Publications

TitleAbstractYear(sorted ascending)
Filter
PMID
Filter
a thermophilic, acidophilic mycoplasma isolated from a coal refuse pile.a thermophilic, acidophilic procaryote lacking a cell wall has been isolated from a coal refuse pile which had undergone self-heating. electron micrographs, chemical assays for hexosamine, and the inability of vancomycin to inhibit growth confirm the lack of a cell wall. the apparent ability of the organism to reproduce by budding and the low guanine plus cytosine content of its dna indicate a relation to the mycoplasmas. the temperature optimum of the organism is 59 degrees c, and growth occurs ...19705481857
lipids of thermoplasma acidophilum.cells of thermoplasma acidophilum contain about 3% total lipid on a dry weight basis. total lipid was found to contain 17.5% neutral lipid, 25.1% glycolipid, and 56.6% phospholipid by chromatography on silicic acid. the lipids contain almost no fatty acid ester groups but appear to have long-chain alkyl groups in ether linkages to glycerol. the phospholipid fraction includes a major component which represents about 80% of the lipid phosphorus and 46% of the total lipids. we believe this componen ...19724344918
characterization of the membranes of thermoplasma acidophilum.thermoplasma acidophilum grows optimally under aeration at 59 c and ph 2. both intact cells and membranes disaggregate below ph 1 and above ph 5, producing no sedimentable particles. increase in ionic strength at ph 5 or below results in cellular lysis and membrane disaggregation. membranous components produced by lysis at alkaline ph reaggregate upon reduction of both ph and ionic strength. osmotic environment plays little role in cellular stability. membranes prepared by sonic lysis at ph 5 ex ...19734583228
lipid phase transitions in membrane vesicles from thermoplasma acidophila. 19744370165
immunodiffusion analysis of membranes of thermoplasma acidophilum.isolates of thermoplasma acidophilum were divided into serological groups based on immunodiffusion studies of solubilized-membrane preparations.19744210340
immunological analysis of glycolipids and lipopolysaccharides derived from various mycoplasmas.the lipids and lipopolysaccharides of five mycoplasmas were examined for complement-fixing activity to antimembrane rabbit sera. total glycolipid fractions and the aqueous phenol fractions (lipopolysaccharides) from the membranes of acholeplasma laidlawii, a. modicum, a. axanthum, and mycoplasma neurolyticum exhibited significant antigenic activity. the glycolipids and phosphoglycolipids from thermoplasma acidophilum were either anticomplementary or did not react due to their extreme hydrophobic ...19744215761
a new class of lipopolysaccharide from thermoplasma acidophilum. 19744371772
scanning electron microscopy of thermoplasma acidophilum.the scanning electron microscope was utilized to observe the morphology of the thermophilic, acidophilic mycoplasma, thermoplasma acidophilum. upon examination of the surface morphology, the size and shape of this unusual mycoplasma revealed its similarity to the other mycoplasmas that have been investigated.19744436262
immunofluorescence approach to the study of the ecology of thermoplasma acidophilum in coal refuse material.specific immunofluorescence staining was applied to the study of the localization, distribution, and growth of thermoplasma acidophilum in its natural habitat, the coal refuse pile. different antigenic groups of t. acidophilum could be isolated from the same refuse pile, and the same antigenic groups were isolated from piles from different geographical areas. no correlation could be established between the antigenic groups and the ph or temperature of the habitats. brightly fluorescing cells of ...19744602306
histone-like protein in the prokaryote thermoplasma acidophilum.the dna of the prokaryote thermoplasma acidophilum is associated with a histone-like protein that has the following properties: it has a high content (23%) of basic amino acids, is positively charged at neutral ph, is soluble in acid, and can stabilize dna against thermal denaturation. in polyacrylamide gel electrophoresis, in the presence of either sodium dodecylsulfate or urea, it migrates at the same rate as histone iv (f2a1) of calf thymus. the amino acid composition, however, it unusually r ...1975238622
membrane properties of thermoplasma acidophila.plasma membranes were isolated from thermoplasma acidophila, a mycoplasma-like organism which grows optimally at ph 2 and 59 degrees. cells in concentrated suspensions were lysed by titrating to ph 9.3. the membranes were purified by washing at ph 10 and centrifuging in a discontinuous sucrose gradient. membrane purity was assessed by electron microscopy, determination of deoxyribonucleic acid content, polyacrylamide gel electrophoretic behavior. gel patterns and amino acid composition of cells ...1975234745
ultrastructure of lipopolysaccharide isolated from thermoplasma acidophilum.the fine structure of lipopolysaccharide isolated from thermoplasma acidophilum was examined by electron microscopy. negative staining of the lipopolysaccharide revealed long, ribbon-like structures with some branching. the average width of the lipopolysaccharide ribbons was 5 nm. treatment of the lipopolysaccharide with 0.5% sodium dodecyl sulfate resulted in the dissociation of the ribbon-like structures to spherical- and vesicular-shaped particles and some short, rodlike structures. results s ...197546226
polypeptide nature of growth requirement in yeast extract for thermoplasma acidophilum.the active component(s) in yeast extract required by thermoplasma acidophilum for growth is polypeptide in nature. a fraction from yeast extract was isolated and partially characterized as one or more peptides of molecular weight about 1,000 containing 8 to 10 amino acids. although it was composed largely of basic and dicarboxylic amino acids, only one amino group per molecule was free. the polypeptide(s) appeared to bind avidly to cations. no other organic compounds except glucose were needed b ...19751102535
