| generation of auxotrophic mutants of enterococcus faecalis. | a 22-kb segment of chromosomal dna from enterococcus faecalis og1rf containing the pyrimidine biosynthesis genes pyrc and pyrd was previously detected as complementing escherichia coli pyrc and pyrd mutations. in the present study, it was found that the e. faecalis pyrimidine biosynthetic genes in this clone (designated pkv48) are part of a larger cluster resembling that seen in bacillus spp. transposon insertions were isolated at a number of sites throughout the cluster and resulted in loss of ... | 1995 | 7592480 |
| the lactococcal lmrp gene encodes a proton motive force-dependent drug transporter. | to genetically dissect the drug extrusion systems of lactococcus lactis, a chromosomal dna library was made in escherichia coli and recombinant strains were selected for resistance to high concentrations of ethidium bromide. recombinant strains were found to be resistant not only to ethidium bromide but also to daunomycin and tetraphenylphosphonium. the drug resistance is conferred by the lmrp gene, which encodes a hydrophobic polypeptide of 408 amino acid residues with 12 putative membrane-span ... | 1995 | 7592810 |
| autoregulation of nisin biosynthesis in lactococcus lactis by signal transduction. | the post-translationally modified, antimicrobial peptide nisin is secreted by strains of lactococcus lactis that contain the chromosomally located nisin biosynthetic gene cluster nisabtciprkfeg. when a 4-base pair deletion is introduced into the structural nisa gene (delta nisa), transcription of delta nisa is abolished. transcription of the delta nisa gene is restored by adding subinhibitory amounts of nisin, nisin mutants, or nisin analogs to the culture medium, but not by the unmodified precu ... | 1995 | 7592991 |
| isolation of lactococcus lactis nonsense suppressors and construction of a food-grade cloning vector. | nonsense suppressor strains of lactococcus lactis were isolated using plasmids containing nonsense mutations or as revertants of a nonsense auxotrophic mutant. the nonsense suppressor gene was cloned from two suppressor strains and the dna sequence determined. one suppressor is an ochre suppressor with an altered trna(gln) and the other an amber suppressor with an altered trna(ser). the nonsense suppressors allowed isolation of nonsense mutants of a lytic bacteriophage and suppressible auxotroph ... | 1995 | 7596286 |
| effects of the generation of single-stranded dna on the maintenance of plasmid pmv158 and derivatives in different bacillus subtilis strains. | the effects of the single-strand origins (ssos) of plasmid pmv158 on (i) the conversion of its single-stranded (ss) replication intermediates to double-stranded (ds) plasmid dna and (ii) its maintenance were analyzed. the rolling-circle plasmid pmv158, which replicates via ssdna intermediates, contains two single-strand origins (ssos) of replication, pala and palu. in this paper the results obtained with bacillus subtilis are described; complementary studies with lactococcus lactis are presented ... | 1995 | 7597110 |
| effects of the generation of single-stranded dna on the maintenance of plasmid pmv158 and derivatives in lactococcus lactis. | the effects of the single-strand origins (ssos) of the broad-host-range streptococcal plasmid pmv158 on (i) the conversion of its single-stranded (ss) dna replication intermediates to double-stranded (ds) plasmid dna and (ii) its maintenance were analyzed. pmv158 is distinguished from most other plasmids that replicate by the rolling-circle mechanism by the presence of two single-strand origins of replication, pala and palu. in this paper the results obtained with lactococcus lactis are presente ... | 1995 | 7597111 |
| sequence analysis of a 5.6 kb fragment of chromosome ii from saccharomyces cerevisiae reveals two new open reading frames next to cdc28. | the sequence of a 5653 bp dna fragment of the right arm of chromosome ii of saccharomyces cerevisiae contains two unknown open reading frames (ybr1212 and ybr1213) next to gene cdc28. gene disruption reveals both putative genes as non-essential. orf ybr1212 encodes a predicted protein with 71% similarity and 65% identity (total polypeptide of 376 aa) with the 378 aa surl protein of s. cerevisiae, while the putative product of orf ybr1213, which is strongly expressed, has 28% identity with a lact ... | 1995 | 7597849 |
| induction of thermotolerance by chemical agents in lactococcus lactis subsp. lactis il1403. | like in other organisms tested to date, adapted cells of lactococcus lactis subsp. lactis il1403 pretreated at 42 degrees c for 30 min develop a thermotolerant state, i.e. an increased ability to survive subsequent exposure to a lethal challenge temperature (52 degrees c for 15 or 30 min). in different cellular systems, chemicals as diverse as divalent metal salts, natural or synthetic compounds trigger the development of thermotolerance. yet, in l. lactis subsp. lactis il1403, among the 17 chem ... | 1995 | 7599033 |
| characterization of the lactococcal abid1 gene coding for phage abortive infection. | lactococcal phage abortive infection (abid1) determined by plasmid pil105 is active on both prolate- and small-isometric-head phages of the c6a and 936 phage groups, respectively, which are considered two different species. the abi phenotype was found to be encoded by a single gene, designated abid1. the abid1-encoded protein (351 amino acids) does not show homology with any known protein and has a deduced isoelectric point of 10. it also possesses two helix-turn-helix structures and an unusuall ... | 1995 | 7601848 |
| phage operon involved in sensitivity to the lactococcus lactis abortive infection mechanism abid1. | phage bil66 is unable to grow on lactococcus lactis cells harboring the abortive infection gene abid1. spontaneous phage mutants able to grow on abid1 cells were used to study phage-abi interaction. a 1.33-kb dna segment of a mutant phage allowed growth of abid1s phages in abid1 cells when present in trans. sequence analysis of this segment revealed an operon composed of four open reading frames, designated orf1 to orf4. the operon is transcribed 10 min after infection from a promoter presenting ... | 1995 | 7601849 |
| restriction-modification systems in lactococcus lactis. | several restriction-modification (r-m) systems have been identified in lactococcus lactis. most of the systems have been plasmid encoded and function as phage-resistance mechanisms. at least five different type-ii r-m systems, llaai, llabi, llaci, lladi and llaei, were identified in isolates from a mixed cheddar starter culture. llaai and llabi recognized the dna sequences 5'- decreases gatc-3' and 5'-c decreases tryag-3', respectively. the genes coding for the llaai and llabi r-m systems have b ... | 1995 | 7607475 |
| the ssoii and nlax dna methyltransferases: overproduction and functional analysis. | overproduction of the nlax dna methyltransferase (m.nlax) in an escherichia coli host conferred resistance to ssoii restriction endonuclease (r.ssoii) digestion. this suggested an overlap of sequence specificity between m.nlax and m.ssoii, the latter of which modifies the internal cytosine of the target sequence 5'-ccngg-3'. a variant of m.nlax (m.sso/nla), containing an n-terminal extension from m.ssoii, was also enzymatically active. using deletion analysis, the n-terminal 71 amino-acid residu ... | 1995 | 7607533 |
