| cloning and expression of the gene for the cross-reactive alpha antigen of mycobacterium kansasii. | the gene for the extracellular alpha antigen of mycobacterium kansasii was cloned by using the alpha-antigen gene fragments of m. bovis bcg as probes. gene analysis revealed that this gene encodes 325 amino acid residues, including 40 amino acids for the signal peptide, followed by 285 amino acids for the mature protein. a comparison of the nucleotide sequences of the genes isolated from these two mycobacterial species showed that the levels of dna and amino acid homology were 84.8 and 89.1%, re ... | 1990 | 2404875 |
| trehalose-containing lipooligosaccharides from mycobacteria: structures of the oligosaccharide segments and recognition of a unique n-acylkanosamine-containing epitope. | the structures of the oligosaccharide segments of nine trehalose-containing lipooligosaccharides (los) of mycobacterium kansasii have been established by positive and negative fast-atom bombardment mass spectrometry, acetolysis, partial acid hydrolysis, methylation analyses, and nuclear magnetic resonance. upon acetolysis, all produce the alpha,alpha-trehalose-containing tetraglucose (glc4) "core" -beta-d-glcp(1----3)-beta-d-glcp(1----4)-alpha-d-glcp(1----1)-alpha-d-gl cp. the simplest (los i') ... | 1985 | 2411286 |
| selective enzyme staining procedures for characterization of mycobacterial immunoprecipitates. | selective staining procedures for four different enzymes (malate dehydrogenase, glutamic oxaloacetic transaminase, leucine aminopeptidase and glucose phosphate isomerase) in combination with two-dimensional immunoelectrophoresis were successfully applied to the analysis of antigen preparations from mycobacteria. thus, a precipitate corresponding to malate dehydrogenase could e.g. be demonstrated in multi-linear precipitation patterns of mycobacterium avium, mycobacterium bovis bcg, mycobacterium ... | 1986 | 2417958 |
| characterization of serologic and cell-mediated reactivity of a 38-kda antigen isolated from mycobacterium tuberculosis. | an antigen of mycobacterium tuberculosis with an m.w. of 38,000 has been isolated by affinity chromatography using a monoclonal antibody. this antibody bound only to an antigen found in m. tuberculosis and mycobacterium bovis bcg. the specificity of the antigen was tested in a vertical study by immunodetection on western blots reacted with hyperimmune sera against m. tuberculosis, m. bovis, and 10 other mycobacterium species. the antigen was detected only by antisera to m. tuberculosis and m. bo ... | 1987 | 2443566 |
| a protein preparation from mycobacterium kansasii culture filtrate has biological activity similar to that of hcg and cholera toxin in human cell lines. | a protein preparation, from culture filtrates from a strain of mycobacterium kansasii (mk precipitate), which cross reacts with antibodies to human chorionic gonadotropin (hcg) beta subunit and antibodies to cholera toxin beta subunit, has been isolated. a tissue culture assay was used to detect the ability of this preparation to affect the antiviral activity of interferons and to visualize changes in cell shape and cell-cell contact caused by this preparation. a cholera toxin containing precipi ... | 1987 | 2447470 |
| activities of clarithromycin against eight slowly growing species of nontuberculous mycobacteria, determined by using a broth microdilution mic system. | mics of clarithromycin against 324 clinical isolates belonging to eight species of slowly growing nontuberculous mycobacteria were determined by using a broth microdilution system. isolates were inoculated into twofold drug dilutions in middlebrook 7h9 broth (ph corrected to 7.4) and then incubated at 30 degrees c for 7 days for mycobacterium marinum and for 14 days for all other species. the mic for 90% of the strains (mic90) was less than or equal to 0.5 micrograms/ml for isolates of mycobacte ... | 1992 | 1416891 |
| n-formylkansosaminyl-(1----3)-2-o-methyl-d-rhamnopyranose: the type-specific determinant of serovariant 14 of the mycobacterium avium complex. | significant occurrences of pulmonary and disseminated infections due to "atypical" mycobacteria have again focused attention on the mycobacterium avium serocomplex. an examination of the major surface glycopeptidolipid antigen of one of the more prominent and one of the first described serovariants, the boone strain (serovariant 14), has shown that it is characterized by a unique terminal disaccharide unit, n-formylkansosaminyl-(1----3)-2-o-methyl-d-rhamnopyranose. the structure of the entire ol ... | 1988 | 2458834 |
| the spectrum of mycobacterium kansasii disease associated with hiv-1 infected patients. | louisiana is known to be an area endemic for mycobacterium kansasii (mk). since mk tends to disseminate in immunocompromised patients, one might, therefore, expect to observe an increasing number of mk infections associated with human immunodeficiency virus (hiv-1). a systematic 60-month review of clinical, microbiologic, and radiographic data associated with mk was performed from two major referral centers in new orleans. from june 30, 1983 through june 30, 1988, mk was isolated from 72 patient ... | 1991 | 2016689 |
| structure of mycobacteria: recent developments in defining cell wall carbohydrates and proteins. | work from this laboratory on the immunogens of mycobacterium species has focused on those based on carbohydrates (with a view to the development of specific tools for the serodiagnosis of mycobacterioses) and on the cell-wall proteins, as a source of protective immunity and as a means of observing specific delayed-type hypersensitivity. most mycobacteria are endowed with specific, highly antigenic glycolipids that are powerful for the serodiagnosis of individual mycobacterial infections: e.g., t ... | 1989 | 2469120 |
| comparative studies of antigenic glycolipids of mycobacteria related to the leprosy bacillus. | the leprosy bacillus, mycobacterium leprae, is a member of a small group of mycobacteria comprising the species mycobacterium bovis, mycobacterium marinum, mycobacterium kansasii, mycobacterium tuberculosis, mycobacterium ulcerans and related taxa. this relationship is based on the similarity of the characteristic lipid types in the cell envelope. mycobacterium leprae produces a phenolic glycolipid antigen which is species specific. this communication reports a comparison of the specificity of t ... | 1989 | 2504005 |