intracellular ph of thermoplasma acidophila.thermoplasma acidophila, a mycoplasma-like organism, was grown at 56 degrees c and ph 2. the intracellular ph of this organism is close to neutral as measured by the distribution of a radioactive weak organic acid, 5,5-dimethyl-2,4-oxazolidinedione, across the plasma membrane. the cell can maintain the ph gradient when subjected to heat or to metabolic inhibitors. our experiments seem to indicate that a major portion of the ph gradient is not maintained by active processes, but rather by a donna ...1975236035
distribution and composition of lipopolysaccharides from mycoplasmas.polymeric carbohydrates containing glycerol and fatty acids were isolated from whole cells and membranes of mycoplasmas by hot aqueous phenol extraction and gel filtration. lipopolysaccharides were found to occur in four species of acholeplasma, two of anaeroplasma, and in mycoplasma neurolyticum. none were detected in spiroplasma citri or in five species of mycoplasma. all lipopolysaccharides contained both neutral and n-acylated amino sugars in ratios varying from 1:1 to 3:1. the neutral sugar ...19761254559
thermoplasma acidophilum: intracellular ph and potassium concentration.thermoplasma acidophilum is a free-living thermophilic mycoplasma. although the organism lacks a cell wall, it can grow in medium as dilute as 66 mosm. the intracellular k+ concentration can be as low as 17 mm, but varies according to the osmolality of the culture medium. the internal ph can be measured by taking advantage of the fact that t. acidophilum undergoes lysis when the ph is adjusted to neutrality. thus, by appropriate analysis of titration curves, it is possible to conclude that the i ...197612804
zeta-potential and surface charge of thermoplasma acidophila.the surface charge density and the zeta-potential of thermoplasma acidophila was estimated from microscopic electrophoresis experiments. the cells moved towards the positive electrode. the mobility remained constant from ph 2 to 5, and increased for ph values higher than 6. the mobility at ph 6 decreased dramatically with increased external ca2+ concentration. at ph 2 and an ionic strength similar to that of the growth medium, the zeta-potential was about 8 mv, negative relative to the bulk medi ...197718171
membrane potential of thermoplasma acidophila. 197714021
long-chain diglycerol tetraethers from thermoplasma acidophilum.the c40 isopranol-containing glycerol ether residues which characterize the complex lipids of the extreme thermoacidophile thermoplasma acidophilum were isolated and purified from the glycolipid and phospholipid fractions. the glycerol ether, as well as the acetate and methoxy derivatives were characterized by thin-layer, gel-permeation and gas-liquid chromatography, infrared, nuclear magnetic resonance and mass spectrometry and by vapor phase osmometry. the glycerol ethers are proposed to be un ...1977857900
lipoquinones of some bacteria and mycoplasmas, with considerations on their functional significance.in a comparative study the lipoquinones of some chemoorganotrophic, facultatively aerobic bacteria, and representative acholeplasma, mycoplasma, spiroplasma, and thermoplasma strains were investigated. the quinones were partly purified by preparative thin layer chromatography of lipid extracts, and characterized by their difference spectra (reduced minus oxidized) and rf values. respiring bacteria expectedly contained benzoquinones and/or naphthoquinones in micromolar concentrations whereas some ...1977413478
the effect of a13+ on the physical properties of membrane lipids in thermoplasma acidophilum. 1978215137
physiologically important stabilization of dna by a prokaryotic histone-like protein.the thermophilic mycoplasma thermoplasma acidophilum has tightly bound to its dna a protein that closely resembles the histones of eukaryotes. dna associated with this protein is more stable than free dna against thermal denaturation by about 40 degrees c, as shown in both native nucleoprotein and in hybrid nucleoprotein reconstituted in vitro with calf dna. since only about 20 percent of the dna in this organism is associated with the histone-like protein, we suggest that its physiological func ...1978694528
a restriction enzyme tha i from the thermophilic mycoplasma thermoplasma acidophilum.a type ii restriction enzyme (tha i) has been isolated from the thermophilic mycoplasma thermoplasma acidophilum. a new method of general application was used to determine the dna sequence cleaved by the enzyme. tha i cuts dna in the centre of the sequence cgcg. single-stranded dna is not a substrate. tha i does not cut t. acidophilum dna which is presumably modified. this is the first description of a restriction enzyme from a mycoplasma. because tha i is easily prepared in large amounts of app ...1978673834
ultrastructural localization of thermoplasma acidophilum surface carbohydrate by using concanavalin a.surface carbohydrate, presumably the lipopolysaccharide, of thermoplasma acidophilum was visualized by means of the concanavalin a, horseradish peroxidase, and diaminobenzidine cytochemical staining procedure.1978641014
phylogenetic affinities between eukaryotic cells and a thermophilic mycoplasma.thermoplasma acidophilum, a thermophilic mycoplasma, has several unusual features suggesting a possible relationship to eukaryotic cells. one feature is a histone-like protein that is associated with the dna, condensing it into subunits similar to those in eukaryotic chromatin. a second feature is an association of cytoplasmic proteins that resembles eukaryotic actin and myosin. these two components are widely distributed in different groups of eukaryotic cells, but are typically lacking in prok ...1978656568
structure of membrane lipids and physico-biochemical properties of the plasma membrane from thermoplasma acidophilum, adapted to growth at 37 degrees c.thermoplasma acidophilum, a mycoplasma-like organism, grows optimally at 56 degrees c and ph2. the low temperature extreme of growth is 37 degrees c. the plasma membrane of cells grown at 37 degrees c was isolated and characterized physicobiochemically. membrane lipids which comprise 25% of the membrane dry weight consist mainly of two repetitively methyl-branched c40 side chains that were ether-linked to two glycerol molecules. the lipid structures were elucidated by combined gas chromatography ...1979221032