| cloning and partial characterization of regulated promoters from lactococcus lactis tn917-lacz integrants with the new promoter probe vector, pak80. | transposon tn917-ltv1 was used to produce a collection of lactococcus lactis strains with fusion of a promoterless lacz gene to chromosomal loci. screening 2,500 tn917-ltv1 integrants revealed 222 that express beta-galactosidase on plates at 30 degrees c. pulsed-field gel electrophoresis revealed tn917-ltv1 insertions in at least 13 loci in 15 strains analyzed. integrants in which beta-galactosidase expression was regulated by temperature or ph and/or arginine concentration were isolated. in mos ... | 1995 | 7618865 |
| genetic marking of lactococcus lactis shows its survival in the human gastrointestinal tract. | a human feeding study was performed with lactococcus lactis tc165.5, which is genetically marked by insertion of the sucrose-nisin conjugative transposon tn5276 and chromosomal resistance to rifampin and streptomycin. the fate of strain tc165.5 and its nucleic acids was monitored by conventional plating methods and by molecular detection techniques based on specific pcr amplification of the nisin (nisa) gene from dna extracted from human feces. a method was developed for the efficient extraction ... | 1995 | 7618890 |
| purification and cloning of dna fragments fractionated on agarose gels. | purification of dna fragments from acrylamide or agarose gels is a commonly used technique in the molecular biology laboratory. this article describes a rapid, efficient, and inexpensive method of purifying dna fractions from an agarose gel. the purified dna is suitable for use in a wide range of applications including ligation using dna ligase. the procedure uses standard high-melting-temperature agarose and normal tbe electrophoresis buffer. in addition, the protocol does not involve the use o ... | 1995 | 7620974 |
| specific antibody-mediated detection of brochothrix thermosphacta in situ in british fresh sausage. | a rabbit polyclonal antibody-linked probe was developed which detected 76% of 800 food isolates of the spoilage bacterium brochothrix thermosphacta when cells were bound to nitrocellulose. in slide cross-reaction tests all six environmental isolates tested were stained but the type strain was not. the antibody did not cross-react with listeria grayi, l. monocytogenes, lactobacillus plantarum, lactococcus lactis, streptococcus mutans, bacillus cereus or b. subtilis. the antibody-linked probe dete ... | 1995 | 7538105 |
| purification and characterization of a small membrane-associated sugar phosphate phosphatase that is allosterically activated by hpr(ser(p)) of the phosphotransferase system in lactococcus lactis. | in the gram-positive bacterium, lactococcus lactis, nonmetabolizable cytoplasmic sugar phosphates, accumulated by the phosphoenolpyruvate:sugar phosphotransferase system, are rapidly dephosphorylated and expelled from the cell upon addition of glucose (inducer expulsion). our recent studies have established that a metabolite-activated, atp-dependent protein kinase that phosphorylates serine-46 in hpr of the phosphoenolpyruvate:sugar phosphotransferase system activates a sugar phosphate phosphata ... | 1995 | 7622485 |
| the codon usage of the nisz operon in lactococcus lactis n8 suggests a non-lactococcal origin of the conjugative nisin-sucrose transposon. | an 11.6 kb area downstream from the structural gene of nisin z in the conjugative nisin-sucrose transposon of lactococcus lactis subsp. lactis n8 was cloned and sequenced. analysis of the sequence revealed eight open reading frames, niszbtclprk, followed by a putative rho-independent terminator (delta g degrees = -4.7 kcal/mol). the c-terminal hydrophilic domain of the nisk protein is homologous to the c-termini of several histidine kinases of bacterial two-component regulator systems, such as s ... | 1995 | 7626780 |
| characterization and heterologous expression of the tetl gene and identification of iso-iss1 elements from enterococcus faecalis plasmid pjh1. | the tetracycline-resistance (tcr) determinant of the enterococcus faecalis plasmid pjh1 has been identified and located on a 2.2-kb rsai-ecori fragment. the fragment was cloned in escherichia coli, and specified tcr in this host. the nucleotide (nt) sequence of the cloned fragment showed the presence of an open reading frame (orf) of 1374 bp, designated tetl. the nt sequence of tetl from pjh1 was identical to that of the tetl present on pls1 from streptococcus agalactiae. upstream of the pjh1 te ... | 1995 | 7628724 |
| homology modelling of the lactococcus lactis leader peptidase nisp and its interaction with the precursor of the lantibiotic nisin. | a model is presented for the 3-d structure of the catalytic domain of the putative leader peptidase nisp of lactococcus lactis, and the interaction with its specific substrate, the precursor of the lantibiotic nisin. this homology model is based on the crystal structures of subtilisin bpn' and thermitase in complex with the inhibitor eglin. predictions are made of the general protein fold, inserted loops, ca2+ binding sites, aromatic interactions and electrostatic interactions of nisp. cleavage ... | 1995 | 7630881 |
| specificity of peptide transport systems in lactococcus lactis: evidence for a third system which transports hydrophobic di- and tripeptides. | a proton motive force-driven di-tripeptide carrier protein (dtpt) and an atp-dependent oligopeptide transport system (opp) have been described for lactococcus lactis mg1363. using genetically well-defined mutants in which dtpt and/or opp were inactivated, we have now established the presence of a third peptide transport system (dtpp) in l. lactis. the specificity of dtpp partially overlaps that of dtpt. dtpp transports preferentially di- and tripeptides that are composed of hydrophobic (branched ... | 1995 | 7642491 |
| cloning and characterization of the abortive infection genetic determinant abid isolated from pbf61 of lactococcus lactis subsp. lactis kr5. | a 6.3-kb fragment from pbf61 in lactococcus lactis subsp. lactis kr5 was cloned and found to confer an abortive phage infection (abi+) phenotype exhibiting a reduction in efficiency of plating and plaque size for small isometric- and prolate-headed bacteriophages sk1 and c2, respectively, and to produce a 10-fold decrease in c2 phage burst size. phage adsorption was not significantly reduced. an open reading frame of 1,098 bp was sequenced and designated abid. tn5 mutagenesis confirmed that abid ... | 1995 | 7646042 |
| characterization and distribution of two insertion sequences, is1191 and iso-is981, in streptococcus thermophilus: does intergeneric transfer of insertion sequences occur in lactic acid bacteria co-cultures? | a chromosomal repeated sequence from streptococcus thermophilus was identified as a new insertion sequence (is), is1191. this is the first is element characterized in this species. this 1313 bp element has 28 bp imperfect terminal inverted repeats and is flanked by short direct repeats of 8 bp. the single large open reading frame of is1191 encodes a 391-amino-acid protein which displays homologies with transposases encodes by is1201 from lactobacillus helveticus (44.5% amino-acid sequence identi ... | 1995 | 7651138 |
