Publications

TitleAbstractYear
Filter
PMID
Filter
a fluorigenic substrate for the rapid differentiation of mycobacterium fortuitum from mycobacterium chelonei on the basis of heat stable esterase activity.a fluorigenic substrate, 4-methylumbelliferyl butyrate, enables mycobacterial esterase activity to be easily and rapidly detected and quantitated. by use of this substrate, the esterase activity of mycobacterium fortuitum was found to be significantly more heat resistant than that of m. chelonei. on this basis, a rapid, simple and inexpensive test for the differentiation of these two species has been developed.1977339449
mycobacteria isolated from exotic animals.mycobacteria were isolated from 263 of 474 specimens submitted from captive exotic (nondomesticated) animals over a 5-year period. mycobacterium avium was isolated from 128 animals originating in 13 states and the district of columbia; serotype 1 accounted for 65 of the isolations. mycobacterium bovi was isolated from 74 animals in 7 zoos, 7 game parks, and 4 primate colonies in 1, states: mycobacterium tuberculosis was isolated from 29 animals originating 9 stats; and mycobacterium fortuitum, m ...1977406254
infection of glutaraldehyde-preserved porcine valve heterografts.gross, histologic and ultrastructural changes associated with bacterial infection are described in four porcine valve heterografts that had been in place in patients for 6 days to 28 months. in one patient, culture of the aortic tissue tag included in the heterograft container grew mycobacterium chelonei; however, examination of the heterograft, recovered at necropsy 6 days after implantation, revealed small colonies of bacteria that differed morphologically from mycobacteria. a second heterogra ...1979443172
sporotrichoid cutaneous infection due to mycobacterium chelonei.extensive cutaneous lesions that simulated sporotrichosis developed in a patient. mycobacterium chelonei, a facultative pathogen that exists as a saprophyte in the environment and rarely produces clinical disease in humans, grew from culture of biopsy material. there was no evidence of visceral involvement, and the lesions healed spontaneously within six months.1979453880
osteomyelitis, pericarditis, mediastinitis, and vasculitis due to mycobacterium chelonei. 1977848795
megaesophagus and pneumonia associated with mycobacterium chelonei. a case report and a literature review.the case of a 37-year-old woman who developed a subacute, bilateral, noncavitary pneumonia 5 years after a colon interposition esophagoplasty is presented. mycobacterium chelonei, subspecies abscessus, was assigned a pathogenic role based on the findings of (1) a clinical and roentgenographic picture consistent with tuberculosis, (2) sputum smears showing acid-fast bacilli, (3) repeated sputum cultures yielding heavy growths of mycobacterium chelonei, subspecies abscessus, and (4) a 12-mm by 12 ...1977931183
mycobacterium chelonei infection in a natterer manatee. 1976988008
cervico-facial infection with mycobacterium chelonei--a case report. 19761063040
an inguinal bubo caused by mycobacterium chelonae abscessus. 19921286124
isoelectric focusing patterns of beta-lactamases in the rapidly growing mycobacteria.beta-lactamases from 259 strains of rapidly growing mycobacteria that included the third biovariant complex of mycobacterium fortuitum, m. peregrinum, m. abscessus, m. chelonae, the m. chelonae-like organisms (mclo), and m. smegmatis were analyzed by isoelectric focusing (ief). all isolates produced acidic beta-lactamases with major band isoelectric points (pis) between 4.4 and 6.0. each of the 6 taxonomic groups exhibited 1 or 2 characteristic beta-lactamase ief patterns. heterogeneity among ie ...19921292713
[clinical analysis of 41 cases of pulmonary atypical mycobacteriosis].this paper reported forty-one patients with pulmonary atypical mycobacteriae infection from jan. 1988 to oct. 1990 in our hospital. 25 male and 16 female. the age ranged from 27 to 70 years, average 50.9 years. according to runyon classification of mycobacterium diseases, there are 4 cases with mycobacterisos kansasii, 2 with m. scrofulaceum, 14 with m. intracellulare or m. avium, 9 with m. chelonae and 12 with m. fortuitum, respectively. characteristics of this disease were long history, mild s ...19921307510
ci-960 (pd127391 or am-1091), sparfloxacin, win 57273, and isepamicin activity against clinical isolates of mycobacterium avium-intracellularae complex, m. chelonae, and m. fortuitum.a 7h9 broth microdilution method against ci-960, sparfloxacin, win57273, ciprofloxacin, norfloxacin, isepamicin, amikacin, kanamycin, ethambutol, isoniazid, and rifampin was used to test 35 mycobacterium avium-intracellulare complex (mai) and five m. chelonae-fortuitum strains. the majority of mai isolates were inhibited by all tested compounds, with sparfloxacin (mic90, 0.5 micrograms/ml) being the most active among the fluoroquinolones; isepamicin (mic90, 4 micrograms/ml), the most potent amin ...19921315233
activities of four macrolides, including clarithromycin, against mycobacterium fortuitum, mycobacterium chelonae, and m. chelonae-like organisms.susceptibilities to erythromycin by broth microdilution were compared with those to the newer macrolide clarithromycin for 223 isolates of rapidly growing mycobacteria belonging to seven taxonomic groups. seventy-nine random isolates were also tested against azithromycin and roxithromycin. the mic of clarithromycin for 90% of strains tested (mic90) was 0.25 microgram/ml for isolates of mycobacterium chelonae subsp. chelonae and 0.5 microgram/ml for m. chelonae subsp. abscessus, with 100% of stra ...19921317144
clarithromycin. a review of its antimicrobial activity, pharmacokinetic properties and therapeutic potential.clarithromycin is an acid-stable orally administered macrolide antimicrobial drug, structurally related to erythromycin. it has a broad spectrum of antimicrobial activity, similar to that of erythromycin and inhibits a range of gram-positive and gram-negative organisms, atypical pathogens and some anaerobes. significantly, clarithromycin demonstrates greater in vitro activity than erythromycin against certain pathogens including bacteroides melaninogenicus, chlamydia pneumoniae, chlamydia tracho ...19921379907
