948081754
atp-independent dna topoisomerase from fervidobacterium islandicum.thermotogales are thermophilic eubacteria belonging to a very slowly evolving branch in the eubacterial tree. in this report, we describe the purification and characterization of an atp-independent dna topoisomerase from the thermotogale, fervidobacterium islandicum. the enzyme, a monomer of about 75 kda, is a type i dna topoisomerase sharing many properties with the other bacterial topoisomerases i: it absolutely requires mg2+ for activity, relaxes negatively but not positively supercoiled dna ...19938241262
preliminary x-ray crystallographic study of the proteasome from thermoplasma acidophilum.single cystals of proteasomes from the archaebacterium thermoplasma acidophilum were obtained using the hanging-drop vapor diffusion method. the crystals diffract to better than 3.0 a and belong to the orthorhombic space group p2(1)2(1)2(1) with unit cell dimensions a = 308.9 a, b = 208.8 a and c = 116.9 a. there is one molecular complex in the asymmetric unit. two potentially useful heavy-atom derivatives have been obtained. the self-rotation function of the native patterson map shows local sev ...19938254679
dissociation and reconstitution of the thermoplasma proteasome.the proteasome from the thermoacidophilic archaeon thermoplasma acidophilum in its native state represents a 20s particle with significant secondary structure (approximately 35% alpha helix) of its subunits. electron microscopy, ultracentrifugal and spectral analysis demonstrate that at ph of less than 3 dissociation to partially denatured subunits occurs. upon dialysis against near neutral ph buffers, at low protein concentration, reconstitution occurs, leading to the restoration of up to 90% o ...19948055945
nucleotide sequence of a putative succinate dehydrogenase operon in thermoplasma acidophilum.28 amino acids from the n-terminal region of a putative terminal oxidase from the archaebacterium thermoplasma acidophilum were determined by edman degradation. on basis of this amino acid sequence a degenerated oligonucleotide was synthesized and used as a radioactive probe for southern blot analysis of ecori digested genomic dna. a 2.3 kb ecori fragment strongly hybridized to the probe and size selected genomic library from genomic dna was constructed. several clones scored positive by screeni ...19938334158
predicted secondary structure of the 20 s proteasome and model structure of the putative peptide channel.secondary structure prediction has made great progress in recent years due to the incorporation of evolutionary information, and may be close to a point where (in combination with biochemical and low-resolution structural data) it can guide the modelling of tertiary structure in cases where no model building is possible by homology. towards this goal it is important to gather information on the performance of prediction methods in advance of the publication of new structures. in anticipation of ...19947957899
novel prenylated hemes as cofactors of cytochrome oxidases. archaea have modified hemes a and o.a series of novel hemes with modifications of the isoprenyl side chain has been detected in archaea. heme a(s) was isolated from cytochrome oxidases of the thermoacidophilic archaeon, sulfolobus acidocaldarius. heme a(s) has the same spectroscopic features as heme a but has a hydroxyethylgeranylgeranyl side chain instead of the hydroxyethylfarnesyl group. this variant is also present in other archaeal oxidases as well as in the cytochrome oxidases of a thermophilic eubacterium. other archaea (th ...19948063781
crystallization and preliminary crystallographic study of citrate synthase from the thermophilic archaeon thermoplasma acidophilum.single crystals of citrate synthase from the archaeon thermoplasma acidophilum were obtained in two forms using the hanging drop vapour diffusion method and polyethylene glycol 3350 as precipitant. type 1 crystals belong to the orthorhombic space group p222(1), with unit cell dimensions a = 80.9 a, b = 103.8 a, c = 98.3 a and one dimer in the asymmetric unit. type 2 crystals belong to the monoclinic space group p2(1), with unit cell dimensions a = 53.8 a, b = 173.8 a, c = 86.7 a and beta = 97.1 ...19938331668
thermoplasma acidophilum proteasomes degrade partially unfolded and ubiquitin-associated proteins.it is shown that proteasomes from the arachaebacterium thermoplasma acidophilum selectively degrade substrate proteins partially unfolded by phenylhydrazine- or hydrogen peroxide-treatment. surprisingly, the pre-incubation of the substrate proteins with ubiquitin is also sufficient to render them susceptible to proteolytic degradation by proteasomes. we propose that, upon spontaneously associating with the substrate protein, ubiquitin exerts a chaotropic effect on it; this may involve the exposu ...19938391997