| [data on the cultural and morphologic features of dissociation forms of nisin-producing streptococcus]. | colonies and cells of s and g variants of streptococcus lactis, strain msu were studied comparatively. it was shown that in the g form the growth rate and other biosynthetic peculiarities and in particular the capacity for the nisin synthesis were lower. morphological properties of the colonies and cells of the s and g variants of the nisin-producing streptococcus were investigated. | 1995 | 7654096 |
| behavior of listeria monocytogenes in mozzarella cheese in presence of lactococcus lactis. | the behavior of listeria monocytogenes (scott a) on fully processed italian mozzarella cheese was examined in presence and in absence of bacteriocins produced by lactococcus lactis ssp. lactis strains (dip 15 and dip 16). these strains, isolated from raw milk, produced heat stable bacteriocins that were inactivated by pronase, alpha- chymotrypsin and proteinase k, but not by pepsin, trypsin and catalase. the addition of crude bacteriocins to the growing culture of listeria monocytogenes resulted ... | 1995 | 7654515 |
| glucose metabolism and internal ph of lactococcus lactis subsp. lactis cells utilizing nmr spectroscopy. | the metabolism of glucose was studied in lactococcus lactis subsp. cnrz 125 by 13c nmr. the initial rate of glucose utilization was higher for exponential phase cells than for stationary phase cells [150 vs 85 nmol g (dry wt)-1 s -1]. 31p nmr was used to determine changes in glycolytic phosphorylated intermediates (fructose-1,6-diphosphate, dihydroxyacetone phosphate and phosphoglycerate). the internal phs of l. lactis subsp. lactis cnrz 141 and cnrz 125 were also measured by 31p nmr as a functi ... | 1995 | 7662330 |
| stress response in lactococcus lactis: cloning, expression analysis, and mutation of the lactococcal superoxide dismutase gene. | in an analysis of the stress response of lactococcus lactis, three proteins that were induced under low ph culture conditions were detected. one of these was identified as the lactococcal superoxide dismutase (soda) by n-terminal amino acid sequence analysis. the gene encoding this protein, designated soda, was cloned by the complementation of a soda sodb escherichia coli strain. the deduced amino acid sequence of l. lactis soda showed the highest degree of similarity to the manganese-containing ... | 1995 | 7665513 |
| streptococcus lactis septicemia in a patient with chronic lymphocytic leukemia. | | 1995 | 7668230 |
| a milk-based method for detecting antimicrobial substances produced by lactic acid bacteria. | a new technique for the detection of antimicrobial substances produced by lactic acid bacteria has been developed. in this technique, milk agar plates were supplemented with tetrazolium chloride or tetrazolium blue dyes. comparisons of milk agar assays with m17 agar plates indicated that, out of 30 bacterial strains, 13 strains produced bacteriocins or inhibitory substances that were detectable on milk agar plates but not on m17 agar plates. multiple-strain lactococcal cultures are used in milk ... | 1995 | 7673514 |
| oligopeptidases from lactococcus lactis. | | 1995 | 7674946 |
| gene inactivation in lactococcus lactis: histidine biosynthesis. | lactococcus lactis strains from dairy and nondairy sources were tested for the ability to grow in the absence of histidine. among 60 dairy strains tested, 56 required histidine, whereas only 1 of 11 nondairy strains had this requirement. moreover, 10 of the 56 auxotrophic strains were able to grow in the presence of histidinol (hol+), the immediate histidine precursor. this indicates that adaptation to milk often results in histidine auxotrophy. the histidine operon was detected by southern hybr ... | 1993 | 7687248 |
| characterization of the nisin gene cluster nisabtcipr of lactococcus lactis. requirement of expression of the nisa and nisi genes for development of immunity. | the nisin gene cluster nisabtcipr of lactococcus lactis, located on a 10-kbp dna fragment of the nisin-sucrose transposon tn5276, was characterized. this fragment was previously shown to direct nisin-a biosynthesis and to contain the nisp and nisr genes, encoding a nisin leader peptidase and a positive regulator, respectively [van der meer, j. r., polman, j., beerthuyzen, m. m., siezen, r. j., kuipers, o. p. & de vos, w. m. (1993) j. bacteriol. 175, 2578-2588]. further sequence analysis revealed ... | 1993 | 7689965 |
| sequence analysis, distribution and expression of an aminopeptidase n-encoding gene from lactobacillus helveticus cnrz32. | lactobacillus (lb.) helveticus cnrz32 possesses a 97-kda metalloenzyme with aminopeptidase activity (pepn; ec 3.4.11.2). a 3.8-kb fragment encoding pepn was cloned into pil253 and designated psuw34. transformation of lactococcus (lc.) lactis lm0230 with psuw34 resulted in > 180-fold increase in general aminopeptidase (ap) activity using l-lysine-p-nitroanilide. southern hybridization was conducted to determine the distribution of homology to the cnrz32 pepn gene among lactic-acid bacteria (lab). ... | 1995 | 7698673 |
| isolation of nisin-producing lactococcus lactis strains from dry fermented sausages. | a total of 4608 lactic acid bacteria (lab) were isolated from 24 spanish fermented sausages and screened for bacteriocin production. two strains, bb24 and g18, produced bacteriocins that inhibited a broad spectrum of gram-positive bacteria. bb24 and g18 were tentatively identified as lactococcus lactis by carbohydrate fermentation patterns and other biochemical characteristics. the characterization of their bacteriocins suggested that both could be the well-known lantibiotic nisin. this was conf ... | 1995 | 7698947 |
| utilization of cheddar cheese containing nisin as an antimicrobial agent in other foods. | cheddar cheese made with nisin-producing lactococci contained between 400 and 1200 iu of nisin per gram of cheese. cultures used were lactococcus lactis ssp. cremoris js102, a nisin-producing transconjugant developed in the laboratories of dr. l.l. mckay and lactococcus lactis ssp. lactis ncdo 1404 obtained from the national collection of food bacteria, reading, england. pasteurized process cheese spreads with 53% and 60% moisture and 0, 301 and 387 iu nisin/g were manufactured and inoculated wi ... | 1994 | 7703016 |
| scanning electron microscopy of target cells and molecular weight determination of a bacteriocin produced by lactococcus lactis d53. | a bacteriocin, lactococcin d53, from lactococcus lactis strain d53 was partially purified by precipitation with ammonium sulfate and dialysis against deionized water, at which time it precipitated from solution. a native molecular weight was determined by gel filtration, where bacteriocin was detected in two fractions which were measured at 104 and 6.7 kda. a molecular weight of 7.0 kda under denaturing conditions was determined by tricine-sds-polyacrylamide gel electrophoresis. the molecular we ... | 1994 | 7703022 |