the evolution of histones in relationship to recent advances in elucidating chromatin structure. 1979555823
purification and partial characterization of a procaryotic glycoprotein from the plasma membrane of thermoplasma acidophilum.the obligate, thermophilic, acidophilic mycoplasma, thermoplasma acidophilum, grows optimally at 56 degrees c and ph 2.0. its plasma membrane possessed 21--22 protein bands that were resolved by polyacrylamide gel electrophoresis. one major membrane protein, molecular weight 152 000, which stained for carbohydrate with periodic acid-schiff reagent, accounted for 32% (w/w) of the total membrane proteins. it was isolated and further purified by concanavalin a affinity chromatography. the carbohydr ...1979534627
squalenes, phytanes and other isoprenoids as major neutral lipids of methanogenic and thermoacidophilic "archaebacteria".the neutral lipids of nine species of methanogenic bacteria including five methanobacilli, two methanococci, a methanospirillum, one methanosarcina as well as two thermoacidophilic bacteria, thermoplasma and sulfolobus, were analyzed. the major components were c30, c25 and/or c20 acylic isoprenoid hydrocarbons with a continuous range of hydroisoprenoid homologues. the range of acyclic isoprenoids detected were from c14 to c30. apart from methanosarcina barkeri, squalene and/or hydrosqualene deri ...1979458874
flagellation and swimming motility of thermoplasma acidophilum.electron microscopy of thin sections of thermoplasma acidophilum confirmed previous observations of the absence of a typical cell wall in this organism. negatively stained specimens revealed the almost consistent occurrence in both strains examined of monotrichously arranged flagella, about 9 micrometer long, which describe a sinuous curve with a wavelength of 1.5 to 2.0 micrometer and an amplitude of 0.33 to 0.59 micrometer. motility of t. acidophilum could be demonstrated microscopically by mi ...1979762021
diphytanyl and dibiphytanyl glycerol ether lipids of methanogenic archaebacteria.the lipids of nine different methanogenic bacterial strains are comprised of diphytanyl glycerol diethers, previously known only in extremely halophilic bacterial, as well as dibiphytanyl diglycerol tetraethers, known formerly only in the extremely thermoacidophilic bacteria thermoplasma and sulfolobus. of the methanogens examined from four representative taxonomic groups, methanobacterium and methanospirillum contained both types of isopranyl ethers in nearly equal proportions, whereas the cocc ...1979758677
physiology of thermophilic bacteria. 197995242
phylogenetic analysis of the mycoplasmas.the phylogenetic relationships between the mycoplasmas and bacteria have been established from a comparative analysis of their 16s rrna oligonucleotide catalogs. the genera mycoplasma, spiroplasma, and acholeplasma arose by degenerative evolution, as a deep branch of the subline of clostridial ancestry that led to bacillus and lactobacillus. thermoplasma has no specific relationship to the other mycoplasmas; it belongs with the archaebacteria.19806928642
archaebacterial elongation factor is adp-ribosylated by diphtheria toxin.archaebacteria have been defined as a 'third primary kingdom' of cells in addition to the urkaryotes and the eubacteria. while the latter two correspond approximately to the conventional categories eukaryotes and prokaryotes respectively, the archaebacteria have up to now comprised four groups of microorganisms: the methanogenic bacteria, the extremely halophilic bacteria and the two thermoacidophilic genera sulfolobus and thermoplasma. based on ribosomal rna sequence homologies and lipid compos ...19806776409
nucleoprotein subunit structure in an unusual prokaryotic organism: thermoplasma acidophilum.the freeliving thermophilic mycoplasma, thermoplasma acidophilum, has a small acid-soluble protein tightly bound to its dna. this protein is similar to eukaryotic histones in both size and amino acid composition. here we report that the protein condenses dna into globular particles that are about half the size of eukaryotic nucleosomes. our conclusions are based primarily upon the following observations: (1) nuclease digestion produced dna fragments of 40 base-pairs. (2) the ratio of protein to ...19807407183
thermoplasma acidophilum histone-like protein. partial amino acid sequence suggestive of homology to eukaryotic histones.thermoplasma acidophilum is a freeliving mycoplasma-like organism that has a small basic protein tightly bound to its dna. the n-terminal sequence of this protein has been determined. it has a distanct but statistically significant homology to eukaryotic histones h2a, h3, and to escherichia coli protein hu.19807407184
sequence and glycosidic bond arrangement of sugars in lipopolysaccharide from thermoplasma acidophilum.the lipopolysaccharide from thermoplasma acidophilum is a linear polymer with the structure [manp-(alpha 1 leads to 2)-manp-(alpha 1 leads to 4)-manp-(alpha 1 leads to 3)]8-glcp-(alpha 1 leads to 1)-diglycerol tetraether as established by smith degradation, methylation, acetolysis and cro3 oxidation.19807407218
endotoxin-like activities of mycoplasmal lipopolysaccharides (lipoglycans).lipoglycans (previously designated lipopolysaccharides) from several species of acholeplasma and from thermoplasma acidophilum were examined for endotoxin-like activities as measured by the standard rabbit fever test and the limulus amoebocyte lysate assay. the lipoglycans from acholeplasma granularum, achloplasma laidlawii, acholeplasma modicum, and acholeplasma oculi caused a febrile response at concentrations of 1 ng/ml per kg or greater, whereas with control escherichia coli ec-2 lipopolysac ...19807429642
a histone-like protein (hta) from thermoplasma acidophilum. i. purification and properties.a histone-like protein (hta) has been isolated from cell extracts of thermoplasma acidophilum by column chromatography on dna-cellulose, hydroxylapatite, and sephadex g-75, hta elutes from dna-cellulose in two fractions, one of which contains an 80-residue form of the protein with an nh2-terminal sequence of val-gly. the other fraction apparently contains the 89-residue species, in addition to a 90-residue form of the protein with the nh2-terminal sequence met-val. the sequence of 47 residues fr ...19817451480