| mycobacterium kansasii infections in western australia (1962-1987). | the records of 81 patients with isolations of mycobacterium kansasii in western australia over 26 years have been reviewed. thirty-nine individuals with 40 episodes of infection were considered to have disease due to m. kansasii: 36 in the lungs (90%), two in the joints (5%), and one each in the skin (2.5%) and the lymph nodes (2.5%). the average incidence rate per 100,000 per year was 0.14 for the state with the highest in the geraldton mid-west region (0.57). the male:female ratio was 4:1 and ... | 1991 | 1882111 |
| [mycobacterium kansasii extensive subcutaneous infection in dermatomyositis]. | | 1990 | 2085249 |
| polymerase chain reaction amplification of a repetitive dna sequence specific for mycobacterium tuberculosis. | a segment of dna repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (pcr). the sequences of the primers (5' to 3') were cctgcgagcgtaggcgtcgg and ctcgtccagcgccgcttcgg, and a temperature of 68 degrees c was used for annealing the primers in the reaction. amplification produced a 123-base-pair fragment with an internal sali site. the specific pcr product was obtained with input dna from 11 different strains o ... | 1990 | 2109022 |
| [antitubercular agents. 45. antimycobacterial thiohydrazide]. | the present paper investigates the activity of thiohydrazides containing a structural fragment of oxalic acid against mycobacterium tuberculosis and mycobacterium kansasii. the drugs included heterocyclic compounds as well. all compounds under study show medium activity. the minimal inhibition concentrations against mycobacterium kansasii are approximately 3 times higher than against mycobacterium tuberculosis. the most effective aromatic compounds have the rm values (silica gel impregnated with ... | 1989 | 2515678 |
| enzyme immunoassay for identification of heat-killed mycobacteria belonging to the mycobacterium tuberculosis and mycobacterium avium complexes and derived from early cultures. | a simple enzyme-linked immunosorbent assay was developed for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii. six monoclonal antibodies were used: two (f23-49 and f24-2) were specific for the m. tuberculosis complex, two (f85-2 and f85-10) were specific for the identification of the m. avium complex, one (f126-22) was specific for m. kansasii, and one (f141-3) was broadly reactive and dis ... | 1990 | 2110180 |
| suppression of monocyte oxidative response by phenolic glycolipid i of mycobacterium leprae. | mycobacterium leprae synthesizes a unique phenolic glycolipid (pgl-i) in abundant quantities. we studied the effect of pgl-i on the generation of superoxide anion (o2-) by stimulated human monocytes. peripheral blood monocytes pretreated with pgl-i released less o2- when stimulated with m. leprae than did control monocytes. monocytes pretreated with dimycocerosyl phthiocerol, mycoside a of mycobacterium kansasii, or mycoside b of mycobacterium microti, on the other hand, released o2- in quantiti ... | 1989 | 2537362 |
| evaluation of new anti-infective drugs for the treatment of disease caused by mycobacterium kansasii and other mycobacteria. infectious diseases society of america and the food and drug administration. | mycobacterium kansasii is a photochromogenic nontuberculous mycobacterium that usually causes infections of the respiratory tract in humans. although spontaneous resolution of infection has been reported, most patients require antimycobacterial therapy. a three- or four-drug combination--isoniazid, rifampin, and ethambutol and/or streptomycin--usually is prescribed. for evaluation of a new drug, a randomized, double-blind or evaluator-blinded, active-control comparative study design is recommend ... | 1992 | 1477246 |
| biological and immunological properties of avirulent strain of listeria innocua. | the strain isolated by dr. j. h. welshimer from plants has antigenic formula v (vi) ix; xv; xi; ab, c--serovar 6a, is non-haemolytic, produces lipase, and toxic factor ei, is avirulent for adult mice, but causes encephalitis in sucklings. in organs of intravenously injected mice the strain persists and multiplies for 1-3 weeks. the protective effect against listerial infections in mice of this strain administered 2-14 days before challenge is dose depending. after 3 weeks induces resistance of g ... | 1989 | 2631501 |
| a reevaluation of sputum microscopy and culture in the diagnosis of pulmonary tuberculosis. | this prospective study was undertaken to determine the interpretation of "scanty-positive" acid-fast bacilli on microscopy and to reevaluate simultaneous microscopy and culture of sputum for the accurate diagnosis of pulmonary tuberculosis (ptb). a total of 2,560 specimens were processed from 727 patients. there were 435 positive specimens (17.0 percent), originating from 139 patients, 10 by microscopy only, 176 by culture only, and 249 on both microscopy and culture. review of the hospital reco ... | 1989 | 2656111 |
| susceptibility of mycobacterium kansasii to ethambutol and its combination with rifamycins, ciprofloxacin and isoniazid. | the susceptibility of mycobacterium kansasii to antibacterial agents alone and in combination was studied. widespread resistance to ethambutol, ciprofloxacin and isoniazid was found when these drugs were tested separately. however, pronounced antibacterial effects were seen when ethambutol was tested in combination with ciprofloxacin, rifampicin or rifabutin, which corresponded to significantly decreased resistance to these drugs in combination. | 1992 | 1563386 |
| peritonitis caused by mycobacterium kansasii in a patient undergoing continuous ambulatory peritoneal dialysis. | mycobacterium kansasii was isolated from the peritoneal fluid, peritoneal biopsy, and the tenckhoff catheter of a 62-year-old woman undergoing continuous ambulatory peritoneal dialysis (capd) who presented with the clinical picture of peritonitis. to the best of our knowledge, this is the first case of capd-associated peritonitis caused by m kansasii. routine susceptibility tests using standard concentrations of isoniazid indicated isoniazid resistance; however, the organism was inhibited in vit ... | 1992 | 1595710 |