[repeated contamination of an antiseptic solution by mycobacterium chelonei]. 197994449
atypical mycobacterium keratitis.we present two cases of mycobacterium chelonae keratitis, both of which followed minor corneal trauma. one case initially showed improvement with medical therapy alone but eventually required penetrating keratoplasty. the second case required surgical intervention to provide tectonic support, but the infection resolved with antibiotic therapy.19921449781
nontuberculous mycobacterial disease of the lungs in singapore.information on lung disease due to nontuberculous mycobacteria (ntm) is lacking in singapore. a review of the records at the central tuberculosis laboratory up to the end of 1988 showed that 23 patients seen between 1976 to 1988 inclusive had cultures which were repeatedly positive for ntm. of the 23 cases analyzed, 15 were found to have lung disease which could be attributed to ntm. there were 9 males and 6 females with a male to female ratio of 1.5:1. the patients were either middle aged or el ...19921455269
imipenem in the treatment of lung infections due to mycobacterium fortuitum and mycobacterium chelonae: further experience. 19921457638
nonspecificity of the anda a60-tb elisa test for serodiagnosis of mycobacterial disease.the conventional methods for the laboratory diagnosis of tuberculosis and other mycobacterial diseases are time consuming and beyond the scope of most of the small and medium-sized hospital facilities. therefore, there has been considerable interest in the development of a serological method for the detection of antibodies against mycobacteria. we recently evaluated a commercially available elisa test (anda biologicals, strasbourg, france) that measures antibody levels to a60 antigen, a membrane ...19921458372
mycobacterium chelonei iatrogenic infections.we report on two outbreaks of mycobacterium chelonei subsp. abscessus cutaneous infections, which occurred between june 1974 and april 1975 in a series of 24 patients (15 studied bacteriologically) subjected to venous stripping for varicose veins. the source of infection was the aqueous solution of merbromin used in presurgical care.197877278
mycobacteria as a cause of infective exacerbation in bronchiectasis.in 91 patients with bronchiectasis seen over 6 years, a positive mycobacterial culture was obtained in 12 cases (13%). the organisms isolated were mycobacterium tuberculosis in nine cases, mycobacterium avium in two cases and mycobacterium tuberculosis and chelonei were obtained on separate occasions in one case. computed tomography and/or bronchography showed that the bronchiectatic changes commonly involved the lower lobes and to a lesser extent, the middle and lingula lobes. in none of these ...19921494510
granulomatous synovitis: the role of atypical mycobacteria.clinical data on 25 patients with granulomatous synovitis and bursitis observed from 1970 through 1977 are reviewed. the lesions occurred about the extremities, the wrists and hands being involved most often. with three exceptions, the patients had no significant underlying disease. the lesions were chronic and often followed minor trauma. many patients had had prior surgery, steriod injections, or both. at the time of surgery for the synovitis, the gross appearance proved to be relatively chara ...1979542760
disseminated infection due to mycobacterium chelonei.we have presented a case of m chelonei subsp abscessus in an immunocompromised patient. the patient was given antimicrobial therapy, to which the organism appeared sensitive for 4 weeks, but he died because of other medical problems. repeated negative blood cultures for mycobacteria after the initiation of therapy and a careful postmortem examination suggested that the antimicrobial therapy was effective.19921439955
mycobacterial infections following heart valve replacement.mycobacterial infection is an uncommon but very serious complication of heart valve replacement and other forms of cardiac surgery. tuberculosis has been a rare complication of valve replacement in the industrially developed countries owing to the low incidence of that disease in such countries. most reported cases are associated with the insertion of human allograft valves. valvular tuberculosis could become a more serious problem if heart valve replacement surgery is used to any extent in coun ...19921341213
activity of amikacin, erythromycin and doxycyline against mycobacterium chelonei and mycobacterium fortuitum.the activity of amikacin, erythromycin and doxycycline was studied against 18 strains of m. fortuitum and 10 of m. chelonei. the agar dilution technique was used for the evaluation of the minimum inhibitory concentration. between the three drugs tested, amikacin was the most active, since 66.6% of the m. fortuitum and 80% of m. chelonei strains were inhibited at 12.8 microgram/ml. it is possible that in some circumstances amikacin could be useful in the treatment of infections caused by m. fortu ...1978726085
disk diffusion testing of susceptibility of mycobacterium fortuitum and mycobacterium chelonei to antibacterial agents.although recent studies have suggested that some antibacterial agents have good activity against the rapidly growing mycobacteria mycobacterium fortuitum and mycobacterium chelonei, an easily applicable method for susceptibility testing of clinical isolates is not yet available. we evaluated a disk diffusion method with mueller-hinton agar and 48-h readings with 59 strains of m. fortuitum and 11 strains of m. chelonei and compared the results to agar dilution susceptibilities for nine antimicrob ...1979526002
pseudoepidemic of nontuberculous mycobacteria due to a contaminated bronchoscope cleaning machine. report of an outbreak and review of the literature.we describe a pseudoepidemic due to nontuberculous mycobacteria contaminating the water tank of a machine used to clean and disinfect fiberoptic endoscopes. forty-six bronchoscopies performed on 41 patients during a six-month period yielded 16 specimens positive for acid-fast bacilli (afb). one specimen showed mycobacterium avium complex from an aids patient and one, m tuberculosis from a patient with active cavitary tuberculosis. in four patients, only the smears showed afb; subsequent cultures ...19921582279