the nucleotide sequence of the trnammet from the archaebacterium thermoplasma acidophilum.using in vitro labelling techniques, a trnammet from thermoplasma acidophilum, a member of the archaebacteriae, has been shown to have the sequence: pgccggg gs4uggcucancuggaggagc m2(2)gccggacmucaut6aauccggaggucucggg psi psi cmgauccccgaucccggcaccaoh. despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. there is no ...19816913864
a mycoplasma-like archaebacterium possibly related to the nucleus and cytoplasms of eukaryotic cells. 19816941726
a histone-like protein (hta) from thermoplasma acidophilum. ii. complete amino acid sequence.the complete amino acid sequence of the dna-binding histone-like protein (hta) from thermoplasma acidophilum has been established by sequence studies directly on the protein and on tryptic, chymotryptic, and thermolysin peptides derived from the protein. the sequence of the 89-residue form of hta is: h2n-val-gly-ile-ser-glu-leu-ser-lys-glu-val-ala-lys-lys-ala-asn-thr-thr-gln-lys -val-ala-arg-thr-val-ile-lys-ser-phe-leu-asp-glu-ile-val-ser-glu-ala-asn-gly-gl y-gln-lys-ile-asn-leu-ala-gly-phe-gly- ...19817005226
superoxide dismutase from the archaebacterium thermoplasma acidophilum.thermoplasma acidophilum is a mycoplasma-like thermophilic organism that has been classified with the archaebacteria. it has a single superoxide dismutase (superoxide : superoxide oxidoreductase, ec 1.15.1.1) which is composed of four identically sized subunits. it has a metal content per molecule of two atoms of iron and probably one of zinc and a molecular weight of 82 000. the amino acid composition is rich in tryptophan and is typical of the manganese or iron superoxide dismutases found in o ...19817272329
the nucleotide sequence of the 5s rrna from the archaebacterium thermoplasma acidophilum.the complete nucleotide sequence of the 5s ribosomal rna isolated from the archaebacterium thermoplasma acidophilum has been determined. the sequence is: pg gcaacggucauagcagcagggaaacaccagaucccauuccgaacucgacgguuaagccugcugcguauugcguuguacu guaugccgcgaggguacgggaagcgcaauaugcuguuaccac(u)oh. the homology with the 55 rrna from another archaebacterial species, halobacterium cutirubrum, is only 60.6% and other 55 rrnas are even less homologous. examination of the potential for forming secondary structure ...19817232209
evolution of major metabolic innovations in the precambrian.a combination of the information on the metabolic capabilities of prokaryotes with a composite phylogenetic tree depicting an overview of prokaryote evolution based on the sequences of bacterial ferredoxin, 2fe-2s ferredoxin, 5s ribosomal rna, and c-type cytochromes shows three zones of major metabolic innovation in the precambrian. the middle of these, which reflects the genesis of oxygen-releasing photosynthesis and aerobic respiration, links metabolic innovations of the anaerobic stem on the ...19827133672
taxonomic relations between archaebacteria including 6 novel genera examined by cross hybridization of dnas and 16s rrnas.dnas from 16 species of archaebacteria including 6 novel isolates were hybridized with 16s rrnas from 7 species representing different orders or groups of the urkingdom of archaebacteria. the yields, normalized for the number of genes per microgram of dna, and the temperature stabilities of all hybrids were determined and related to each other. a taxonomic tree constructed from such fractional stability data reveals the same major divisions as that derived from comparative cataloging of 16s rrna ...19826178834
[archbacteria: living traces of primeval times]. 19826819474
dna-dependent rna polymerase of thermoacidophilic archaebacteria.the component compositions of the dna-dependent rna polymerases of the extremely thermophilic, anaerobic sulfur-respiring archaebacteria thermoproteus tenax and desulfurococcus mucosus strongly resemble each other but also that of the rna polymerase of sulfolobus acidocaldarius suggesting that both organisms belong to the same novel order thermoproteales, which together with the order represented by sulfolobus, forms the thermoacidophilic branch of archaebacteria. the component pattern of the rn ...19826800790
thermoacidophilic archaebacteria contain bacterial-type ferredoxins acting as electron acceptors of 2-oxoacid:ferredoxin oxidoreductases.thermoplasma acidophilum and sulfolobus acidocaldarius contain coenzyme a-acylating 2-oxoacid:ferredoxin oxidoreductases similar to those found in halophilic archaebacteria. a common feature of these enzymes is the formation of a free radical intermediate in the course of the catalytic cycle. the electron-accepting ferredoxins and a similar protein from desulfurococcus mobilis have been purified and characterized. in contrast to the [2fe-2s] ferredoxin of halobacterium halobium, the ferredoxins ...19826816594
low-angle x-ray scattering analysis of the thermoplasma acidophilum nucleoprotein subunit. 19827059610
component e of the dna-dependent rna polymerase of the archaebacterium thermoplasma acidophilum is required for the transcription of native dna.the role of component e of the dna-dependent rna polymerase of the archaebacterium thermoplasma acidophilum in the transcription of thermoplasma dna has been analyzed. component e (mr 22000) is released upon formation of the binary complex of the polymerase with the dna. enzyme not containing component e is inactive on dna but active on poly[d(a-t) x d(a-t)]. the activity on dna can be restored by addition of component e. two states of the binding complex between rna polymerase and dna, differin ...19827151810
organization of rrna structural genes in the archaebacterium thermoplasma acidophilum.in the archaebacterium thermoplasma acidophilum, each of the structural genes for 5s, 16s and 23s rrna occur once per genome. in contrast to those of eubacteria and eukaryotes, they appear unlinked. the distance between the 16s and the 23s rdna is at least 7.5 kb, that between 23s and 5s rdna at least 6 kb and that between 16s and 5s rdna at least 1.5 kb. no linkage between those genes has been found by the analysis of recombinant plasmids carrying bam hi and hind iii rdna fragments as by hybrid ...19827155894