| repair of oxidative dna damage in gram-positive bacteria: the lactococcus lactis fpg protein. | the formamidopyrimidine dna glycosylase gene (fpg-l) of the gram-positive microaerophilic bacterium lactococcus lactis subsp. cremoris ml3 has been cloned, characterized and sequenced. the fpg-l gene is composed of 819 bp encoding a protein of 31.3 kda (fpg-l). the deduced amino acid sequence of the fpg-l protein shows 59% similarity and 38% identity with the escherichia coli fpg protein (fpg-e). polyclonal antibodies against fpg-e react with the fpg-l protein. the fpg-l protein was purified to ... | 1995 | 7704272 |
| cloning of promoter-like sequences from lactobacillus paracasei subsp. paracasei cg11 and their expression in escherichia coli, lactococcus lactis, and lactobacillus reuteri. | fragments of chromosomal dna from lactobacillus paracasei subsp. paracasei cg11 (formerly lactobacillus casei cg11) capable of functioning as promoters were isolated using the broad host range, promoter-probe vector pgkv210. five such fragments designated p61, p79, p80, p116, and p144 were completely sequenced and analyzed. fragment p61 had the highest transcriptional efficiency in escherichia coli and lactobacillus reuteri whereas p80 was the most active in lactococcus lactis. in general, the o ... | 1994 | 7704831 |
| preparation of bacterial x-prolyl dipeptidyl aminopeptidase and its stabilization by organic cosolvents. | to obtain large amounts of the x-prolyl dipeptidyl aminopeptidase from lactococcus lactis subsp lactis (pepx, e.c. 3.4.14.5), pepx was purified from a commercial l. lactis cell extract. the enzyme was purified in only three steps and the last one was performed by hplc on a c4 reverse-phase column using acetonitrile as an eluent. despite its high molecular mass (175 kda), the enzyme was recovered with a good activity yield (75%). advantages and drawbacks of this technique compared to the classica ... | 1995 | 7710078 |
| distribution of proteins similar to iiimanh and iiimanl of the streptococcus salivarius phosphoenolpyruvate:mannose-glucose phosphotransferase system among oral and nonoral bacteria. | in streptococcus salivarius, the phosphoenolpyruvate (pep):mannose-glucose phosphotransferase system, which concomitantly transports and phosphorylates mannose, glucose, fructose, and 2-deoxyglucose, is composed of the general energy-coupling proteins ei and hpr, the specific membrane-bound iiiman, and two forms of a protein called iiiman, with molecular weights of 38,900 (iiimanh) and 35,200 (iiimanl), that are found in the cytoplasm as well as associated with the membrane. several lines of evi ... | 1995 | 7730253 |
| construction of a food-grade host/vector system for lactococcus lactis based on the lactose operon. | a plasmid-based food-grade vector system was developed for lactococcus lactis by exploiting the genes for lactose metabolism. l. lactis mg5267 is a plasmid-free strain containing the entire lactose operon as a chromosomal insertion. the lacf gene was deleted from this strain by a double cross-over homologous recombination event. the lacf-deficient strain produced a lac- phenotype on indicator agar. a cloned copy of the lacf gene expressed on a plasmid was capable of complementing the lacf-defici ... | 1995 | 7737470 |
| locating nisin-producing lactococcus lactis in a fermented meat system. | antibody-linked probes were used to locate nisin in a fermented meat system. free nisin or nisin bound to susceptible cells or food components was not detected. colonies of nisin-producing lactococcus lactis were stained at all times during growth. the position of nisin-producing l. lactis colonies was noted and compared with the location of spoilage organisms or the distribution of areas with a fermented meat appearance. no relationship between the distribution of starter culture and the locati ... | 1995 | 7744718 |
| cloning, expression, sequence analysis, and site-directed mutagenesis of the tn5306-encoded n5-(carboxyethyl)ornithine synthase from lactococcus lactis k1. | the gene (ceo) encoding n5-(carboxyethyl)ornithine synthase (ec 1.5.1.24) has been isolated from the sucrose-nisin transposon tn5306 of lactococcus lactis k1, sequenced, and expressed at high level in escherichia coli. the cloned enzyme has allowed the synthesis of the novel n omega-carboxypropyl amino acids n5-(1-carboxypropyl)-l-ornithine and n6-(1-carboxypropyl)-l-lysine. comparison of the deduced amino acid sequence of n5-(1-carboxyethyl)-l-ornithine synthase (m(r) = 35,323) to the functiona ... | 1995 | 7744873 |
| secretion of biologically active murine interleukin-2 by lactococcus lactis subsp. lactis. | secretion of functional recombinant murine interleukin-2 (mil2) by lactococcus lactis was achieved by fusion of the sequence encoding mature mil2 to the secretion signal leader of the lactococcal usp45 gene placed under transcriptional control of the phage t7 promoter-t7 rna polymerase expression system. the recombinant mature mil2 was one of only a few proteins which accumulated in the growth medium. sequence analysis revealed correct processing at the first amino acid of the mature protein. a ... | 1995 | 7747977 |
| physical and genetic map of the lactococcus lactis subsp. cremoris mg1363 chromosome: comparison with that of lactococcus lactis subsp. lactis il 1403 reveals a large genome inversion. | a physical and genetic map of the chromosome of the lactococcus lactis subsp. cremoris reference strain mg1363 was established. the physical map was constructed for noti, apai, and smai enzymes by using a strategy that combines creation of new rare restriction sites by the random-integration vector prl1 and ordering of restriction fragments by indirect end-labeling experiments. the mg1363 chromosome appeared to be circular and 2,560 kb long. seventy-seven chromosomal markers were located on the ... | 1995 | 7751295 |
| use of continuous culture for the selection of plasmids with improved segregational stability. | in this report a method that enables the selection of stable plasmid variants and the isolation of dna sequences that improve plasmid maintenance is described. the method is based on the principle that in populations of cells carrying derivatives of a plasmid that differ only in the level of segregational stability, when grown in a chemostat under conditions with selective pressure on the plasmid, cells that carry more stable plasmid variants will be enriched. we developed the system for lactoco ... | 1995 | 7753912 |
| the nucleotide sequence for the replication region of pvs40, a lactococcal food grade cloning vector. | the replication region of a limited host range lactococcal vector, pvs40, was located within a 2359 bp ecori--clai fragment. within this fragment a sequence for a 1197 bp reading frame coding for a 46,826 da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (tatagcgtatgaaaaaactgtg), suggesting an origin of replication. the prot ... | 1993 | 7763788 |