[pulmonary mycobacteriosis due to mycobacterium chelonei: a report on a new case (authors' transl)].mycobacterium chelonei is a saprophytic germ usually devoid of pathogenic activity. over a period of about the last ten years, however, several cases have been reported, including twelve cases of bronchopulmonary affections, in which it has been the infecting organism. the radiographic appearance is in every respect similar to that observed in pulmonary tuberculosis. a positive diagnosis of infection due to this germ can be made by the absence of kuch's bacillus the lack of therapeutic effect of ...1979475209
disseminated mycobacterium chelonei infection: response to sulfonamides.a disseminated infection due to mycobacterium chelonei occurred in a hemodialysis patient after rejection of his second renal transplant. painful subcutaneous nodules and abscesses were found on both legs. therapy with sulfisoxaxole and kanamycin produced a prompt response twice, as did sulfisoxazole alone on 2 additional occasions, despite resistance in vitro to both drugs. clinical relapses occurred 3 times when administration of sulfisoxazole was discontinued.1979464378
mycobacterium xenopi, mycobacterium fortuitum, mycobacterium kansasii, and other nontuberculous mycobacteria in an area of endemicity for aids.between 1981 and 1990, cultures of specimens from 86 patients at state university of new york-health sciences center at brooklyn were positive for nontuberculous mycobacteria other than mycobacterium avium/mycobacterium intracellulare complex or mycobacterium gordonae. the most common species isolated were mycobacterium xenopi (33), mycobacterium fortuitum (28), mycobacterium kansasii (7), and mycobacterium chelonae (6). thirty-five patients (41%) had clinical and/or serological evidence of huma ...19921617056
nontuberculous mycobacterial keratitis. report of two cases and review of the literature.we report two cases of nontuberculous mycobacterial keratitis. to our knowledge, case 1 is the first documented case of mycobacterium chelonei sclerokeratitis and case 2 is the first report of mycobacterium flavescens keratitis. a total of 40 cases of nontuberculous mycobacterial keratitis involving at least five different species have been reported previously in the literature. almost all of these opportunistic infections have occurred following either accidental or surgical ocular trauma, usua ...19921562261
[activity of polar glycopeptidolipids from mycobacterium chelonae in the reversal of chemically induced leukopenia in mice].intraperitoneal administration of polar glycopeptidolipids extracted from mycobacterium chelonae (gplp-mc) has led to reversal of doxorubicin-induced leucopenia in a manner comparable to that effected by gm-csf administered in a dose of 100 iu (2.5 micrograms/kg). the mode of action and the toxicity of this product are being studied. results obtained on the mouse indicate that it would be worthwhile to undertake tests in man aimed at studying the effect of gplp-mc on chemotherapy- and radiothera ...19921422916
fatal case of disseminated infection with the turtle bacillus mycobacterium chelonae.an apparently immunocompetent 78 year old woman presented with confusion, subcutaneous abscesses, and lesions of the nasopharynx. gram positive, acid fast bacilli were isolated from her blood after 10 days' incubation. she was treated with trimethoprim-sulphamethoxazole for presumed disseminated nocardiasis but deteriorated and died. a post mortem examination showed skin and pulmonary lesions and endomyocardial fibrous plaques. organisms isolated from the skin and lung were indistinguishable fro ...19921624602
[contamination of endoscopes and endoscope washers by atypical mycobacteria].contamination of endoscopes and endoscope washers by atypical mycobacteria was studied. large amounts of atypical mycobacteria were detected with high frequency inside endoscopes and endoscope washers. the species of atypical mycobacteria was mycobacterium chelonae subsp. abscessus. antibacterial-effects of glutaraldehyde against isolated atypical mycobacteria were checked. sufficient antibacterial-effect was not obtained by 2% glutaraldehyde solution for endoscope sterilization. however, after ...19921624823
acid-fast bacillus contamination of a bronchoscope washing machine. 19911684602
occurrence of mycobacteria in biofilm samples.the occurrence of mycobacteria was studied in 50 biofilm samples from water treatment plants, domestic water supply systems and aquaria. mycobacteria were found in 90% of the samples and their densities usually ranged between 10(3) and 10(4) cfu/cm2 (maximum density 5.6 x 10(6) cfu/cm2). organic substances such as plastics and rubber were usually colonized by larger numbers of mycobacteria than inorganic substances such as copper and glass. the highest mycobacterial densities were found on plast ...19921421346
catheter-related infections caused by the mycobacterium fortuitum complex: 15 cases and review.fifteen cancer patients have developed catheter-related infections caused by the mycobacterium fortuitum complex (m. fortuitum and mycobacterium chelonae) at m. d. anderson cancer center since 1978. eleven patients had bacteremia and four had catheter site infections. nine infections were caused by m. fortuitum and six by m. chelonae. all four bacteremic patients whose catheters were initially removed and who were treated with antibiotics recovered, whereas for all of the seven bacteremic patien ...19911775845
pulmonary nontuberculous mycobacteriosis showing wandering shadows in chest roentgenograms.the case of a 68-year-old woman with pulmonary nontuberculous mycobacteriosis, whose chest roentgenograms showed unusual wandering shadows on separate occasions, is presented. acid-fast bacilli were detected in her sputa and by bronchial washing, and were identified as mycobacterium chelonae, subspecies abscessus. the findings of computed tomography and transbronchial lung biopsy were also unique because of multiple peribronchial inflammations. chemotherapy with anti-tuberculosis agents and a ne ...19911792425