occurrence of diphthamide in archaebacteria.we examined the nature of the diphtheria toxin fragment a recognition site in the protein synthesis translocating factor present in cell-free preparations from the archaebacteria thermoplasma acidophilum and halobacterium halobium. in agreement with earlier work (m. kessel and f. klink, nature (london) 287:250-251, 1980), we found that extracts from these organisms contain a protein factor which is a substrate for the adp-ribosylation reaction catalyzed by diphtheria toxin fragment a. however, t ...19836402493
some properties of the histone-like protein from crypthecodinium cohnii (hcc).the histone-like protein from crypthecodinium cohnii (hcc) was examined in regard to its amino acid composition and the peptide pattern resulting from protease digestion. a revised amino acid composition indicated a higher lysine and arginine content and a lower glycine content than that determined previously. comparative peptide mapping of hcc with hta, a histone-like protein from thermoplasma acidophilum, and with a histone-like protein from the dinoflagellate gyrodinium dorsum showed signific ...19836687044
histone-like protein in the archaebacterium sulfolobus acidocaldarius.the archaebacterium thermoplasma acidophilum contains a basic chromosomal protein remarkably similar to the histones of eukaryotes. therefore, it was of interest to examine a different archaebacterium for similar proteins. we chose to examine sulfolobus acidocaldarius because it is thermophilic, like t. acidophilum, but nevertheless the two organisms are not particularly closely related. two major chromosomal proteins were found in s. acidocaldarius. the smaller of these was soluble in 0.2 m h2s ...19836418207
ribosome specificity of archaebacterial elongation factor 2. studies with hybrid polyphenylalanine synthesis systems.polyphenylalanine synthesis with ribosomes and two separated, partially purified elongation factors (ef) was measured in cell-free systems from the archaebacteria thermoplasma acidophilum and methanococcus vannielii, in an eukaryotic system from rat liver and an eubacterial one with escherichia coli ribosomes and factors from thermus thermophilus. by substitution of heterologous ef-2 or ef-g, respectively, for the homologous factors, ribosome specificity was shown to be restricted to factors fro ...19836341085
physiology of acidophilic and alkalophilic bacteria. 19836364726
mycoplasma evolution: a review of the use of ribosomal and transfer rna nucleotide sequences in the determination of phylogenetic relationships.comparison of the nucleotide sequences of "structural" rnas (ribosomal and transfer rna) has enabled the construction of phylogenetic trees to be achieved. data from 16s rrna, 5s rrna, and trna from a total of eight mollicutes (excluding t. acidophilum) including representatives of the families mycoplasmataceae, spiroplasmataceae, and acholeplasmataceae, show that these families share a close relationship and a common ancestor with the gram-positive eubacteria. thermoplasma acidophilum is a memb ...19836206653
on the dna binding protein ii from bacillus stearothermophilus. ii. the amino acid sequence and its relation to those of homologous proteins from other prokaryotes.the complete amino acid sequence of dna binding protein ii from bacillus stearothermophilus has been determined. the protein contains 90 amino acid residues and has a calculated mr of 9716. the sequence is compared to homologous molecules from escherichia coli, thermoplasma acidophilum, and pseudomonas aeruginosa (where only a partial sequence is available). the b. stearothermophilus molecule has 58% and 59% residues identical with the two forms of the e. coli protein and 32% with the t. acidoph ...19836300069
lipoglycans from mycoplasmas.lipoglycans , distinguishable from bacterial lipopolysaccharides, are associated with the cytoplasmic membranes of several genera of mollicutes, namely acholeplasma, mycoplasma neurolyticum , anaeroplasma , and thermoplasma. structurally, the lipoglycans are long heteropolysaccharides covalently linked to a lipid. the exact structures of three have been determined. thermoplasma oligosaccharide is attached to a diglycerol tetraether ; a. granularum to a diacyl glycerol. the lipoglycan from a. axa ...19846375975
structural requirements for the interaction of 5s rrna with the eukaryotic transcription factor iiia.in order to study the binding of the eukaryotic transcription factor iiia to heterologous 5s rrnas with a low degree of overall sequence conservation (less than 20%) we have utilized a transcription competition assay involving eubacterial, archaebacterial and eukaryotic 5s rrnas. all the molecules inhibit xenopus 5s rrna transcription specifically, which suggests that only a small amount of specific conserved rna sequences, if indeed any, are essential for the interaction of the transcription fa ...19846390342
on the memory of modern metabolism. 19846462691
the primary structure of the dna-binding protein ii from clostridium pasteurianum.the complete amino acid sequence of the clostridium pasteurianum dna-binding protein ii (dnab-ii) has been determined. the molecule contains 91 amino acid residues and has an mr of 10 133. sequence data were obtained from manual edman degradation, using the dabitc/pitc double-coupling of the tryptic, peptic, chymotryptic and staphylococcus protease peptides. a comparison of the amino acid sequence of the c. pasteurianum dnab-ii with those of the dnab-ii from escherichia coli, bacillus stearother ...19846541161
genome organization and transcription in archaebacteria.the genome organization of the archaebacteria is investigated in three model systems: a) rrna genes of various archaebacteria, b) a plasmid of 15.6 kb from sulfolobus acidocaldarius which exists in free or integrated form, c) the 59 kb genome of phage phi h of halobacterium halobium as a model for the unusual structural variability of dna in this organism. several variants of this phage have been isolated, their genomes differ by several insertions, a deletion, and an inversion. the frequent inv ...19846202564