| methods to demonstrate the bactericidal activity of bacteriocins. | two simple techniques were developed to demonstrate bactericidal activity of bacteriocins. both were based on allowing a lawn of indicator strain to grow first, then exposing the lawn to bacteriocin-containing cell-free supernatants in a well cut in the seeded agar lawn or by inoculating the bacteriocin-producing strain onto the indicator lawn. lysis of cells of the indicator strain resulted in a clear zone. these techniques may be adapted to test antimicrobial substances other than bacteriocins ... | 1993 | 7763935 |
| the regulation of expression of the lactococcus lactis lactose operon. | translational gene fusions between the escherichia coli beta-galactosidase (lacz) gene and the lactococcus lactis lactose operon were constructed such that transcription from the lactose operon promoter could be assessed by measuring beta-galactosidase activity. the level of beta-galactosidase activity was up to 2.5-fold lower when mg5267 cells, which contain a chromosomal copy of the lactose operon, were grown in glucose compared to those grown in lactose. a greater degree of repression was see ... | 1993 | 7763936 |
| partial characterization of an rpod-like gene of lactococcus lactis subsp. lactis ml3 with a polymerase chain reaction-based approach. | with degenerated oligonucleotide primers for conserved regions of bacterial sigma factor proteins, a 117-bp internal dna fragment of an rpod-like gene of lactococcus lactis subsp. lactis ml3 was amplified by the polymerase chain reaction (pcr). the dna sequence of this pcr product was determined by cycle sequencing, and the deduced amino acid sequence of this internal fragment showed an extensive homology with the known sigma factor sequences from six other microorganisms and present a 13-amino ... | 1993 | 7764136 |
| construction of first-generation lactococcal integrative cloning vectors. | using a randomly-cloned, hindiii-digested, chromosomal fragment from lactococcus lactis subsp. lactis lm0230, first-generation lactococcal integrative cloning vectors were developed. through dideoxy dna sequence analysis, the cloned chromosomal dna fragment was determined to be 1026 base pairs. southern hybridization studies demonstrated applicability of the integrative vector to other strains of l. lactis and l. lactis subsp. cremoris. identification of a single nrui site near the middle of the ... | 1993 | 7764390 |
| production of chymosin for the dairy industry by recombinant dna technology. | the increasing world production of cheese, coupled with a decline in the number of slaughtered calves, has stimulated a search for alternative sources of chymosin. this article briefly reviews microbial alternatives to chymosin and discusses chymosins produced using recombinant dna technology. recombinant chymosin represents one of the first successful applications of recombinant dna technology in the food industry. | 1994 | 7764615 |
| influence of dilution rate and cell immobilization on plasmid stability during continuous cultures of recombinant strains of lactococcus lactis subsp. lactis. | the influence of dilution rate and cell immobilization on plasmid stability in recombinant strains of lactococcus lactis subsp. lactis was investigated during continuous cultures. the studied strains, l. lactis il2682 and il2683, contained plasmids pil9 (lac+), pil205 (cmr) and plasmids pil252 (low copy number) and pil253 (high copy number), respectively, that conferred resistance to erythromycin. plasmid pil205 was remarkably stable. dilution rate did not affect the rate of loss of plasmids pil ... | 1994 | 7764746 |
| rapid isolation and purification of lactococcal bacteriophage dna without the use of caesium chloride gradients. | intact bacteriophage of lactococcus lactis were recovered from small volumes of lysate by centrifugation at 15,000 g without precipitation with polyethylene glycol and sodium chloride, or ultracentrifugation in a caesium chloride gradient. dna was then extracted and purified by standard protocols. this dna was readily digested with restriction endonucleases and used successfully in hybridization experiments. | 1994 | 7764812 |
| action of a cell-envelope proteinase (cepiii-type) from lactococcus lactis subsp. cremoris am1 on bovine kappa-casein. | the specificity of the cell-envelope proteinase (cepiii-type) from lactococcus lactis subsp. cremoris am1 in its action on bovine kappa-casein was studied. a 4-h digest (ph 6.2, 15 degrees c) of kappa-casein was made with the purified proteinase. the ph-4.6 soluble fraction, representing more than 95% of the whole hydrolysate, was ultrafiltered to obtain a high-molecular-mass (hmm) and a low-molecular-mass (lmm) fraction, which were separately further purified by electrophoretic and chromatograp ... | 1994 | 7765163 |
| a novel approach for high level production of a recombinant human parathyroid hormone fragment in escherichia coli. | we describe a novel approach to the production in e. coli of a peptide fragment derived from the human parathyroid hormone (hpth). the first 38 amino acids of hpth were fused at the amino terminus to a derivative of the bacteriophage t4-encoded gp55 protein, and were expressed in the e. coli cytoplasm in inclusion bodies at levels exceeding 50% of the total cell protein. solubilization and subsequent incubation of the inclusion bodies in dilute hydrochloric acid facilitated the cleavage of an ac ... | 1994 | 7765406 |
| expression of lactobacillus casei atcc 393 beta-galactosidase encoded by plasmid plz15 in lactococcus lactis cnrz 1123. | lactococcus lactis subsp. lactis cnrz 1123, a lac- derivative of cnrz 1122 was transformed by electroporation with the lactobacillus casei atcc 393 plasmid plz15, which bears a beta-galactosidase gene. the transformants expressed a constitutive beta-galactosidase activity at a higher level than in lact. casei, and in the cell-free extract two additional protein bands were detected by sds-page which could correspond to lactose metabolism enzymes. both plasmid and beta-gal activity were stable in ... | 1994 | 7765447 |
| cloning and nucleotide sequencing of l-lactate dehydrogenase gene from streptococcus thermophilus m-192. | the gene encoding l-lactate dehydrogenase (ldh) was cloned from an industrial dairy strain of streptococcus thermophilus m-192 using a synthetic oligonucleotide probe based on the n-terminal amino acid sequence of the purified enzyme, and its nucleotide sequence was determined. the enzyme was deduced to have 328 amino acid residues with a molecular weight of 35,428 and found to have high sequence similarity to ldhs from other lactic acid bacteria (89.0% to streptococcus mutans, 76.3% to lactococ ... | 1994 | 7765475 |
| expression of a chitinase gene from serratia marcescens in lactococcus lactis and lactobacillus plantarum. | a chitinase gene from the gram-negative bacterium serratia marcescens bjl200 was cloned in lactococcus lactis subsp. lactis mg1363 and in the silage inoculum strain lactobacillus plantarum e19b. the chitinase gene was expressed as an active enzyme at a low level in lactococcus lactis, when cloned in the same transcriptional orientation as the gene specifying the replication protein of the vector pil253. using the expression vectors pmg36e and pgkv259 with lactococcal promoter fragments p32 and p ... | 1994 | 7765812 |