skin, soft tissue, and bone infections due to mycobacterium chelonae chelonae: importance of prior corticosteroid therapy, frequency of disseminated infections, and resistance to oral antimicrobials other than clarithromycin.little is known of clinical disease due to mycobacterium chelonae chelonae. one hundred skin, soft tissue, or bone isolates of this rapidly growing mycobacterium were identified over 10 years. clinical disease included disseminated cutaneous infection (53%); localized cellulitis, abscess, or osteomyelitis (35%); and catheter infections (12%). underlying conditions with disseminated infection included organ transplantation, rheumatoid arthritis, and autoimmune disorders; 92% involved corticostero ...19921386098
porins in the cell wall of mycobacteria.the cell wall of mycobacteria is an efficient permeability barrier that makes mycobacteria naturally resistant to most antibiotics. liposome swelling assays and planar bilayer experiments were used to investigate the diffusion process of hydrophilic molecules through the cell wall of mycobacterium chelonae and identify the main hydrophilic pathway. a 59-kilodalton cell wall protein formed a water-filled channel with a diameter of 2.2 nanometers and an average single-channel conductance equal to ...19921279810
nosocomial infection and pseudoinfection from contaminated endoscopes and bronchoscopes--united states. 19911843659
newly documented antimicrobial activity of quinolones.the improved antimicrobial activity of newer fluoroquinolones and novel applications recently found for the drugs already marketed are reviewed. several new compounds are more active against gram-positive bacteria than the presently marketed fluoroquinolones. win 57273, the most potent compound in vitro on a weight basis, is 16 to 128 times more active than ciprofloxacin against various staphylococci, streptococci, enterococcus spp., corynebacterium spp., listeria monocytogenes and bacillus spp. ...19911864284
prosthetic valve endocarditis due to mycobacterium chelonei.postoperative prosthetic valve endocarditis due to mycobacterium chelonei occurred in a man after replacement of the aortic valve. the organism was isolated from blood cultures and from vegetations taken postmortem from the edge of the inserted valve. this is believed to be the first documented report of a mycobacterial endocarditis.19751176621
prosthetic valve endocarditis due to mycobacterium chelonei.starr-edwards mitral and aortic prosthetic valves served as nidi for endocarditis due to m chelonei. cultural, physiologic, lipid chromatographic, and serologic studies identified the organism as m chelonei (abscessus).1976968552
the pathogenicity of mycobacterium fortuitum and mycobacterium chelonei in man: a report of seven cases.the clinical records of 7 patients referred to the national jewish hospital and research center over a 6-year period for evaluation of an abnormal chest x-ray and repeated sputum isolates of rapidly growing mycobacteria (runyon's group iv) were reviewed to determine the potential pathogenicity of these organisms. mycobacterium fortuitum was isolated from 5 patients and mycobacterium chelonei from 2. haemoptysis, cough and weight loss were prominent in 6. three had rheumatoid arthritis. although ...1976941300
mycobacterium chelonei infection of porcine heart valves. 1977895768
mycobacterium chelonei isolation from broncho-alveolar lavage fluid and its practical implications.mycobacterium chelonei was isolated from the broncho-alveolar lavage fluid of seven patients on eight occasions over a 6-month period. the same bacterium was identified in the hospital water supply. despite the use of a recommended disinfection procedure, it proved impossible to eradicate the organism until the bronchoscopes were treated with ethylene oxide and the use of tap water in rinsing was abandoned.19901979576
host modification and restriction with a mycobacteriophage isolated from a pseudolysogenic mycobacterium chelonei.a pseudolysogenic mycobacterium chelonei and its phage phi630 are described. phage phi630 is the first mycobacteriophate reported to be resistant to the nonpolar solvents chloroform, dioxan and diethyl ether. the phage had a latent period of 75 min, a rise period of 90 min and a burst size of 5i. evidence is presented for host modification and restriction. phage phi630a, grown on host strain m. chelonei f-630 rg, plated on the alternative host m. smegmatis atcc607 with an efficiency of plating ( ...1977874454
susceptibilities of mycobacterium fortuitum biovar. fortuitum and the two subgroups of mycobacterium chelonae to imipenem, cefmetazole, cefoxitin, and amoxicillin-clavulanic acid.mics of imipenem, cefoxitin, cefmetazole, and amoxicillin-clavulanic acid were determined against 100 strains of mycobacterium fortuitum and 200 strains of mycobacterium chelonae. imipenem and cefmetazole were more active against m. fortuitum than cefoxitin was, and imipenem (which inhibited 39% of strains at 8 micrograms/ml) was the only beta-lactam active against m. chelonae subsp. chelonae.19912069387
mycobacterium chelonei infection: successful treatment based on a radiometric susceptibility test.a patient with mycobacterium chelonei infection was treated with erythromycin stearate and streptomycin. the choice of antibiotics was based on a rapid radiometric susceptibility test developed in our laboratory.1977856032
keratitis due to mycobacterium chelonei.a case of ulcerative keratitis has been followed by ophthalmological, bacteriological and histopathological examinations. mycobacterium chelonei has been repeatedly isolated from the lesion before and after surgical interventions.1978635994
[mycobacteriosis in sea mammals and birds].different diagnostic techniques for mycobacteria were studied in sea lions, sea elephants, fur seals, dolphins, killer whales and penguins from a sea aquarium. three strains were isolated from fur seals. two were classified as mycobacterium chelonae and one as mycobacterium fortuitum complex. there was good correlation between the results given by the intradermal tuberculin test and elisa, but the former is recommended as a screening test on the basis of its practicality. results and methodology ...19902132708