| identification of mycobacterium kansasii by dna hybridization. | a dna probe specific for mycobacterium kansasii was obtained from a plasmid clone library of ecori-digested genomic dna. the probe specifically identified culture-confirmed isolates of m. kansasii and isolates in cultures of environmental water samples. in an attempt to distinguish between isolates of m. kansasii, we used two methods to demonstrate restriction fragment length polymorphisms in the genomic dna. both of these methods failed to detect any differences between the isolates. these isol ... | 1991 | 1682342 |
| atypical mycobacterial infection of the lung in rheumatoid arthritis. | mycobacterium kansasii was isolated from a cavitating pneumonia found in a 51 year old man with seropositive rheumatoid arthritis, and treatment was complicated by drug induced neuropathy. | 1989 | 2712616 |
| mycobacterium kansasii and pneumocystis carinii pneumonia in a patient with the acquired immunodeficiency syndrome. | the case of a swiss aids patient suffering from mycobacterium kansasii lung disease is described. the course of the illness was complicated by pneumocystis carinii pneumonia. therapy with isoniazid, ethambutol, clofazimine, ciprofloxacin and, after the onset of p. carinii pneumonia, trimethoprim-sulfamethoxazole led to a rapid and sustained clinical recovery of the patient. | 1989 | 2714863 |
| structural and immunological properties of the phenolic glycolipids from mycobacterium gastri and mycobacterium kansasii. | mycobacterial species-specific antigens belong to the three following classes: phenolic glycolipids (phe gl), acyltrehalose-containing lipooligosaccharides and polar glycopeptidolipids. these antigens have been chemically defined and alkali-labile epitopes were found to characterize the lipooligosaccharide antigen type. in the present study the major mycobacterium kansasii phenolic glycolipid epitope namely phe gl k-i was delineated as the distal monoacetylated disaccharidic residue: 2,6-dideoxy ... | 1990 | 1691978 |
| [pulmonary disease caused by opportunistic environmental mycobacteria. review of 35 cases]. | the clinical characteristics, radiologic findings, and therapeutic response in 35 cases of pulmonary disease induced by opportunistic environmental mycobacteria collected during a period of 4 years are reported. these cases included 21 infections by mycobacterium kansasii, 10 by m. xenopi, and 4 by m. avium. the cases reported constituted the 6% of all mycobacterial infections of the lung observed in our institution. the mean age of the patients was 56 years and 83% of them were male. the presen ... | 1990 | 2250503 |
| [in vitro determination of the sensitivity of mycobacteria to fluoroquinolones]. | in vitro activity of four fluorinated quinolones: pefloxacin, norfloxacin, ciprofloxacin, ofloxacin were determined against various clinical isolates of mycobacteria. the method of agar dilution was used, seventy strains of ten species were tested: mycobacterium tuberculosis (25), mycobacterium bovis (5), mycobacterium africanum (2), bcg (5), mycobacterium kansasii (6), mycobacterium marinum (5), mycobacterium avium (11), mycobacterium xenopi (6), mycobacterium chelonae (3), mycobacterium fortui ... | 1989 | 2780092 |
| meningitis due to mycobacterium kansasi in nonhodgkin's lymphoma. | | 1989 | 2797582 |
| atypical mycobacterial infections. | atypical mycobacterial infections play an important role in human pathogenicity. mycobacterium avium complex has been reported to occur in 17% to 50% of individuals infected with human immunodeficiency virus. in the southwestern united states, mycobacterium kansasii is reported to be a predominate mycobacterial infection in middle-aged men. the epidemiology of the pathological species is discussed along with current recommendations for chemotherapeutic regimens. | 1990 | 2262742 |
| immunohistologic analysis of mycobacterial antigens by monoclonal antibodies in tuberculosis and mycobacteriosis. | four monoclonal antibodies (moabs), 60.15, 61.3, 105.10, and 2.16, directed to different proteins of mycobacterium tuberculosis were used by an indirect avidin-biotin complex peroxidase-antiperoxidase method to detect mycobacterial antigens in lung, lymph node, and joint tissue specimens of tuberculous patients. using moab 60.15, which recognizes a broad range of cross-reactive mycobacterial proteins with a molecular mass of 28 kilodaltons (kd), scattered materials (mycobacterial in origin) were ... | 1989 | 2807270 |
| [bactericidal activity of ofloxacin against mycobacterium kansasii]. | bactericidal activity of ofloxacin against mycobacterium kansasii was observed in in-vitro experiment. tested bacteria were suspended to a concentration of one mg wet weight per ml in 10 ml of dubos liquid medium containing no drug or containing 1 or 3 micrograms/ml ofloxacin and incubated at 37 degrees c. the number of colony-forming units contained in a 0.02 ml-sample of the dubos liquid medium was counted after incubation for 0, 1, 3 and 7 days. the number of colonies was counted in ogawa egg ... | 1990 | 2277465 |
| mycobacterium xenopi and mycobacterium kansasii in a hospital water supply. | a steady rise in the number of isolations of mycobacterium xenopi from patients in a general hospital led to an examination of water taps. most patients had been accommodated in a group of wards which had a common water supply. this organism was recovered from 35 of 69 outlets, mostly from hot and mixer taps in those wards. mycobacterium kansasii was also isolated from 14, mostly cold and mixer taps. ten strains of myco. xenopi were recovered from 131 taps sampled at 10 other locations. we concl ... | 1985 | 2862192 |
| chromatographic and serologic identity of the specific phenolglycolipids pgl-k1 from mycobacterium kansasii and pgl-g1 from m. gastri. | mycobacterium kansasii and m. gastri formed chromatographically and serologically identical phenolglycolipid antigens, designated respectively pgl-k1 and pgl-g1, in elisa. antisera prepared in rabbits did not bind the pgl-1 from m. leprae nor the crude extracts of 20 other mycobacterial species. | 1988 | 2457384 |