| segregational stability and copy number of the theta-type lactococcal replicon rep22 in lactococcus. | rep22 is the replication region of the lactococcal theta replicating pucl22 plasmid. the copy number of rep22-based plasmids in lactococcus was determined by using a chromosomal dna fragment from lactococcus lactis subsp. lactis mms368 as reference. segregational behavior appeared to be linked to copy number and therefore indicated random distribution of copies to daughter cells. nevertheless, an active partitioning system was detected in the parental plasmid pucl22. a pucl22 138-bp dna restrict ... | 1995 | 7765880 |
| identification and molecular analysis of lactococcus lactis rpod operon. | the complete nucleotide sequence of an open reading frame (orf) preceding the lactococcus lactis rpod gene is reported. it was suggested that this orf encodes lactococcus lactis dna primase and that the l. lactis rpod operon consists of only two genes. northern hybridization analysis showed that i) there are four mrnas transcribing the rpod gene (from upstream, m1-m4), ii) only the 3.7-kb transcript m1 includes the entire rpod operon, iii) the shortest transcript m4 exists at both logarithmic an ... | 1995 | 7765979 |
| medium-dependent regulation of proteinase gene expression in lactococcus lactis: control of transcription initiation by specific dipeptides. | transcriptional gene fusions with the escherichia coli beta-glucuronidase gene (gusa) were used to study the medium- and growth-dependent expression of the divergently transcribed genes involved in proteinase production (prtp and prtm) of lactococcus lactis sk11. the results show that both the prtp and prtm genes are controlled at the transcriptional level by the peptide content of the medium and, to a lesser extent, by the growth rate. a more than 10-fold regulation in beta-glucuronidase activi ... | 1995 | 7768792 |
| the extracellular pi-type proteinase of lactococcus lactis hydrolyzes beta-casein into more than one hundred different oligopeptides. | the peptides released from beta-casein by the action of pi-type proteinase (prtp) from lactococcus lactis subsp. cremoris wg2 have been identified by on-line coupling of liquid chromatography to mass spectrometry. after 24 h of incubation of beta-casein with purified prtp, a stable mixture of peptides was obtained. the trifluoroacetic acid-soluble peptides of this beta-casein hydrolysate were fractionated by high-performance liquid chromatography and introduced into the liquid chromatography-ion ... | 1995 | 7768856 |
| lactococcus lactis glyceraldehyde-3-phosphate dehydrogenase gene, gap: further evidence for strongly biased codon usage in glycolytic pathway genes. | the gene gap, encoding glyceraldehyde-3-phosphate dehydrogenase (ec 1.2.1.12), was isolated from a genomic library of lactococcus lactis lm0230 dna. plasmids containing the l. lactis gene were able to complement a gap mutant of escherichia coli. the nucleotide sequence of gap predicted a polypeptide chain of 337 amino acids for the enzyme and a subunit molecular mass of 36,043. the codon usage in gap and four other glycolytic genes from l. lactis showed a high degree of bias, when compared with ... | 1995 | 7773380 |
| genes involved in immunity to the lantibiotic nisin produced by lactococcus lactis 6f3. | the lantibiotic nisin is produced by several strains of lactococcus lactis. the complete gene cluster for nisin biosynthesis in l. lactis 6f3 comprises 15 kb of dna. as described previously, the structural gene nisa is followed by the genes nisb, nist, nisc, nisi, nisp, nisr, and nisk. further analysis revealed three additional open reading frames, nisf, nise, and nisg, adjacent to nisk. approximately 1 kb downstream of the nisg gene, three open reading frames in the opposite orientation have be ... | 1995 | 7793910 |
| cloning and sequencing of lladchi [corrected] restriction/modification genes from lactococcus lactis and relatedness of this system to the streptococcus pneumoniae dpnii system. | the natural 7.8-kb plasmid psrq700 was isolated from lactococcus lactis subsp. cremoris dch-4. it encodes a restriction/modification system named lladchi [corrected]. when introduced into a phage-sensitive l. lactis strain, psrq700 confers strong phage resistance against the three most common lactococcal phage species, namely, 936, c2, and p335. the lladchi [corrected] endonuclease was purified and found to cleave the palindromic sequence 5'-gatc-3'. it is an isoschizomer of streptococcus pneumo ... | 1995 | 7793939 |
| biochemical and genetic characterization of pepf, an oligopeptidase from lactococcus lactis. | lactococcus lactis possesses a complex proteolytic system which is essential for its growth in milk. we characterized one of the peptidases of this system, oligopeptidase pepf, together with its structural gene. pepf hydrolyzed peptides containing between 7 and 17 amino acids with a rather wide specificity. it was purified to homogeneity. the n-terminal sequences of pepf and of peptides resulting from tryptic digestion of pepf were determined and used to design degenerate oligonucleotides which ... | 1994 | 7798200 |
| genetic analysis of regions of the lactococcus lactis subsp. lactis plasmid prs01 involved in conjugative transfer. | the genes responsible for conjugative transfer of the 48.4-kb lactococcus lactis subsp. lactis ml3 plasmid prs01 were localized by insertional mutagenesis. integration of the is946-containing plasmid ptrk28 into prs01 generated a pool of stable cointegrates, including a number of plasmids altered in conjugative proficiency. mapping of ptrk28 insertions and phenotypic analysis of cointegrate plasmids identified four distinct regions (tra1, tra2, tra3, and tra4) involved in prs01 conjugative trans ... | 1994 | 7811081 |
| mosaic structure of large regions of the lactococcus lactis subsp. cremoris chromosome. | lactococcus lactis subsp. lactis and lactococcus lactis subsp. cremoris are closely related phenotypically and genetically. here we report that certain regions of their chromosomes diverge considerably more than others. conserved regions differ by less than 20%, whilst variable regions differ by more than 60%. this mosaic structure may have arisen by horizontal gene transfer from distantly related bacteria since in a particular region of the l. lactis subsp. cremoris chromosome the g+c content a ... | 1994 | 7812446 |
| two lactococcus lactis genes, including lacx, cooperate to trigger an sos response in a reca-negative background. | a 4.3-kb ecori fragment from a lactococcus lactis genomic library alleviates the methyl methanesulfonate, mitomycin c, and uv sensitivities of an escherichia coli reca mutant (m. novel, x. f. huang, and g. novel, fems microbiol. lett. 72:309-314, 1990). it complements reca1 and delta reca mutations but not reca13. three proteins (with molecular masses of 20, 35, and 23 kda) were produced from this fragment in a t7-directed system, and three corresponding genes were detected by dna sequencing, na ... | 1995 | 7814316 |