cell symbiosis [correction of symbioisis] theory: status and implications for the fossil record.recent geological treatises have presented three alternative models of the origins of eukaryotes as if they merited equal treatment. however, modern biological techniques, especially nucleic acid and protein sequencing, have clearly established the validity of the symbiotic theory of the origin of eukaryotic organelles. the serial endosymbiotic theory in its most extreme form states that three classes of eukaryotic cell organelles (mitochondria, plastids and undulipodia) originated as free-liv ...198411537775
the phylogenetic relationships of three sulfur dependent archaebacteria.oligonucleotide catalogs have been determined for the 16s ribosomal rnas of three sulfur dependent (i.e. "thermoacidophilic") archaebacteria--sulfolobus acidocaldarius, s. solfataricus, and thermoproteus tenax. the three form a group specifically related to one another, but are only distantly related to the other archaebacteria--i.e. the group comprising the methanogens, extreme halophiles, and (peripherially) the genus thermoplasma. the three catalogs exhibit two features unique among bacteri ...198411541975
symbiosis as a mechanism of evolution: status of cell symbiosis theory.several theories for the origin of eukaryotic (nucleated) cells from prokaryotic (bacterial) ancestors have been published: the progenote, the direct filiation and the serial endosymbiotic theory (set). compelling evidence for two aspects of the set is now available suggesting that both mitochondria and plastids originated by symbioses with a third type of microbe, probably a thermoplasma-like archaebacterium ancestral to the nucleocytoplasm. we conclude that not enough information is availab ...198511543608
generation of a large, protonophore-sensitive proton motive force and ph difference in the acidophilic bacteria thermoplasma acidophilum and bacillus acidocaldarius.the mechanism by which acidophilic bacteria generate and maintain their cytoplasmic ph close to neutrality was investigated. for this purpose we determined the components of proton motive force in the eubacterium bacillus acidocaldarius and the archaebacterium thermoplasma acidophilum. after correction for probe binding, the proton motive force of untreated cells was 190 to 240 mv between external ph 2 and 4. anoxia diminished total proton motive force and the transmembrane ph difference by 60 t ...19852981803
[evolutionary status of acids-thermophilie archaebacteria]. 19853906775
crystallization of a fe,zn superoxide dismutase from the archaebacterium thermoplasma acidophilium.the novel fe,zn superoxide dismutase from the archaebacterium thermoplasma acidophilium has been crystallized in space groups p1, p2(1) and p2(1)2(1)2, with 2,4 and 1/2 of an 84,000 mr tetramer, respectively, estimated to be in the asymmetric unit of the unit cell. the orthorhombic crystals, which have unit cell dimensions a = 84.2 a, b = 72.7 a, c = 67.8 a, diffract x-rays to at least 2.0 a and are suitable for a determination of the three-dimensional structure of the fe,zn superoxide dismutase ...19853935799
primary structure of elongation factor 2 around the site of adp-ribosylation is highly conserved from archaebacteria to eukaryotes.elongation factor 2 (ef-2) from eukaryotes and archaebacteria can be adp-ribosylated by diphtheria toxin (dt) [(1977) annu. rev. biochem. 46, 69-94; (1980) nature 287, 250-251]. the primary structure of the adp-ribose accepting region in efs from the archaebacteria thermoplasma acidophilum halobacterium cutirubrum and methanococcus vannielli was determined in order to elucidate the degree of conservation compared with 4 previously established eukaryotic sequences [(1971) febs lett. 103, 253-255] ...19853996598
preliminary x-ray diffraction studies on a ferredoxin from the thermophilic archaebacterium, thermoplasma acidophilum.a ferredoxin from the thermophilic archaebacterium, thermoplasma acidophilum, is supposed to contain two (4fe-4s) active centers; one center could be linked by four cysteine residues to the protein and the other bonded with three cysteines and an unknown group. this ferredoxin has been crystallized by salting-out against 2.3 m-ammonium sulfate solution. the space group is p21212 with cell dimensions of a = 59.20 a, b = 52.77 a and c = 41.28 a. four molecules pack in the unit cell with vm = 2.03 ...19854087301
archaebacterial malate dehydrogenases. the enzymes from the thermoacidophilic organisms sulfolobus acidocaldarius and thermoplasma acidophilum show a-side stereospecificity for nad+.the stereoselective transfer of hydrogen from nadh to oxaloacetate catalysed by malate dehydrogenases (ec 1.1.1.37) from the thermoacidophilic archaebacteria sulfolobus acidocaldarius and thermoplasma acidophilum was studied by the p.m.r. method described by zhou & wong [(1981) j. biochem. biophys. methods 4, 329-338]. both enzymes are a-side (pro-r) stereospecific for nadh.19852985051
membrane-bound atpase of a thermoacidophilic archaebacterium, sulfolobus acidocaldarius.the membranes of sulfolobus, a thermoacidophilic archaebacterium showed two types of atp hydrolyzing activity. one was that of a neutral atpase at an optimum ph around 6.5. this enzyme was activated by 10 mm sulfate with a shift of optimum ph to 5. in these respects, the enzyme was similar to membrane-bound atpase of thermoplasma, another thermoacidophilic archaebacterium, reported by searcy and whatley [1982) zbl. bakt. hyg., i. abt. orig. c3, 245-257). the enzyme hydrolyzed atp and other ntps, ...19853159431
[prospects for using thermoacidophilic bacteria in biotechnology]. 19863078176
purification and properties of malate dehydrogenase from the thermoacidophilic archaebacterium thermoplasma acidophilum.malate dehydrogenase from the thermoacidophilic archaebacterium thermoplasma acidophilum is purified 50-fold to electrophoretic homogeneity. the purified enzyme crystallizes readily. native malate dehydrogenase shows a relative molecular mass of 144 000. it is a tetramer of identical subunits with a relative molecular mass of 36 600. malate dehydrogenase from thermoplasma uses both nadh and nadph as coenzyme to reduce oxaloacetate. the enzyme shows a-side (pro-r) stereospecificity for both coenz ...19863741624