in vitro susceptiiblity of mycobacterium fortuitum and mycobacterium chelonei to amikacin.infections due to runyon group iv atypical mycobacteria, mycobacterium fortuitum and mycobacterium chelonei, in humans have been difficult to treat in the past because of the organisms' resistance to all of the conventional antimycobacterial drugs. determinations of minimal inhibitory concentrations (mics) by the agar dilution method suggest that amikacin may be useful in the treatment of infections due to m. fortuitum and m. chelonei. further support for the efficacy of antimicrobial agents wit ...1978632627
delayed hypersensitivity reactions in patients with mycobacterium chelonei and mycobacterium fortuitum infections.delayed hypersensitivity reactions to skin test antigens prepared from rapidly growing mycobacteria were measured in patients with postoperative wound infections due to mycobacterium chelonei and m. fortuitum. sixteen of 19 patients with m. chelonei infection had more than 10 mm of induration to the m. chelonei purified protein derivative antigen (ppd-cg) and were significantly more likely to react to ppd-cg than patients or hospital personnel who had no evidence of infection. all but one patien ...1978629486
atypical mycobacteria and the xenograft valve.during a 4 month interval, cultures taken at the time of porcine xenograft valve implantation grew a fastidious atypical mycobacterium, mycobacterium chelonei (runyon's groups iv), in eight of 20 patients. initial growth occurred at 2 to 3 weeks in thioglycollate broth only; detailed biochemical and bacteriologic evaluation demonstrates altered catalase activity accounting for its initial slow growth. only one patient has manifested clinical evidence of infection 5 months after mitral valve repl ...1978564994
isolation of mycobacterium chelonei from a granulomatous lesion in a pig.a rapidly growing, non-photochromogenic acid-fast organism was isolated from a lesion in a 6-month-old pig. the isolate was subsequently identified as mycobacterium chelonei by its growth rate, but its failure to reduce nitrates, and by being arylsulfatase positive at 3 days.1977560396
endobronchial closure of a postpneumonectomy bronchopleural fistula.successful permanent endobronchial closure of a serious postpneumonectomy bronchopleural fistula is reported in a patient with a delayed diagnosis of mycobacterium fortuitum-cheloni infection. increasing experience, improved plugging agents, and a review of the literature suggest that in selected patients, this procedure can avoid complex repeat operations and reverse life-threatening situations. although atypical mycobacterial infections occur with infrequency, they are difficult to treat and m ...19921554283
tuberculoid cutaneous infection due to a niacin-positive mycobacterium chelonei.a case of cutaneous infection due to a niacin-positive mycobacterium chelonei (previously called m. abscessus) on the dorsum of the hand of a professional cotton-classifier is reported from hong kong. the infection was probably directly acquired from handling contaminated raw cotton. the patient was successfully treated with combined anti-tuberculous drugs over a period of 1 year. histologically, the skin lesion showed tuberculoid granulomas, in addition to abscesses.1979475989
severe cutaneous mycobacterium chelonei infection following a yellow jacket sting. 19921493240
contamination of flexible fiberoptic bronchoscopes with mycobacterium chelonae linked to an automated bronchoscope disinfection machine.between december 5, 1989, and september 25, 1990, mycobacterium chelonae was isolated from endoscopic or bronchial washings in 14 patients on a single clinical service. a phenotypically unique strain of m. chelonae subspecies abscessus that was highly resistant to cefoxitin (mic greater than 256 micrograms/ml) and different from 13 control isolates of m. chelonae recovered elsewhere in the hospital was identified in all these patients and the rinse water from the bronchoscope disinfecting machin ...19921554214
nontuberculous mycobacteria in adult patients with cystic fibrosis.because patients with cystic fibrosis (cf) may be predisposed to airway infections with unusual microorganisms, we screened the sputum of adult cf patients for mycobacterial organisms. acid-fast bacilli (afb) smears and mycobacterial culture were performed on 297 sputum specimens from 87 patients. cultures for mycobacteria were frequently overgrown with other bacteria; 22.6 percent of cultures were contaminated. despite this limitation of mycobacterial culture, 17 patients had at least one posit ...19921623799
permeability barrier to hydrophilic solutes in mycobacterium chelonei.in order to define the permeability barrier to hydrophilic molecules in mycobacteria, we used as a model a smooth, beta-lactamase-producing strain of mycobacterium chelonei. the rates of hydrolysis of eight cephalosporins by intact and sonicated cells were measured, and the permeability coefficient (p) was calculated from these rates by the method of zimmermann and rosselet (w. zimmermann and a. rosselet, antimicrob. agents chemother. 12:368-372, 1977). p ranged from (0.9 +/- 0.3) x 10(-8) (benz ...19902307653
mycobacterial diseases other than tuberculosis.the incidence of tuberculosis in the united states declined steadily until 1985, while at the same time, for at least the past 15 years, the frequency of disease attributable to other mycobacteria increased both in actual numbers and in the proportion of the total burden of mycobacterioses. chronic pulmonary disease, lymphadenitis in children, skin and soft-tissue involvement, and infections of the skeletal system were predominant, and the principal etiologic agents were mycobacterium avium/myco ...19921617048
outbreak of mycobacterium chelonae infection associated with use of jet injectors.between january 1 and may 15, 1988, foot infections due to mycobacterium chelonae subspecies abscessus were diagnosed in eight persons who had undergone invasive procedures at a podiatry office. a cohort study was performed to evaluate risk factors for disease. persons who underwent procedures before 10:30 am were more likely to have developed infection than those with procedures after that time (relative risk, 5.6). in addition, procedures involving any of the second through fourth toes were mo ...19902362334