| heterogeneity of bacterial antigenic lipooligosaccharides determined by californium-252 plasma desorption mass spectrometry. | californium-252 plasma desorption mass spectrometric analysis of complex lipooligosaccharide antigens from mycobacterium kansasii has provided molecular weight information. from the spectra obtained and from other data it can be concluded that these lipooligosaccharides generally contain three 2,4-dimethyltetradecanoyl groups, and considerable heterogeneity in the attached acyl functions is apparent. | 1986 | 2943342 |
| mycobacterium kansasii infection. | | 1991 | 1872499 |
| determination of mycobacterial antigens in sputum by enzyme immunoassay. | an enzyme-linked immunosorbent assay (elisa) was examined for its usefulness in detecting mycobacterial antigens in sputum. a double-antibody sandwich procedure was set up by using a commercially available hyperimmune serum directed against mycobacterium bovis, bcg. the elisa was able to detect 10 ng of protein per ml of bcg sonic extract. the system also clearly distinguished mycobacterium tuberculosis organisms from mycobacterium avium and mycobacterium kansasii organisms. a total of 68 unknow ... | 1986 | 3086369 |
| the mycobacteriology of pulmonary tuberculosis in south african gold miners. | two bacteriological surveys of gold miners with pulmonary tuberculosis diagnosed for the first time, have shown a stable level of primary drug resistance which is substantially lower than that reported for the home areas of these men. initial drug resistance was detected in 12.7% of the 205 cultures of mycobacterium tuberculosis in 1983-1984 and in 10.7% of 253 cultures in 1988-1989. resistance to isoniazid was detected in 5.4% and 5.5% of the strains tested, to streptomycin in 6.8% and 5.1% and ... | 1990 | 2115216 |
| characterization of a monoclonal antibody to mycobacterium kansasii. | the characterization of an igg2/kappa monoclonal antibody against a protein antigen obtained by gel chromatography of the complex sonicate of m. kansasii biomass is described. it recognized specifically epitope molecules in complex and fractionated m. kansasii antigens ranging from 14.4 to 20 kd. the 20 kd immunoreactive band is common to the complex antigen, its fraction a and to the fraction b which was employed as the immunogenic agent. the 14.4 and 18 kd bands are predominantly present in th ... | 1988 | 2463723 |
| elisa analysis of bactec bottles for the earlier diagnosis of tuberculosis. | enzyme-linked immunosorbent assays (elisa) have enabled earlier identification of mycobacterium tuberculosis (tb) in clinical settings by utilizing both tb antibody and antigen detection. we studied the sensitivity and specificity of elisa detection of tb antigen by using a commercially available anti-bcg antibody in conjunction with bactec 7h12b culture bottles. we compared these results against those obtained with cultures of mycobacterium avium-intracellulare and mycobacterium kansasii. all b ... | 1989 | 2506783 |
| aspects of the antituberculous activity of 27753-rp, a new semisynthetic derivative of griselimycine. | the antituberculous activity of 27753-rp (rp), a new semisynthetic derivative of griselimycine, was determined both in vitro and in vivo, and its activity against atypical mycobacteria was also studied in vitro. 1) the minimal inhibitory concentration of rp against h37rv and its mutants resistant to streptomycin, isoniazide, kanamycin, rifampicin and enviomycin was 0.5 microgram/ml in liquid media, showing no cross-resistance. however, loss of potency occurred in ogawa's egg media, and 50 microg ... | 1987 | 3135829 |
| in-vitro susceptibility of mycobacterium tuberculosis, mycobacterium bovis and mycobacterium kansasii to amoxycillin and ticarcillin in combination with clavulanic acid. | the in-vitro susceptibility of mycobacterium tuberculosis, m. bovis, and m. kansasii to amoxycillin alone and in combination with 2 mg/l of clavulanic acid was evaluated by broth dilution. the mic90 of amoxycillin plus clavulanic acid was 4 mg/l compared with greater than 32 mg/l for amoxycillin alone when tested against m. tuberculosis (n = 27). m. bovis (n = 8) was the most susceptible species with an mic90 of amoxycillin 8 mg/l, compared with 0.5 mg/l for the combination. m. kansasii (n = 6), ... | 1988 | 3149633 |
| relationship between mycobacterial species and their carotenoid pigments. | a study of the relationship between mycobacterial species and their carotenoid pigments was carried out. according to the carotenoid pigments contained, the mycobacterial species tested were divided into four groups: the first group of mycobacterium kansasii and m. marinum, which formed principally only beta-carotene; the second group of m. gordonae, m. scrofulaceum, m. szulgai, m. xenopi, m. flavescens, m. phlei, m. rhodesiae, m. neoaurum, and m. aichiense, which formed beta-carotene and a zeax ... | 1988 | 3173145 |
| [evaluation of cycloserine in the treatment of infections caused by nontuberculous mycobacteria viewed from in vitro experiments]. | evaluation of cycloserine as a drug in the treatment of infections caused by nontuberculous mycobacteria was made from in-vitro studies, in which mycobacterium tuberculosis strains were used as the standard of the evaluation. the susceptibility testing to cycloserine was made using ogawa egg medium. bacterial suspensions, 10 mg wet weight/ml, prepared from 10 day-old cultures (m. tuberculosis, 14 day-old cultures) growing on ogawa egg medium were used as the source of inoculation. a 0.02 ml-samp ... | 1989 | 2507817 |
| enzyme-linked immunosorbent assay using monoclonal antibodies for identification of mycobacteria from early cultures. | a simple enzyme-linked immunosorbent assay (elisa) for the identification of cultured mycobacteria belonging to the mycobacterium tuberculosis complex, the mycobacterium avium complex, and mycobacterium kansasii has been developed (r. schöningh, c. p. h. j. verstijnen, s. kuijper, and a. h. j. kolk. j. clin. microbiol. 28:708-713, 1990). the test for the routine identification of cultured mycobacteria was introduced in five clinical laboratories located in tanzania, thailand, vietnam, and the ne ... | 1991 | 1909344 |