| absence of cholic acid 7 alpha-dehydroxylase activity in the strains of lactobacillus and bifidobacterium. | to investigate the presence of 7 alpha-dehydroxylase activity on bile acids in the bacterial strains of fermented milk products, 46 strains of lactobacillus casei, lactobacillus paracasei, lactobacillus rhamnosus, lactobacillus acidophilus, lactobacillus gasseri, bifidobacterium adolescentis, bifidobacterium bifidum, bifidobacterium breve, bifidobacterium infantis, bifidobacterium longum, lactococcus lactis spp. lactis, and streptococcus salivarius spp. thermophilus were tested for their ability ... | 1994 | 7814703 |
| the pot family of transport proteins. | | 1994 | 7817396 |
| genetic aspects of aromatic amino acid biosynthesis in lactococcus lactis. | polymerase chain reaction (pcr) primers designed from a multiple alignment of predicted amino acid sequences from bacterial aroa genes were used to amplify a fragment of lactococcus lactis dna. an 8 kb fragment was then cloned from a lambda library and the dna sequence of a 4.4 kb region determined. this region was found to contain the genes tyra, aroa, arok, and phea, which are involved in aromatic amino acid biosynthesis and folate metabolism. tyra has been shown to be secreted and arok also h ... | 1995 | 7823907 |
| transport of beta-casein-derived peptides by the oligopeptide transport system is a crucial step in the proteolytic pathway of lactococcus lactis. | in the proteolytic pathway of lactococcus lactis, milk proteins (caseins) are hydrolyzed extracellularly to oligopeptides by the proteinase (prtp). the fate of these peptides, i.e. extracellular hydrolysis followed by amino acid uptake or transport followed by intracellular hydrolysis, has been addressed. mutants have been constructed that lack a functional di-tripeptide transport system (dtpt) and/or oligopeptide transport system (opp) but do express the p1-type proteinase (specific for hydroly ... | 1995 | 7829486 |
| primary structure and functional analysis of the lysis genes of lactobacillus gasseri bacteriophage phi adh. | the lysis genes of the lactobacillus gasseri bacteriophage phi adh were isolated by complementation of a lambda sam mutation in escherichia coli. nucleotide sequencing of a 1,735-bp dna fragment revealed two adjacent coding regions of 342 bp (hol) and 951 bp (lys) in the same reading frame which appear to belong to a common transcriptional unit. proteins corresponding to the predicted gene products, holin (12.9 kda) and lysin (34.7 kda), were identified by in vitro and in vivo expression of the ... | 1995 | 7836307 |
| purification and characterization of a general aminopeptidase (st-pepn) from streptococcus salivarius ssp. thermophilus cnrz 302. | a general aminopeptidase (st-pepn) was purified from an intracellular extract of streptococcus salivarius ssp. thermophilus cnrz 302 by ion-exchange chromatography and hydrophobic interaction chromatography. gel electrophoresis of the purified enzyme in denaturing or nondenaturating conditions showed a single protein band. the enzyme is a monomer with a molecular mass of 97 kda. its activity is maximal at ph 7 and 36 degrees c and is completely abolished by cucl2 and zncl2. the enzyme is strongl ... | 1994 | 7836577 |
| [the dental pulp reaction to microbial action in different methods of treating the carious cavity]. | under study were the effects of bacterial stimulation of prepared dentin on dental pulp. traditional method of drug treatment of prepared cavity with alcohol and either was compared with methods reducing dentin permeability making use of calcium hydroxide, potassium nitrate, and calcium oxalate. inflammatory reaction of the pulp was more pronounced after traditional treatment. reduction of dentin permeability with agents blocking dentin tubes reduced the severity of inflammatory reaction. | 1994 | 7846716 |
| cloning and nucleotide sequence analysis of the lactobacillus delbrueckii ssp. lactis dsm7290 cysteine aminopeptidase gene pepc. | a genomic library of lactobacillus delbrueckii ssp. lactis dsm7290 in the low copy number vector plg339, was screened for the presence of peptidase genes. using the chromogenic substrate gly-ala-beta-naphthylamide, which is not a substrate for any of the recently cloned peptidases of dsm7290, and the multiple peptidase deficient escherichia coli strain cm89, allowed the isolation of clones, which contained the equivalent hydrolytic activity. to identify genes encoding the conserved catalytic act ... | 1994 | 7851736 |
| functional expression in saccharomyces cerevisiae of the lactococcus lactis mles gene encoding the malolactic enzyme. | malolactic fermentation, a crucial step in winemaking, results mostly in degradation by lactic acid bacteria of l-malic acid into l-lactic acid. this direct decarboxylation is catalysed by the malolactic enzyme. recently we, and others, have cloned the mles gene of lactococcus lactis encoding malolactic enzyme. heterologous expression of mles in saccharomyces cerevisiae was tested to perform simultaneously alcoholic and malolactic fermentations by yeast. mles gene was cloned in a yeast multicopy ... | 1995 | 7867919 |
| an aminopeptidase p from lactococcus lactis with original specificity. | an aminopeptidase p (e.c. 3.4.11.9) that cleaves the arg-1-pro-2 bond of bradykinin has been isolated for the first time from lactococcus lactis. the peptidase was purified to homogeneity in a 3-step procedure and characterized. it is a monomeric metalloenzyme with a 43 kda molecular mass, activated by mn2+ and inhibited by dtt. it differs from the majority of aminopeptidases p already described by displaying a specificity for x-pro-pro n-terminal and probably an extended binding site that could ... | 1995 | 7873564 |
| regulation of 2-deoxyglucose phosphate accumulation in lactococcus lactis vesicles by metabolite-activated, atp-dependent phosphorylation of serine-46 in hpr of the phosphotransferase system. | lactococcus lactis takes up glucose and the nonmetabolizable glucose analogue 2-deoxyglucose (2dg) via the phosphotransferase system and extrudes the accumulated sugar phosphates in a process apparently dependent on a cytoplasmic sugar-phosphate phosphatase. uptake of 2dg into l. lactis vesicles was shown to be dependent on an energy source, effectively provided by intravesicular phosphoenolpyruvate (pep). 2dg phosphate (2dg-p) accumulation in these vesicles was not inhibited, and preaccumulated ... | 1994 | 7881559 |
| molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of lactococcus lactis, a muramidase needed for cell separation. | a gene of lactococcus lactis subsp. cremoris mg1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in puc19 by screening escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized micrococcus lysodeikticus cells. in cell extracts of l. lactis mg1363 and several halo-producing e. coli transformants, lytic bands of similar sizes were identified by denaturing sodium dodecyl sulfate (sds)-polyacrylamide gels contai ... | 1995 | 7883712 |