ubiquitin found in the archaebacterium thermoplasma acidophilum.systematic n-terminal sequencing of the low molecular weight proteins from thermoplasma acidophilum separated by two-dimensional poly-acrylamide gel electrophoresis led to the discovery of a polypeptide with an apparent m(r) of 4.5 kda identical as its first 18 amino acid residues to human ubiquitin. the occurrence of ubiquitin and proteasomes in an archaebacterium strongly suggests that atp-ubiquitin-dependent proteolysis is a cellular function that developed early in evolution.19938392003
cloning, sequencing and expression of the gene encoding glucose dehydrogenase from the thermophilic archaeon thermoplasma acidophilum.the gene encoding glucose dehydrogenase has been identified by southern analysis of doubly restricted genomic thermoplasma acidophilum dna, using two redundant 17-residue oligonucleotide probes reverse translated from protein n-terminal sequence data. a 1670-bp bamh1-ecor1 restriction fragment was ligated into puc19 and puc18 (constructs ptagdh1 and ptagdh2, respectively) and cloned in escherichia coli. the sequence of the whole fragment was determined, and a 1059-bp open reading frame identifie ...19938436115
cdna cloning of rat proteasome subunit rc7-i, a homologue of yeast pre1 essential for chymotrypsin-like activity.the nucleotide sequence of a cdna that encodes a new subunit, named rc7-i, of the 20 s proteasome of rat hepatoma cells has been determined. the polypeptide predicted from the open reading frame consists of 201 amino acid residues with a calculated molecular weight of 22,912 and isoelectric point of 7.25. approximately 80% of the partial amino acid sequences of several fragments of rc7-i, determined by protein chemical analyses, were found to be in excellent accordance with those deduced from th ...19938405448
picrophilus gen. nov., fam. nov.: a novel aerobic, heterotrophic, thermoacidophilic genus and family comprising archaea capable of growth around ph 0.two species belonging to a novel genus of archaea, designated picrophilus oshimae and picrophilus torridus, have been isolated from two different solfataric locations in northern japan. one habitat harboring both organisms was a dry, extremely acidic soil (ph < 0.5) that was heated by solfataric gases to about 55 degrees c. in the laboratory both species grew heterotrophically on yeast extract and poorly on tryptone under aerobic conditions at temperatures between 45 and 65 degrees c; they grew ...19958522509
cytoskeleton in the archaebacterium thermoplasma acidophilum? viscosity increase in soluble extracts.thermoplasma acidophilum has no cell wall, and so its irregular shape implies the presence of a cytoskeleton. when soluble extracts of t. acidophilum were incubated in vitro they increased in viscosity, suggestive of a polymerizable component. optimal conditions for the viscosity increase coincided with physiological ionic concentrations. electron micrographs of negatively stained extracts showed a meshlike lattice of elements 10 nm in diameter similar to nuclear lamins. however, immunologically ...19938374067
isolation and characterization of flagella and flagellin proteins from the thermoacidophilic archaea thermoplasma volcanium and sulfolobus shibatae.isolated flagellar filaments of sulfolobus shibatae were 15 nm in diameter, and they were composed of two major flagellins which have m(r)s of 31,000 and 33,000 and which stained positively for glycoprotein. the flagellar filaments of thermoplasma volcanium were 12 nm in diameter and were composed of one major flagellin which has an m(r) of 41,000 and which also stained positively for glycoprotein. n-terminal amino acid sequencing indicated that 18 of the n-terminal 20 amino acid positions of th ...19968550530
expression of an archaeal chaperonin in e. coli: formation of homo- (alpha, beta) and hetero-oligomeric (alpha+beta) thermosome complexes.co-expression of the two genes encoding the alpha- and beta-subunit of the thermoplasma acidophilum thermosome in escherichia coli yielded fully assembled hetero-oligomeric complexes (alpha+beta). surprisingly, also separate expression of both genes resulted in formation of hexadecameric complexes (alpha, beta) in the bacterial cytoplasm. on electron micrographs these complexes were indistinguishable from each other and from the native thermosome. the recombinant alpha-complex as well as the nat ...19958521970
purification and partial characterisation of a protein of unknown function from thermoplasma acidophilum. 19938449347
nuclear localization signals of human and thermoplasma proteasomal alpha subunits are functional in vitro.proteasomes are located both in the nuclei and in the cytoplasm of eukaryotic cells. active transport of these complexes through the nuclear pores has been proposed to be mediated by nuclear localization signals (nls), which have been found in several of the alpha-type proteasomal subunits. we have tested three different putative nls sequences from human alpha-type proteasomal subunits (hsc iota, hsc9, and hsc3), as well as a putative nls-type sequence from the archaeon thermoplasma acidophilum, ...19958618844