| sensitivity to "atypical" mycobacteria in high school children in two community health departments. | to evaluate the prevalence of atypical mycobacteria infections in our population, a study was done among students of secondary fifth grade (15-19 years of age) in the community health departments of maisonneuve-rosemont in montreal and of sherbrooke. the tuberculin used was the rt-23 2 t.u. with tween 80 and the sensitins prepared by the statens serum institute of copenhagen from mycobacterium intracellulare (battey) and from mycobacterium kansasii. each student had a tuberculin test on one arm ... | 1989 | 2509059 |
| recurrent granulomatous synovitis due to mycobacterium kansasii in a renal transplant recipient. | a 61-year-old woman received a cadaveric renal transplant in 1972 and was maintained on chronic immunosuppression. nonspecific granulomatous synovitis of the left hand developed in 1982. after recurrence of synovitis in 1984, surgical exploration of the left hand demonstrated "rice bodies" in a region of chronic synovitis from which mycobacterium kansasii was isolated. despite therapy with isoniazid, rifampin, and ethambutol, to which the organism was susceptible in vitro, synovitis recurred. re ... | 1987 | 3295004 |
| a monoclonal antibody to mycobacterium kansasii: preparation and properties. | an igg2/kappa monoclonal antibody specific for a subunit protein antigen (mol.w. 32 kd) obtained by means of gel chromatography of the cell-free sonicate of m. kansasii was generated by the fusion of spleenocytes from balb/c mice immunized with this antigen and ag-8 myeloma cells. its specificity was demonstrated by elisa and dot blot procedures. this moab has potential application in taxonomy and species identification of m. kansasii isolates, in studies relating to the molecular pattern of the ... | 1987 | 3302036 |
| [fish breeder granuloma: infection caused by mycobacterium marinum and other atypical mycobacteria in the human. analysis of 8 cases and review of the literature]. | granulomatous lesions of the skin and tendon sheaths after exposure to fish tank or aquarium water are frequently caused by non-tuberculous so-called atypical mycobacteria. mycobacterium marinum is the species most often isolated from such lesions. rarely, other non-tuberculous species of mycobacteria may be isolated. in contrast to swimming-pool granuloma as the epidemic form of mycobacterium marinum infection of man, fish tank granuloma seems to be a rare sporadic human disease that is often m ... | 1989 | 2533660 |
| analysis of dimycocerosates of glycosylphenolphthiocerols in the identification of some clinically significant mycobacteria. | extracts of representative mycobacteria were examined by thin-layer chromatography for glycosylphenolphthiocerol dimycocerosates. the glycolipid typical of mycobacterium bovis was also found in mycobacterium africanum and mycobacterium microti, but it was absent in mycobacterium bovis an 5. mycobacterium gastri strains contained a glycolipid which was chromatographically similar to that in mycobacterium kansasii. representatives of mycobacterium marinum produced a distinct glycolipid type, and o ... | 1987 | 3326746 |
| mycobacteria other than tuberculosis. pulmonary involvement in patients with acquired immunodeficiency syndrome. | a normal host can be colonized by mycobacteria other than tuberculosis (mott), resulting in bronchoscopic isolates of no clinical significance. in the acquired immunodeficiency syndrome (aids), mycobacterium avium-intracellulare, mycobacterium kansasii, and mycobacterium xenopi have caused widely disseminated infection. to determine the usefulness of fiberoptic bronchoscopy (fb) in evaluating mott infection in aids, we reviewed mott cultures from 36 fbs, correlated these to clinical course, and ... | 1988 | 3355312 |
| sporotrichoid spread of cutaneous mycobacterium chelonei infection. | atypical mycobacterial infections of the skin have increased in frequency in immunocompromised individuals in recent years. such patients may follow a different clinical pattern from immunocompetent patients, often lacking a history of preceding trauma and presenting with multiple suppurating subcutaneous nodules. a sporotrichoid pattern of spread may occur with the species mycobacterium kansasii and m. marinum but is rare with m. chelonei. | 1989 | 2591098 |
| mycobacteria in biofilms. | the objective of this study was to elucidate the role of biofilms as the habitat of aquatic mycobacteria. investigations were carried out on a biofilm which grew on the inner surface of a silicone tube constantly perfused by water of a distribution system known to be contaminated with mycobacterium kansasii and m. flavescens. the biofilm yielded 2 x 10(5) cfu/cm2 of m. kansasii and 7 x 10(4) cfu/cm2 of m. flavescens after 10 months of perfusion. microscopic examination revealed that approximatel ... | 1989 | 2667558 |
| sandblaster's lung with mycobacterial infection. | this report describes the development of alveolar silico-lipoproteinosis complicated by mycobacterium kansasii infection in a previously healthy man who worked as a sandblaster. alveolar silico-lipoproteinosis is a rare disease that usually is fatal within 1 year of onset of symptoms. there is a high incidence of mycobacterial infection, half being caused by atypical organisms. | 1988 | 3389393 |
| synthesis of the tetrasaccharide core region of antigenic lipo-oligosaccharides characteristic of mycobacterium kansasii. | the oligosaccharide core region, beta-d-glcp-(1----3)-beta-d-glcp-(1----4)-alpha-d-glcp- 1----1)-alpha-d-glcp (1), of the lipo-oligosaccharide-type antigens isolated from m. kansasii has been synthesised from 2,3,2',3',4',6'-hexa-o-benzyl-6-o-(1-phenylethyl)-alpha, alpha-trehalose (4). compound 4 was obtained by lialh4-alcl3-type hydrogenolysis of 2,3,2',3',4',6'-hexa-o-benzyl-4,6-o-(s)-(1-phenylethylidene)-alpha , alpha-trehalose. the beta-laminaribiosyl part of the molecule was built-up by seq ... | 1988 | 3401879 |