[inner ear damage induced by bacteria (mycobacterium chelonae)].mycobacterium chelonae has a pathogenicity for mouse inner ear, resulting in "spinning disease". the mice were subjected to intravenous injection of 1-1.2 x 10(7) organisms of strain atcc19977 of m. chelonae subspecies abscessus. morphological changes in the inner ear were investigated together with changes in behavior and auditory brainstem response (abr). three days after injection, the threshold of abr rose in high frequency and the latency of the fifth wave prolonged. the behaviors of the mi ...19902348283
mycobacterium chelonei infection of a broviac catheter insertion site.mycobacterium chelonei infection developed at the insertion site of an indwelling broviac catheter in a child with erythroleukemia. direct adherence to and colonization of the intra- and extra-luminal surfaces of the catheter, with extension to the adjacent subcutaneous tissue, by this rapidly growing mycobacterium may have been the primary factor underscoring the infection. nontuberculous mycobacteria such as mycobacterium chelonei grow readily on routine bacteriologic media and resemble coryne ...19892504592
post-surgical nasal cellulitis outbreak due to mycobacterium chelonae.an outbreak of post-rhinoplasty nasal cellulitis due to mycobacterium chelonae in a secondary care centre is described. a case-control study demonstrated that the use of inadequately sterilized surgical equipment in the otorhinolaryngology department was a risk factor. the causal organism was cultured from the equipment, from the surface of the operating theatre lamp, adhesive tape and from two of the hospital's general water tanks. introduction of effective instrument sterilization methods, mon ...19911684612
scleral buckle infections due to atypical mycobacteria.six cases of scleral buckle infections due to atypical mycobacteria were studied to determine their clinical and microbiologic features and the response of these infections to treatment. all infections were treated with exoplant removal and administration of a variety of antibiotics. symptoms and clinical signs of infection resolved rapidly after treatment in all cases, and visual acuity returned to the best preoperative level in 5 of 6 cases. there are no clinical features to distinguish mycoba ...19911813955
[mycobacterium chelonei pulmonary infections. apropos of a case].infections caused by mycobacterium chelonei are rare. we report a case of pulmonary infection in a 57-year-old non-immunocompromised woman. most of the abnormalities were observed at radiology which showed bilateral apical excavated opacities. the disease could only be diagnosed on surgical biopsies. beside diagnostic problems, m. chelonei infections are a source of therapeutic problems.19911836895
successful treatment of pulmonary infection due to mycobacterium chelonae: case report and review.during the past decade, mycobacterium chelonae has been recognized with increasing frequency as a pulmonary pathogen. a review of previously reported cases reveals that most patients with pulmonary infections due to m. chelonae are nonimmunosuppressed but have underlying chronic lung disease. the infection is notably absent among blacks. m. chelonae organisms are characterized by a high degree of in vitro resistance to antituberculous drugs, and attempts at eradicating the organism through chemo ...19921571422
biofilm and scleral buckle-associated infections. a mechanism for persistence.scleral buckle infections tend to be persistent as well as resistant to antimicrobial treatment. often, scleral buckle infections require removal of the buckling elements for resolution. to determine if bacteria are able to persist on scleral buckles by elaborating a glycocalyx matrix or biofilm that offers protection against host defenses and antimicrobial treatment, the authors cultured 28 scleral buckle elements removed for infection and extrusion. bacteria were isolated from 18 elements (64% ...19911866148
atypical mycobacterium soft-tissue infection of the dorsal radial wrist: a possible complication of steroid injection for de quervain's disease.corticosteroid injection into the first dorsal compartment for acute de quervain's tenosynovitis is an accepted form of therapy. potential side effects include soft-tissue atrophy, tendon attrition, postinjection neuritis of the superficial radial nerve, systemic reactions, and infection. we present a patient with a mycobacterium chelonei infection localized to the soft tissue overlying the first dorsal compartment, occurring 3 years after a triamcinolone injection into this area. histological e ...19911872558
tuberculosis in saudi arabia: epidemiology and incidence of mycobacterium tuberculosis and other mycobacterial species.the epidemiology of mycobacterial infections was studied in a wide cross-section of the jeddah population over 2 years (1987-1989). saudis, non-saudis and patients from a stable population attending national guard king khalid hospital (ngkkh) were compared. the ratio of saudi to non-saudi was 1:2 and males accounted for 65% of the total. the incidence was highest among young adults although the peak varied slightly between saudi and non-saudi patients. extra-pulmonary tuberculosis was also prepo ...19911882445
interplay of cell wall barrier and beta-lactamase activity determines high resistance to beta-lactam antibiotics in mycobacterium chelonae.we calculated the target access index, which reflects the probability that a drug will reach its target at an effective concentration, and the predictive mics of cephaloridine, cephalothin, and cefazolin for mycobacterium chelonae from the drug concentrations inhibiting the binding of benzylpenicillin to penicillin-binding proteins, the permeability coefficients, and the beta-lactamase properties. despite a low level of beta-lactamase activity and because of a very effective permeability barrier ...19911952873