structural and sequence comparisons of quinone oxidoreductase, zeta-crystallin, and glucose and alcohol dehydrogenases.quinone oxidoreductase, zeta-crystallin, glucose dehydrogenase, and alcohol dehydrogenase belong to a superfamily of medium-chain dehydrogenase/reductases. the crystal structures of escherichia coli quinone oxidoreductase (qor) and thermoplasma acidophilum glucose dehydrogenase have recently been determined and are compared here with the well-known structure of horse liver alcohol dehydrogenase. a structurally based comparison of these three enzymes confirms that they possess extensive overall s ...19968638928
processing of n3, a mammalian proteasome beta-type subunit.proteasome subunits are encoded by members of the same gene family and can be divided into two groups based on their similarity to the alpha and beta subunits of the simpler proteasome isolated from thermoplasma acidophilum. rn3 is the beta-type subunit, n3, of rat proteasomes which has been implicated in the peptidylglutamyl-peptide hydrolase activity of the proteinase complex. we have expressed recombinant rn3 protein in escherichia coli in order to raise subunit-specific polyclonal antibodies ...19968645151
citrate synthase from the hyperthermophilic archaeon, pyrococcus furiosus.the gene encoding the enzyme citrate synthase has been cloned and sequenced from the hyperthermophilic archaeon pyrococcus furiosus, and the derived amino acid sequence has been phylogenetically compared with citrate synthases from archaeal, bacterial and eukaryal organisms. the gene has been over-expressed in escherichia coli to produce an active enzyme that has then been characterized with respect to its kinetic, oligomeric and hyperthermostable properties. a structurally-based sequence alignm ...19958532683
autocatalytic processing of the 20s proteasome.the ntn (n-terminal nucleophile) hydrolases are enzymes with an unusual four-layer alpha + beta fold. the amino-terminal residue (cysteine, serine or threonine) of the mature protein is the catalytic nucleophile, and its side chain is activated for nucleophilic attack by transfer of its proton to the free n terminus, although other active-site residues may also be involved. the four currently known ntn hydrolases (glutamine prpp amidotransferase, penicillin acylase, the 20s proteasome and aspart ...19968684489
the effect of cysteine-43 mutation on thermostability and kinetic properties of citrate synthase from thermoplasma acidophilum.in this study, we have substituted serine-43 by cysteine in the recombinant citrate synthase from a moderately thermophilic archaeon thermoplasma acidophilum, for site-specific attachment of labels and have investigated the effects of this mutation on the biochemical properties and thermal stability of the enzyme. both wild-type and the mutant enzymes were purified to homogenity using affinity chromatography on matrex gel red a. the mutant thermoplasma citrate synthase is very similar to wild-ty ...19968694816
a non-alpha-like dna polymerase from the hyperthermophilic archaeon pyrococcus furiosus.we identified a dna polymerase with properties that differed from those of alpha-like dna polymerase (pol i), in pyrococcus furiosus, a hyperthermophilic archaeon. the novel dna polymerase (pol ii) was partially purified and characterized. the dna polymerizing activity of pol ii was relatively sensitive to dideoxythymidine-triphosphate (ddttp) and it was inhibited by n-ethylmaleimide, but not by aphidicolin. activity staining gel electrophoresis showed that the dna polymerizing activity was deri ...19958787781
catalytic mechanism of the 20s proteasome of thermoplasma acidophilum revealed by x-ray crystallography. 19958824425
tricorn protease--the core of a modular proteolytic system.large macromolecular assemblies have evolved as a means of compartmentalizing reactions in organisms lacking membrane-bounded compartments. a tricorn-shaped protease was isolated from the archaeon thermoplasma and was shown to form a multisubunit proteolytic complex. the 120-kilodalton monomer assembled to form a hexameric toroid that could assemble further into a capsid structure. tricorn protease appeared to act as the core of a proteolytic system; when it interacted with several smaller prote ...19968910281
glucose dehydrogenase from the halophilic archaeon haloferax mediterranei: enzyme purification, characterisation and n-terminal sequence.an nad(p)-glucose dehydrogenase from the extremely halophilic archaeon, haloferax mediterranei, has been purified to electrophoretic homogeneity. the purified enzyme has been characterised with respect to its cofactor specificity, subunit composition and its salt and thermal stability. the n-terminal amino acid sequence has been determined and n-terminus alignment with sequences of other glucose dehydrogenases shows that the halophilic enzyme most closely resembles the nad(p)-linked glucose dehy ...19968925901