| pulmonary mycobacterium kansasii infection successfully treated with a regimen containing erythromycin. | we report a case in which erythromycin was used in place of rifampicin after a severe reaction to the latter in the treatment of pulmonary mycobacterium kansasii infection. | 1988 | 3420563 |
| specificity of a mycobacterium kansasii phenolic glycolipid (mycoside a) immunoserum. | the specificity of mycobacterium kansasii anti-mycoside a antiserum prepared in rabbits injected with purified samples of the phenolic glycolipid was evaluated by an enzyme-linked immunosorbent assay. chloroform-methanol extracts from representative strains of 23 mycobacterial species and 50 strains of m. kansasii showed that all strains of m. kansasii and the representative strain of m. gastri formed the antigen, whereas none of the remaining species (including m. leprae) formed it. consequentl ... | 1987 | 3429620 |
| [preparing a monoclonal antibody specific to mycobacterium kansasii and its corresponding antigen]. | | 1987 | 3450427 |
| [current clinical study of pulmonary disease due to mycobacterium kansasii or m. avium intracellulare in the united states]. | | 1986 | 3527605 |
| mycobacterium kansasii septic arthritis complicating rheumatic disease: case report and review of the literature. | | 1987 | 3547660 |
| [sensitivity of mycobacterium intracellulare and mycobacterium kansasii to antituberculous drugs]. | | 1986 | 3582058 |
| t-cellular immune reactions (in macrophage inhibition factor assay) against mycobacterium paratuberculosis, mycobacterium kansasii, mycobacterium tuberculosis, mycobacterium avium in patients with chronic inflammatory bowel disease. | a mycobacterial aetiology has been suggested for crohn's disease. a slow growing mycobacterium, biochemically and genetically identical to m paratuberculosis, the causative agent of enteritis in ruminants (johne's disease), has been isolated from gut specimens of patients affected by crohn's disease. if m paratuberculosis or other mycobacteria play a role in the pathogenesis of crohn's disease, then patients may have been sensitised to these mycobacteria or show an anergy immune reaction. we the ... | 1990 | 2112502 |
| the diagnosis and management of disease caused by m. avium complex, m. kansasii, and other mycobacteria. | because mycobacteria other than mycobacterium tuberculosis are common in the environment and yet are infrequent causes of disease in humans, their isolation from a clinical specimen must be carefully evaluated before concluding that disease exists. it is often necessary to accumulate and weigh a cascade of various clinical factors before a diagnosis can be made. mycobacterium avium complex has emerged as an increasingly important pathogen, particularly in patients with the acquired immunodeficie ... | 1989 | 2673651 |
| disseminated mycobacterium kansasii infection in the acquired immunodeficiency syndrome (aids) | | 1987 | 3662300 |
| disseminated infection caused by mycobacterium kansasii presenting as fever of unknown origin. | | 1987 | 3665907 |
| lethal extrapulmonary mycobacteriosis. | a 60 yr old previously healthy man was treated for gradually elevating fever and rash followed by leucopenia and mycosis of the gastrointestinal tract; he died within 6 weeks of the first symptoms appearing. histologic examination revealed disseminated tuberculosis of paratracheal lymph nodes, liver, spleen and bone marrow with the presence of acid fast bacilli by smear examination. multiple colonies of the same strain of mycobacterium kansasii were isolated by bacteriological examination of lym ... | 1989 | 2707407 |
| a novel mannose containing phenolic glycolipid from mycobacterium kansasii. | using high-performance liquid chromatography, a new kind of phenolic glycolipid quantitatively minor, called phenolic glycolipid-ii, was isolated from a lipidic fraction of mycobacterium kansasii. the structure was determined by fast atom bombardment-mass spectrometry and proton nuclear magnetic resonance spectroscopy, as: 2,4-di-o-me-alpha-d-manp(1----3) 4-o-ac-2-o-me-alpha-l-fucp(1----3)2-o-me- alpha-l-rhap(1----3) 2,4-di-o-me-alpha-l-rhap 1----phenolphthiocerol dimycocerosate. phenolic glycol ... | 1987 | 3667611 |
| exacerbation of isoniazid induced peripheral neuropathy by pyridoxine. | mycobacterium kansasii was isolated from an area of cavitating pneumonia in a man with rheumatoid arthritis. standard antituberculosis treatment, including isoniazid 300 mg daily, had to be stopped because of peripheral neuropathy. the patient, a slow acetylator, subjectively deteriorated despite withdrawal of isoniazid and treatment with pyridoxine 150 mg daily. improvement occurred only after the pyridoxine had also been withdrawn. pyridoxine may cause peripheral neuropathy and this case illus ... | 1990 | 2166360 |
| comparison of the fibronectin-binding ability and antitumor efficacy of various mycobacteria. | although the mechanism by which bacillus calmette-guerin (bcg) exerts an antitumor effect on superficial bladder tumors is not fully understood, recent evidence has implicated binding of bcg organisms to fibronectin (fn) as requisite for this antitumor efficacy. various substrains of bcg and other mycobacteria were tested in vitro for their relative capacities to bind both matrix and soluble fn. a substrain of mycobacterium kansasii, designated the "high-binding strain," was found to bind fn mor ... | 1990 | 2191767 |
| [cutaneous atypical mycobacteriosis due to mycobacterium kansasii--a case report and a review of the literature]. | a case of cutaneous atypical mycobacteriosis due to mycobacterium (m.) kansasii is reported. a 41-year-old man, who had lived in kawasaki city, was seen in april 1988 because of sores on the dorsum of left forefinger which had been present for one month. physical examination revealed an erythematous, edematous plaque approximately 2 and 4 cm overlying proximal and middle phalanx of left index finger. otherwise his physical findings were normal. laboratory studies including x-ray examinations of ... | 1990 | 2214238 |