treatment of mycobacterium chelonae infection with controlled localized heating.an immunocompetent man acquired a localized cutaneous infection caused by the atypical mycobacterium mycobacterium chelonae. this was successfully treated with controlled localized heating with a hand-held radiofrequency heat generator. possible mechanisms of effects of heat on this organism are discussed.19912050854
sporotrichoid cutaneous infection due to mycobacterium chelonei in a renal transplant patient.atypical mycobacterial infections are becoming more common in dermatological practice due to increasing numbers of immunosuppressed patients. a case of cutaneous mycobacterium chelonei infection with sporotrichoid spread in a renal transplant patient is described, and the current literature regarding clinical spectrum, histopathology and management of infection with this pathogen is reviewed.19902095734
polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis.a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ...19902109022
proposal of mycobacterium peregrinum sp. nov., nom. rev., and elevation of mycobacterium chelonae subsp. abscessus (kubica et al.) to species status: mycobacterium abscessus comb. nov.we studied the taxonomic positions of the rapidly growing organism mycobacterium fortuitum and phenotypically related organisms. we confirmed that "mycobacterium peregrinum" atcc 14467t (t = type strain) is genetically independent of m. fortuitum atcc 6841t by using various dna hybridization conditions. strains that were genetically identified as "m. peregrinum" were phenotypically differentiated from m. fortuitum atcc 6841t. thus, we propose that "m. peregrinum" should be revived as an independ ...19921581184
disseminated mycobacterium chelonae subspecies chelonae infection with cutaneous and osseous manifestations.a 75-year-old man who had been receiving corticosteroids for treatment of chronic obstructive pulmonary disease presented with nodulopustular skin lesions, bone pain, and constitutional symptoms. evaluation revealed a disseminated infection with mycobacterium chelonae subspecies chelonae, with cutaneous and osseous involvement documented by histopathologic studies and cultures. the bone involvement is a novel observation for this subspecies. the patient was successfully treated with a three-drug ...19902200346
immunomodulatory properties of a strain of mycobacterium chelonae--ii. qualitative and quantitative stimulation of mouse splenocytes by mycobacterium chelonae.intraperitoneal [i.p.] and subcutaneous [s.c.] administration to balb/c mice with a single dose of 5 mg/kg body weight (wet weight) of live mycobacterium chelonae (mch) augmented splenocyte blastogenesis. similar increases in splenocyte blastogenesis manifested during a single oral administration to mice with 100 mg/kg body weight (wet weight) of this mycobacterium. when splenocytes issued from these mice are activated by mitogens, a highly significant enhancement of lymphoblastic transformation ...19902208972
the turtle's revenge: a case of soft tissue mycobacterium chelonae infection.a case of cutaneous mycobacterium chelonae infection with sporotrichoid spread and extensive antibiotic resistance is presented. control of this problem was only achieved after extensive debridement and grafting of the involved limb. the importance of surgery in management is discussed and the literature is reviewed.19902215341
ofloxacin and imipenem in the treatment of mycobacterium fortuitum and mycobacterium chelonae lung infections.two patients with mycobacterium fortuitum and one patient with mycobacterium chelonae lung infections were treated with ofloxacin and imipenem respectively. of the former two, one had underlying inactive pulmonary tuberculosis and bronchiectasis and the other had silicosis. the latter had severe underlying bronchiectasis also. the treatments were well tolerated and the patients responded well.19902219463
mycobactin analysis as an aid for the identification of mycobacterium fortuitum and mycobacterium chelonae subspecies.mycobactin patterns from 65 mycobacterium fortuitum and mycobacterium chelonae strains have been determined by thin-layer chromatography. by use of a rich liquid medium containing an iron chelator (ethylenediamine-di-o-hydroxyphenylacetic acid [edda]) to ensure iron starvation, all strains were able to form mycobactins. the method developed here allows sensitive detection of mycobactin by thin-layer chromatography from as little as 5 ml of culture after a 2-week incubation. within m. fortuitum t ...19921583124
mycobacterium chelonei keratopathy with visual rehabilitation by a triple procedure.we report a chronic keratouveitis following an eye injury, the etiology of which remained obscure despite repeated corneal scrapings and cultures. eventually, the diagnosis was established by culturing mycobacterium chelonei from a corneal biopsy specimen. topical amikacin resolved active inflammation, but dense corneal scarring and a cataract remained. visual rehabilitation was achieved through a combined penetrating keratoplasty, extracapsular cataract extraction, and intraocular lens implanta ...19902270167
infection caused by mycobacterium chelonae: a diagnostic and therapeutic problem in the neutropenic patient.mycobacterium chelonae, a rapidly growing species, is a significant cause of fever in neutropenic patients. we describe three febrile neutropenic patients at the royal free hospital from whom this organism was isolated on several occasions. the condition of the first patient improved as the neutrophil count recovered. the second patient developed pulmonary disease and required surgical resection of a pulmonary lesion. the third patient, who had rapidly progressive, diffuse pulmonary disease, res ...19921623077
mycobacterium chelonae infection among patients receiving high-flux dialysis in a hemodialysis clinic in california.between july 1987 and january 1988, five patients dialyzed at a hemodialysis outpatient clinic developed systemic mycobacterium chelonae abscessus (mca) infections. four of the five patients had arteriovenous graft infections, and two died during antimicrobial therapy. case-patients were more likely than control-patients to have received high-flux dialysis during the 6 mo before their infection (100% vs. 30%, p = .009). mca was cultured from the hose connected to a water spray device used for ma ...19902295862