tricorn protease (tri) interacting factor 1 from thermoplasma acidophilum is a proline iminopeptidase.tricorn protease (tri), a high molecular mass complex from the archaeon t. acidophilum, forms the core of a modular proteolytic system; upon interacting with low molecular mass factors intrinsic activities are enhanced and novel activities are generated. here we characterize the first factor, f1, which turns out to be homologous with several bacterial proline iminopeptidases (pips). surprisingly, it cleaves not only typical pip substrates such as h-pro-amc, but a wide spectrum of amino acid subs ...19968946961
archaeal-eubacterial mergers in the origin of eukarya: phylogenetic classification of life.a symbiosis-based phylogeny leads to a consistent, useful classification system for all life. "kingdoms" and "domains" are replaced by biological names for the most inclusive taxa: prokarya (bacteria) and eukarya (symbiosis-derived nucleated organisms). the earliest eukarya, anaerobic mastigotes, hypothetically originated from permanent whole-cell fusion between members of archaea (e.g., thermoplasma-like organisms) and of eubacteria (e.g., spirochaeta-like organisms). molecular biology, life-hi ...19968577716
the b12-dependent ribonucleotide reductase from the archaebacterium thermoplasma acidophila: an evolutionary solution to the ribonucleotide reductase conundrum.a coenzyme b12-dependent ribonucleotide reductase was purified from the archaebacterium thermoplasma acidophila and partially sequenced. using probes derived from the sequence, the corresponding gene was cloned, completely sequenced, and expressed in escherichia coli. the deduced amino acid sequence shows that the catalytic domain of the b12-dependent enzyme from t. acidophila, some 400 amino acids, is related by common ancestry to the diferric tyrosine radical iron(iii)-dependent ribonucleotide ...19978990160
amino acid sequence alignment of a "small' citrate synthase from pseudomonas aeruginosa pac 514, with other citrate synthase sequences. 19968674717
reconstitution of bacteriorhodopsin and atp synthase from micrococcus luteus into liposomes of the purified main tetraether lipid from thermoplasma acidophilum: proton conductance and light-driven atp synthesis.the archaebacterium thermoplasma acidophilum is cultivated at 59 degrees c in a medium containing sulfuric acid of ph 2. the purified bipolar membrane spanning main phospholipid (mpl) of this organism can be used to produce stable liposomes of 100-500 nm in diameter either using a french pressure cell detergent dialysis or sonication. despite a potassium diffusion potential of 186 mv very low ionic permeability of sonicated mpl liposomes was measured using the potassium binding fluorescent indic ...19958565113
novel zinc-containing ferredoxin family in thermoacidophilic archaea.the dicluster-type ferredoxins from the thermoacidophilic archaea such as thermoplasma acidophilum and sulfolobus sp. are known to contain an unusually long extension of unknown function in the n-terminal region. recent x-ray structural analysis of the sulfolobus ferredoxin has revealed the presence of a novel zinc center, which is coordinated by three histidine ligand residues in the n-terminal region and one aspartate in the ferredoxin core domain. we report here the quantitative metal analyse ...19979013590
processive degradation of proteins and other catalytic properties of the proteasome from thermoplasma acidophilum.although the structure of the 20 s proteasome from thermoplasma acidophilum has been elucidated, its enzymatic properties have not been explored in depth. thermoplasma proteasomes, which contain one type of active site, exhibit not only "chymotrypsin-like" activity (as reported), but also some "post-glutamyl" and "trypsin-like" activities. like eukaryotic proteasomes, its activity can be stimulated by sds, mg2+, and also guanidine hcl, but not urea. the enzyme was strongly inhibited by novel pep ...19978999862
subunit topology of the rhodococcus proteasome.the 20s proteasome, isolated from the nocardioform actinomycete rhodococcus erythropolis strain ni86/21, is built from two alpha-type and two beta-type subunits. in order to probe the subunit topology, we have set up an expression system which allows coexpression of the genes encoding the alpha- and beta-subunits in all possible combinations. the four respective constructs obtained yielded fully assembled and proteolytically active proteasomes. biochemical, kinetic and electron microscopy analys ...19979000518
structure of 20s proteasome from yeast at 2.4 a resolution.the crystal structure of the 20s proteasome from the yeast saccharomyces cerevisiae shows that its 28 protein subunits are arranged as an (alpha1...alpha7, beta1...beta7)2 complex in four stacked rings and occupy unique locations. the interior of the particle, which harbours the active sites, is only accessible by some very narrow side entrances. the beta-type subunits are synthesized as proproteins before being proteolytically processed for assembly into the particle. the proforms of three of t ...19979087403
hats off to the tricorn protease. 19968966603
Displaying items 101 - 200 of 527