| [hemolytic activity of mycobacterium kansasii]. | mycobacterium kansasii has a strong virulence as compared with those of "mycobacteria other than tubercle bacilli". in this study, hemolytic activities of several strains of m. kansasii were investigated. secretion of hemolytic factor from these strains was not observed, since no hemolytic zone was found around the colonies grown on the 7h11 agar plate when 5% rabbit blood agar was overlayed. on the other hand, weak hemolytic activities were detected after treatment of sonication and trypsin-dig ... | 1990 | 2214512 |
| disseminated infection with mycobacterium kansasii in the acquired immunodeficiency syndrome. | | 1986 | 3767152 |
| mycobacterial infection is an important infective complication in british asian dialysis patients. | to define the extent and nature of mycobacterial infection in patients on an adult dialysis unit whose catchment population contains a large proportion of non-caucasian subjects, a retrospective survey of all new patients accepted onto our maintenance dialysis programme between january 1987 and december 1989 was carried out. twenty-six asian, 13 afro-caribbean, two oriental and 170 caucasian patients were accepted onto the dialysis programme in the three-year recruitment period. eight of the 26 ... | 1991 | 1686037 |
| [studies on the nontuberculous lung mycobacteriosis in japan. (report of the study in the year 1987 and 1988 of the mycobacteriosis research group of the japanese national chest hospitals)--pulmonary infection caused by mycobacterium kansasii has begun to appear in all over japan including north japan hokkaido]. | in this study, the mycobacteriosis research group of the japanese national chest hospitals (mrg) presents the reports of study years 1987 and 1988. as reported previously**, pulmonary infection caused by mycobacterium kansasii occurred principally in south-west japan (prefectures south-west of tokyo) and did not appear in north japan. however, this disease appeared in 1987 and 1988 in hokkaido (sapporo hospital). accordingly, we may say the disease occurs all over japan. this is a noteworthy fin ... | 1991 | 1960913 |
| the recognition of mycobacterial infections by intraoperative cytology in patients with acquired immunodeficiency syndrome. | in patients with the acquired immunodeficiency syndrome, mycobacterial lymphadenitis is characterized by the presence of numerous acid-fast bacilli within histiocytes. in diff-quik-stained cytologic preparations of such lymph nodes, performed during intraoperative consultations, the presence of mycobacteria is manifested by numerous negatively staining rod-shaped spaces intracellularly within histiocytes, as well as extra-cellularly in the background. recognition of these characteristic "footpri ... | 1989 | 2802941 |
| mycobacterium kansasii in a rhesus monkey. | the incidence of pulmonary disease caused by "atypical" mycobacteria has been increasing gradually in the human population since the 1950s. mycobacterium kansasii and mycobacterium intracellulare are the two organisms most responsible for this trend. a rhesus monkey was euthanatized and necropsied after reacting positive to mammalian old tuberculin on semi-annual testing. histopathology demonstrated the presence of small numbers of acid fast organisms in pulmonary lesions. further microbiologica ... | 1989 | 2811282 |
| mycobacterium kansasii diffuse pulmonary infection in a patient with acquired immune deficiency syndrome. successful therapy with an antituberculous regimen. | mycobacterium kansasii is a rare cause of disseminated mycobacterial infection in patients with the acquired immune deficiency syndrome (aids). it occurs as the index aids diagnosis in only 0.2% of aids cases. previously reported cases of aids-associated m. kansasii infection have manifested as diffuse interstitial pneumonitis and diffuse small bowel inflammation and have been refractory to antimycobacterial therapy. the authors now report success in treating a hypoxemic patient with aids-associ ... | 1989 | 2916466 |
| the free lipids of mycobacterium leprae harvested from experimentally infected nine-banded armadillos. | the free lipids of a sample of mycobacterium leprae were extracted by a procedure designed to produce separate non-polar and polar fractions. the composition of these lipids was analysed semi-quantitatively by five special thin-layer chromatographic systems covering the total range of mycobacterial lipid polarities. in order of increasing polarity, the major lipids were dimycocerosates of phthiocerol a, phthiocerol b and phthiodiolone a, glycosyl phenolphthiocerol dimycocerosates and phospholipi ... | 1985 | 3903039 |
| treatment of septic arthritis due to mycobacterium kansasii. | | 1985 | 3919820 |
| control of the bcg gene of early resistance in mice to infections with bcg substrains and atypical mycobacteria. | the effect of the bcg gene on the early host response to intravenous infection with a variety of bcg substrains and some atypical mycobacteria was investigated. the numbers of live bacilli of bcg pasteur and bcg tice recovered from the spleens of bcgs mice (c57bl/6, b10.a and balb/c) at 3 weeks following infection exceeded the bacterial dose injected, whereas the number of cfu recovered from the spleens of bcgr mice (a/j, dba/2 and c3h/hen) did not exceed the number of cfu injected, thus followi ... | 1986 | 3086001 |
| synthesis and antibacterial activity of 2,2'-dithiobis(benzamide) derivatives against mycobacterium species. | a series of compounds, which are analogues of 2,2'-dithiobis(benzamide), were synthesized and tested for in vitro antibacterial activity against mycobacterium tuberculosis h37rv including resistant strains against streptomycin, kanamycin, or isonicotinic acid hydrazide. mics of these compounds against atypical mycobacteria, mycobacterium kansasii and mycobacterium intracellulare were also examined. structure-activity relationships were found in a series of (acyloxy)alkyl ester derivatives depend ... | 1985 | 3934384 |
| pericarditis due to mycobacterium kansasii in a patient undergoing dialysis for chronic renal failure. | | 1985 | 4045238 |