breast uptake of gallium-67 citrate in disseminated mycobacterium chelonei. 19902225676
high-performance liquid chromatography patterns of mycolic acids as criteria for identification of mycobacterium chelonae, mycobacterium fortuitum, and mycobacterium smegmatis.rapidly growing mycobacteria of clinical significance were identified by mycolic acids detected with high-performance liquid chromatography. mycolic acids from whole cells were extracted, derivatized, and detected by a modified high-performance liquid chromatography procedure in less than 3 h. use of an internal standard allowed differentiation of mycobacterium chelonae and mycobacterium fortuitum by comparison of relative retention times. peak height ratios were used for subidentification of m. ...19902229390
mycobacteriosis in yellow perch (perca flavescens) from two lakes in alberta.granulomatous skin lesions were identified in a population of yellow perch (perca flavescens) from sandy lake (alberta, canada) in 1985. severe granulomatous peritonitis and hepatitis was identified subsequently in a separate population of yellow perch from wolf lake (alberta, canada). mycobacterium chelonae was isolated from affected fish in both epizootics. the source and route of infection were not determined in either case. the nature of the inflammatory reaction in both cases suggested a de ...19892915401
promising new drugs in the treatment of tuberculosis and mycobacteriosis.the aims of this work were to investigate the possible effect of several antimicrobial agents alone and in combinations against 190 clinical isolates of mycobacterium tuberculosis and 30 isolates of mycobacterium avium, 30 mycobacterium fortuitum and 30 mycobacterium chelonei. the susceptibility was determined in müller-hinton agar and middlebrook 7h 10 agar. for interpretation of the results the minimum inhibitory concentration (mic) was determined and for the combinations of antimicrobials we ...19892498468
pulmonary disease caused by mycobacterium chelonae in a heart-lung transplant recipient with obliterative bronchiolitis.a heart-lung transplant recipient with pulmonary disease caused by the rapidly growing nontuberculous mycobacterium chelonae and obliterative bronchiolitis is presented. the clinical features, course, and management of the mycobacterial disease and the obliterative bronchiolitis are discussed. the role of transbronchial lung biopsy in determining the significance of rapidly growing mycobacteria in pulmonary specimens and in diagnosing infection and rejection is emphasized.19892506786
[total surinfected prosthesis of the hip by mycobacterium chelonei]. 19892529499
immunomodulatory properties of a strain of mycobacterium chelonae. i. mouse lymphocyte responses in vitro.immunomodulatory properties of a strain of live mycobacterium chelonae (mch) was investigated in an in vitro lymphocyte transformation system. murine splenocyte activation by this bacterium was characterized by polyclonal lymphoproliferative responses in a dose dependent fashion. optimal doses ranging from 20 to 80 micrograms of mch (wet weight) per ml of cell suspension induced a very significant mitogenic effect. higher doses (100 micrograms) of mch manifested a decreased rate of tritiated thy ...19892582740
sporotrichoid spread of cutaneous mycobacterium chelonei infection.atypical mycobacterial infections of the skin have increased in frequency in immunocompromised individuals in recent years. such patients may follow a different clinical pattern from immunocompetent patients, often lacking a history of preceding trauma and presenting with multiple suppurating subcutaneous nodules. a sporotrichoid pattern of spread may occur with the species mycobacterium kansasii and m. marinum but is rare with m. chelonei.19892591098
hand infection with mycobacterium chelonei. 19863081116
in vitro susceptibility of mycobacterium tuberculosis, mycobacterium fortuitum and mycobacterium chelonei to augmentin. 19863093225
in vitro susceptibility of mycobacterium tuberculosis, mycobacterium africanum, mycobacterium bovis, mycobacterium avium, mycobacterium fortuitum, and mycobacterium chelonae to ticarcillin in combination with clavulanic acid.the in vitro susceptibility of mycobacterium tuberculosis, mycobacterium bovis, mycobacterium africanum, mycobacterium avium, mycobacterium fortuitum, and mycobacterium chelonae (m. chelonei) to ticarcillin in combination with calvulanic acid (ca) was studied by the agar dilution method. all the m. tuberculosis, m. bovis, and m. africanum strains were inhibited at a ticarcillin concentration of 32 micrograms/ml or lower in combination with 5 micrograms of ca. m. chelonae and m. avium strains pro ...19873105441
effect of ro 23-6240 on sensitive and resistant intracellular mycobacteria.the activity of ro 23-6240 and rifampicin against intracellular mycobacterium fortuitum and mycobacterium chelonei was assessed in vitro over a 48-hour period. both agents, at an extracellular concentration of 2.0 mg/l (ro 23-6240) and 1.0 mg/l (rifampicin), produced a significant intracellular killing of the sensitive mycobacterium fortuitum at both 20 and 48 hours. however, neither agent was effective against the resistant mycobacterium chelonei. it was concluded that ro 23-6240 has a direct a ...19873109896
in vitro activity of the new quinolone ro 23-6240 (am-833) and the new cephalosporins ro 15-8074 and ro 19-5247 (t-2525) against mycobacterium fortuitum and mycobacterium chelonae. 19873117539
in vitro activity of four fluoroquinolones against eighty-six isolates of mycobacteria.the in vitro activity of pefloxacin, norfloxacin, ofloxacin and ciprofloxacin against 86 strains of mycobacteria was evaluated by broth dilution. while mycobacterium avium, mycobacterium scrofulaceum and mycobacterium chelonae were resistant to all four antibacterials, the susceptibility of the other species, mycobacterium tuberculosis, mycobacterium kansasii, mycobacterium xenopi and mycobacterium fortuitum, depended on the antibiotic. ofloxacin and ciprofloxacin (mic90: 0.5 - 2 mg/l) were more ...19873125050
Displaying items 1 - 100 of 1156