glucose dehydrogenase from the thermoacidophilic archaebacterium sulfolobus solfataricus.glucose dehydrogenase has been purified to homogeneity from cell extracts of the extreme thermoacidophilic archaebacterium sulfolobus solfataricus. the enzyme utilizes both nad+ and nadp+ as coenzyme and catalyses the oxidation of several monosaccharides to the corresponding glyconic acid. substrate specificity and oxidation rate depend on the coenzyme present; when nad+ is used, the enzyme binds and oxidizes specifically sugars presenting equatorial orientation of hydroxy groups at c-2, c-3 and ...19863827812
differential features of ribosomes and of poly(u)-programmed cell-free systems derived from sulphur-dependent archaebacterial species.the properties of poly(u)-directed cell-free systems developed from the sulphur-dependent, thermophilic archaebacteria desulfurococcus mobilis, thermoproteus tenax, sulfolobus solfataricus, thermococcus celer and thermoplasma acidophilum have been compared. all systems are truly thermophilic in requiring incubation at temperatures close to the physiological optimum for cell growth. under optimized conditions the error frequency in trna selection is less than 0.4% at 80 degrees c, and synthetic e ...19863087750
occurrence of coenzyme f420 and its gamma-monoglutamyl derivative in nonmethanogenic archaebacteria.analysis of the fluorescent compounds extracted from six different species of halobacteria and one species each of sulfolobus and thermoplasma revealed the universal occurrence of coenzyme f420, (n-[n-[o-[5-(8-hydroxy-5-deazaisoalloxazin-10-yl)-2,3,4-trihydroxy -4-pentoxyhydroxyphosphinyl]-l-lactyl]-l-gamma-glutamyl]-l -glutamic acid), or its gamma-monoglutamyl derivative or both. the total amount (approximately 100 pmol/mg [dry weight]) of these compounds found in the halobacteria studied was a ...19863093465
improved procedure for the isolation of a double-strand-specific ribonuclease and its application to structural analysis of various 5s rrnas and trnas.an improved method for the isolation of a double-strand-specific rnase from snake venom is presented. this rnase, called csv, was used to cleave yeast trnaphe and trna2glu and trnafmet from escherichia coli. in addition these rnas and e. coli trnaphe were examined with the single-strand-specific nuclease s1. the results are discussed in terms of the specificity of csv rnase and the structure of trnas. s1 nuclease digestions at increasing temperatures allowed the melting of tertiary and secondary ...19862417836
archaebacterial phylogeny: perspectives on the urkingdoms.comparisons of complete 16s ribosomal rna sequences have been used to confirm, refine and extend earlier concepts of archaebacterial phylogeny. the archaebacteria fall naturally into two major branches or divisions, i--the sulfur-dependent thermophilic archaebacteria, and ii--the methanogenic archaebacteria and their relatives. division i comprises a relatively closely related and phenotypically homogeneous collection of thermophilic sulfur-dependent species--encompassing the genera sulfolobus ...198611542063
characteristic archaebacterial 16s rrna oligonucleotides.a method of analyzing 16s rrna catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. this approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. this signature approach has been applied to forty archaebacterial catalogs and every oligonucleot ...198611542064
bacterial bedfellows: a microscopic menage a trois may be responsible for a major step in evolution. 198711542100
5'-methylbenzimidazolyl-cobamides are the corrinoids from some sulfate-reducing and sulfur-metabolizing bacteria.the sulfate-reducing bacteria desulfobacterium autotrophicum, desulfobulbus propionicus and archaeoglobus fulgidus (vc-16) and the sulfur-metabolizing archaebacteria desulfurolobus ambivalens and thermoplasma acidophilum were found to contain considerable amounts of corrinoids, that were isolated and crystallized in their co beta-cyano form. in three other sulfur-metabolizing archaebacteria, thermoproteus neutrophilus, pyrodictium occultum and staphylothermus marinus significant amounts of corri ...19883416881
archaebacteria: their phylogenetic relationship with the eubacterial and eukaryotic kingdoms.in microbiology the discovery of archaebacteria ten years ago has wrought a profound change in the concepts of physiology, taxonomy, ecology, biochemistry, molecular biology, genetics and phylogeny. this review offers a concise summary of the state of the art in this field with special reference to taxonomy and ecology as well as to the different methodologies used to study the phylogeny of this unusual group of microorganisms that question many well established biological concepts.19882481476
[biology of chemoautotrophs]. 19883150584
aminoglycoside-induced mistranslation in thermophilic archaebacteria.the effect of selected aminoglycoside antibiotics on the translational accuracy of poly(u) programmed ribosomes derived from the thermophilic archaebacteria thermoplasma acidophilum, sulfolobus solfataricus, thermococcus celer and desulfurococcus mobilis has been determined. under optimum temperature and ionic conditions for polyphenylalanine synthesis, the four species investigated are found to be markedly diverse in their response to the miscoding-inducing action of aminoglycoside antibiotics. ...19882465484
the structure and organization of the 16s ribosomal rna gene from the archaebacterium thermoplasma acidophilum.the complete nucleotide sequence of the 16s rrna gene from thermoplasma acidophilum, as well as its 5' and 3' flanking regions, were determined by the dideoxynucleotide chain termination method. the 16s rrna gene encodes 1471 nucleotides. the primary and secondary structures of t. acidophilum 16s rrna both exhibit typical archaebacterial features. the sequence appears to be more closely related to 16s rrnas of the methanogen--halophile group than to those of the thermoacidophile group. secondary ...19892470478
phylogenetic conservation of antigenic determinants in archaebacterial elongation factors (tu proteins).by using affinity chromatography methods, we have purified elongation factor tu (ef-tu) proteins from a host of archaebacteria covering all known divisions in the archaebacterial tree except halophiles, and from such distantly related eubacteria as thermotoga maritima and escherichia coli. polyclonal antibodies were raised against the tu proteins of sulfolobus solfataricus, thermoproteus tenax, thermococcus celer, pyrococcus wosei, archaeoglobus fulgidus, methanococcus thermolitotrophicus, therm ...19892470483