| [experimental pathogenicity of so-called atypical mycobacteria in mice, hamsters and meriones. anatomo-pathological study]. | three animal species were used for the experimental pathogenicity of fourteen out of a total of thirty strains of atypical mycobacteria which were isolated from lymph nodes of healthy pigs in the surrounding area of montevideo. white mice, hamsters and meriones were inoculated by intraperitoneal, intravenous or intracardiac routes. these animals were observed for either one year or until death, if death occurred during that year. macroscopic and microscopic lesions were studied. smears and cultu ... | 1985 | 4062198 |
| pulmonary mycetoma following mycobacterium kansasii infection. report of seven cases. | a long-term follow-up of 263 patients with pulmonary mycobacterium kansasii infection disclosed seven cases of mycetoma. we report the clinical manifestations of these patients. the incidence was less than that of tuberculosis. all mycetomas originated in large cavity lesions of inactive m kansasii infection. most patients had received multiple antituberculous antibiotics, including rifampin. five patients had died, two of underlying disease, one of invasive candidiasis following massive hemopty ... | 1985 | 4074030 |
| differential identification of mycobacterium kansasii and mycobacterium marinum. | this report deals with the differential diagnosis between mycobacterium marinum and m. kansasii. we found that the two species could be differentiated by using six main tests, namely, the nitrate reduction test, the arylsulfatase test, the ability to grow in the presence of 10.0 mug of amithiazone per ml, the ability to grow in the presence of 5.0 mug of kanamycin per ml, the temperature-ratio test, and the rate of growth on solid medium. in contrast to m. kansasii, considerable variation was ob ... | 1971 | 4101184 |
| strains of mycobacterium kansasii with weak catalase activity. | | 1972 | 4113935 |
| studies on the effect of starvation on mycobacteria. | ten cultures of mycobacterium tuberculosis, one of mycobacterium kansasii (nonsignificant), and one of mycobacterium phlei were submitted to starvation. as a result they lost first their acid fastness and then all other staining affinities but, in this chromophobic state, they survived for at least 2 years and, after that time, produced cultures of acid-fast bacilli when transferred onto nutrient media. chromophobic tubercle bacilli similar to those produced experimentally had previously been de ... | 1974 | 4132910 |
| disseminated infection caused by mycobacterium kansasii. report of a case and brief review of the literature. | | 1969 | 4185322 |
| preservation of mycobacteria: 100 percent viability of suspensions stored at -70 c. | our earlier studies on long-term preservation of mycobacteria have been expanded to include other species in this genus. mycobacterium kansasii and m. marinum, like mammalian tubercle bacilli and bcg, survive much better when stored at -70 c. by statistical analysis, m. gordonae, m. scrofulaceum, m. xenopi, m. avium, m. intracellulare, m. terrae, m. fortuitum, and m. smegmatis survived equally well at -20 c or -70 c; however, viable counts of all strains stored at -20 c were always lower than th ... | 1973 | 4197770 |
| mycobacterium kansasii in kansas: saprophyte or infection? | | 1974 | 4212184 |
| [endemic occurrence of mycobacterium kansasii in the karviná district]. | | 1972 | 4258672 |
| chemotherapeutic studies of mycobacterial infections in mice. | of six antibiotics investigated, streptovaricin c had the most marked chemotherapeutic effect on mycobacterium kansasii infections in mice. by the intraperitoneal route this antibiotic caused elimination of the pathogens from all organs. kanamycin eliminated the pathogens from the lungs of all animals and from the spleens and livers of most of them. bluensomycin also removed the pathogens from the lungs of all animals, and spectinomycin and lincomycin, from the lungs of the majority of the anima ... | 1968 | 4384964 |
| carotenoid pigments of mycobacterium kansasii. | partitioned between aqueous methanol and petroleum ether, the unsaponifiable pigments of mycobacterium kansasii were all epiphasic. thin-layer chromatography of these carotenoids showed that m. kansasii formed at least nine pigments. these pigments were identified by their chromatographic properties and spectral characteristics as phytoene, zeta-carotene, neurosporene, lycopene, leprotene, gamma-carotene, delta-carotene, alpha-carotene, and beta-carotene. three additional pigmented spots on thin ... | 1974 | 4424510 |
| a case of mycobacterium kansasii infection. | | 1974 | 4468972 |
| permanently successful chemotherapy in two cases with severe pulmonary mycobacterial disease due to mycobacterium kansasii and fortuitum, respectively. | | 1972 | 4510913 |
| differentiation between mycobacterium kansasii and mycobacterium marinum. | | 1973 | 4566852 |
| [hodgkin's disease associated with generalized infection with mycobacterium kansasii]. | | 1972 | 4644017 |
| activity of ciprofloxacin and other fluorinated quinolones against mycobacteria. | the new fluorinated quinolones display interesting but variable activity against mycobacteria. almost all compounds tested (ciprofloxacin, ofloxacin, enoxacin, norfloxacin, difloxacin, ci-934, a-56620, and megalone) inhibit mycobacterium tuberculosis at achievable serum concentrations, with ciprofloxacin and ofloxacin most active by weight (minimal inhibitory concentration at which growth of 90 percent of strains is inhibited is equal to 1 microgram/ml or less). the growth of mycobacterium kansa ... | 1987 | 3107379 |
| differentiation between mycobacterium kansasii and mycobacterium marinum by gas-liquid chromatographic analysis of cellular fatty acids. | comparison of the cellular fatty acids of 10 strains of mycobacterium marinum and 35 strains of mycobacterium kansasii revealed similarities within each species but differences between these two photochromogenic mycobacteria. a branched-chain fatty acid characteristic of m. kansasii was found in trace amounts in 2 of the 10 strains of m. marinum. | 1972 | 4650594 |
| [group i mycobacterial diseases. a. infections caused by mycobacterium kansasii]. | | 1972 | 4658710 |
| [improvement of the differential methods for mycobacterium kansasii variants (a preliminary report)]. | | 1972 | 4663876 |