the structure and evolution of archaebacterial ribosomal rnas.a cladistic analysis of 553 5s rrna sequences has revealed a ur-5s rrna, the ancestor of all present-day 5s rrna molecules. previously stated characteristic differences between the eubacterial and eukaryotic molecules, namely, the length base-pairing schemes of helices d, can be used as a marker for the various archaebacterial branches. one model comprises thermococcus, thermoplasma, methanobacteria, and halobacteria; a second comprises the sulfolobales; and a third is represented only by the si ...19892470487
comparison of initiating abilities of primers of different length in polymerization reactions catalyzed by dna polymerases from thermoacidophilic archaebacteria.optimal conditions for polymerization reaction catalyzed on poly(da) and poly(dt) templates by dna polymerases from thermoacidophilic archaebacteria--dna polymerase a from sulfolobus acidocaldarius and dna polymerase b from thermoplasma acidophilum--have been established. values of km and vmax (60 degrees c) for a set of primers d(pa)n and d(pt)n have been estimated. minimal primers for both enzymes are dnmp. lengthening of primers by each mononucleotide increases their affinity about 2.16-fold. ...19892497779
the multicatalytic proteinase (prosome) is ubiquitous from eukaryotes to archaebacteria.from the thermoacidophilic archaebacterium, thermoplasma acidophilum, a proteolytically active particle has been isolated which is almost identical in size and shape with the multicatalytic proteinase (prosome) from rat. this result indicates that prosomes have been developed early in evolution and that they possibly serve functions common to all living cells.19892502434
phenotypic characterization of the archaebacterial genus sulfolobus: comparison of five wild-type strains.though amenable to routine manipulation and a popular subject of molecular genetic and biochemical studies on archaebacteria, the genus sulfolobus has remained poorly described in phenotypic terms. to delineate their physiological capabilities and diversity, five laboratory strains, including type strains of the described species sulfolobus acidocaldarius and s. solfataricus, were compared with respect to a variety of growth and biochemical parameters, including component profile of the surface- ...19892512283
phenylalanine-to-tyrosine singlet energy transfer in the archaebacterial histone-like protein hta.the archaebacterium thermoplasma acidophilum has a histone-like protein (hta) abundantly associated with its deoxyribonucleic acid. each native tetrameric complex of hta contains 20 phenylalanine residues, 4 tyrosine residues, and no tryptophan. when the protein was excited by radiation at 252 nm, which is a wavelength absorbed predominantly by phenylalanine, the fluorescent emission was mostly from tyrosine. according to the excitation spectrum for this tyrosine fluorescence, the cause was ener ...19892513885
studies on dna polymerases and topoisomerases in archaebacteria.we have isolated dna polymerases and topoisomerases from two thermoacidophilic archaebacteria: sulfolobus acidocaldarius and thermoplasma acidophilum. the dna polymerases are composed of a single polypeptide with molecular masses of 100 and 85 kda, respectively. antibodies against sulfolobus dna polymerase did not cross react with thermoplasma dna polymerase. whereas the major dna topoisomerase activity in s. acidocaldarius is an atp-dependent type i dna topoisomerase with a reverse gyrase activ ...19892541877
purification and characterization of glucose dehydrogenase from the thermoacidophilic archaebacterium thermoplasma acidophilum.glucose dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium thermoplasma acidophilum. the enzyme is a tetramer of polypeptide chain mr 38,000 +/- 3000, it is catalytically active with both nad+ and nadp+ cofactors, and it is thermostable and remarkably resistant to a variety of organic solvents. the amino acid composition was determined and compared with those of the glucose dehydrogenases from the archaebacterium sulfolobus solfataricus and the eubacteria bacill ...19892803257
preliminary x-ray crystallographic study of malate dehydrogenases from the thermoacidophilic archaebacteria thermoplasma acidophilum and sulfolobus acidocaldarius.malate dehydrogenases from the thermoacidophilic archaebacteria thermoplasma acidophilum and sulfolobus acidocaldarius have been crystallized and characterized by x-ray diffraction measurements. crystals of the enzyme from t. acidophilum display space-group symmetry p2(1), a = 63 a, b = 135 a, c = 83 a and beta = 105 degrees; they scattered to approximately 4 a resolution. two crystal modifications of malate dehydrogenase from s. acidocaldarius were characterized; one displayed trigonal symmetry ...19892507788
small ribosomal subunit rna sequences, evolutionary relationships among different life forms, and mitochondrial origins.a tree was constructed from a structurally conserved area in an alignment of 83 small ribosomal subunit sequences of eukaryotic, archaebacterial, eubacterial, plastidial, and mitochondrial origin. the algorithm involved computation and optimization of a dissimilarity matrix. according to the tree, only plant mitochondria belong to the eubacterial primary kingdom, whereas animal, fungal, algal, and ciliate mitochondria branch off from an internal node situated between the tree primary kingdoms. t ...19902111858
purification and characterization of a dna polymerase from the archaebacterium thermoplasma acidophilum.a thermophilic dna polymerase has been purified to near homogeneity from the archaebacterium thermoplasma acidophilum. analysis of the purified enzyme by sodium dodecyl sulfate gel electrophoresis revealed a single polypeptide of 88 kda which co-sediments with the dna polymerase activity on sucrose gradients. combination of sedimentation and gel filtration analyses indicates that this dna polymerase is an 88-kda monomeric enzyme in its native form. the dna polymerase is resistant to aphidicolin, ...19902115439
[the archaebacterial ribosome]. 19902181533
Displaying items 1 - 100 of 527