| a di- and tripeptide transport system can supply listeria monocytogenes scott a with amino acids essential for growth. | listeria monocytogenes takes up di- and tripeptides via a proton motive force-dependent carrier protein. this peptide transport system resembles the recently cloned and sequenced secondary di- and tripeptide transport system of lactococcus lactis (a. hagting, e. r. s. kunji, k. j. leenhouts, b. poolman, and w. n. konings, j. biol. chem. 269:11391-11399, 1994). the peptide permease of l. monocytogenes has a broad substrate specificity and allows transport of the nonpeptide substrate 5-aminolevuli ... | 1995 | 7887604 |
| a 7-base-pair sequence protects dna from exonucleolytic degradation in lactococcus lactis. | linear dna molecules are subject to degradation by various exonucleases in vivo unless their ends are protected. it has been demonstrated that a specific 8-bp sequence, 5'-gctggtgg-3', named chi, can protect linear double-stranded dna from the major escherichia coli exonuclease recbcd. chi protects linear replication products of rolling-circle plasmids from recbcd degradation in vivo, in agreement with observations in vitro. a unique 7-bp sequence, 5'-gcgcgtg-3', is shown to protect similar repl ... | 1995 | 7892255 |
| sequence of the afg3 gene encoding a new member of the ftsh/yme1/tma subfamily of the aaa-protein family. | a nuclear gene from saccharomyces cerevisiae was cloned by genetic complementation of a temperature-sensitive respiratory-deficient mutant. dna sequence analysis reveals that it encodes a protein with homology to yme1, ftsh and tma, proteins which belong to the aaa-protein family (atpases associated with diverse cellular activities). the members of this family are involved in very different biological processes. yme1p, a yeast mitochondrial protein, affects the rate of dna escape from mitochondr ... | 1994 | 7900428 |
| xaa-pro-dipeptidyl-aminopeptidase from lactococcus lactis catalyses kinetically controlled synthesis of peptide bonds involving proline. | xaa-pro-dipeptidyl-aminopeptidase (ec 3.4.14.5) from lactococcus lactis (pepx) was used, for the first time, as a catalyst in kinetically controlled synthesis of peptide bonds involving proline. pepx had amidase and esterase activities in addition to peptidase activity. thus amide and ester derivatives of x-pro peptides could be employed as acyl donors. pepx showed a broad specificity for the residue in position p'1, accepting a large variety of amino acid amides, esters, peptides as well as fre ... | 1994 | 7917062 |
| expression, purification, and characterization of thymidylate synthase from lactococcus lactis. | the thymidylate synthase (ts) gene from lactococcus lactis has been highly expressed in escherichia coli. the ts protein was purified by sequential chromatography on q-sepharose and phenyl-sepharose. six grams of cell pellet yielded 140 mg of homogeneous ts. ts is a highly conserved enzyme, and several of the conserved amino acid residues that have been implicated in catalytic function are altered in l. lactis ts. by use of a 3-dimensional homology model, we have predicted covariant changes that ... | 1994 | 7920258 |
| study of gene transfer in vitro and in the digestive tract of gnotobiotic mice from lactococcus lactis strains to various strains belonging to human intestinal flora. | the use of genetically modified organisms (gmo) in dairy products requires evaluation of the dna transfer capacity from such organisms among the human intestinal microflora. thus, both in vitro and in vivo [in the digestive tract (dt) of mice] transfer from lactococcus lactis donor strains of the conjugative plasmid pil205 (cmr) and the non-conjugative plasmid pil253 (emr) to: (1) recipient strains isolated from human faecal flora bacteroides sp., bifidobacterium sp., peptostreptococcus sp. (str ... | 1994 | 7921350 |
| cloning, molecular characterization, and expression of the genes encoding the lytic functions of lactococcal bacteriophage phi lc3: a dual lysis system of modular design. | the genes encoding the lysis proteins of lactococcus lactis bacteriophage phi lc3 were cloned, sequenced, and expressed in escherichia coli. the phi lc3 lysis genes, lysa and lysb, encode a membrane-disrupting protein (lysa) of 88 amino acids, and a cell wall degrading protein (lysb) of 429 amino acids, which shares significant sequence similarity with lysins from the streptococcus pneumoniae phages cp-1, cp-7, and cp-9, and lactobacillus delbrueckii phage mv1. both lysa and lysb function in e. ... | 1994 | 7922887 |
| gene cloning and characterization of pepc, a cysteine aminopeptidase from streptococcus thermophilus, with sequence similarity to the eucaryotic bleomycin hydrolase. | streptococcus thermophilus cnrz 302 contains at least three general aminopeptidases able to hydrolyze phe-beta-naphthylamide substrate. the gene encoding one of these aminopeptidases was cloned from a total dna library of s. thermophilus cnrz 302 constructed in escherichia coli tg1 using pbluescript plasmid. the wild-type tg1 strain, although not deficient in aminopeptidase activity, is unable to hydrolyze the substrate phe-beta-naphthylamide, and thus the library could be screened with an enzym ... | 1994 | 7925365 |
| characterization and expression of the lactobacillus helveticus pepc gene encoding a general aminopeptidase. | an aminopeptidase c gene (pepc) was detected by nucleic acid hybridization from an industrially important lactobacillus helveticus strain. three hybridization positive clones were isolated from a gene library of this l. helveticus strain, and one of them was characterized in more detail. deletion mapping localized the hybridization positivity into a 2.8-kb fragment, which also encoded aminopeptidase activity. this fragment was sequenced and two open reading frames (orf1 and 2) of 1347 and 840 ba ... | 1994 | 7925424 |
| confirmation of the existence of a third family among peptidyl-prolyl cis/trans isomerases. amino acid sequence and recombinant production of parvulin. | in addition to the major cyclophilin-like peptidyl-prolyl cis/trans isomerases (ppiases) of escherichia coli an enzyme of very low relative molecular mass (10.1 kda) was discovered in this organism which gave first indication of the existence of a novel family in this enzyme class [1994, febs lett. 343, 65-69]. in the present report we describe the chemically determined amino acid sequence of four peptides derived from the 10.1 kda protein by the treatment with either cyanogen bromide or endopro ... | 1994 | 7925971 |
| theta replication of the lactococcal plasmid pwvo2. | pwvo2 is a 3.8 kb narrow-host-range plasmid from lactococcus lactis ssp. cremoris wg2, which does not replicate in bacillus subtilis or escherichia coli. single-stranded pwvo2 dna was not observed in lactococcal cells, indicating that this plasmid does not replicate via a rolling-circle mechanism. the sequence of pwvo2 neither showed the structural organization typical for rolling-circle plasmids, nor were sequence similarities with known rolling-circle plasmids present. by 2-d agarose gel elect ... | 1993 | 7934823 |
| molecular analysis of the lactococcus lactis subspecies lactis cnrz270 bidirectional theta replicating lactose plasmid pucl22. | pucl22 is the lactose protease plasmid of lactococcus lactis ssp. lactis cnrz270. the nucleotide sequence of its replication region rep22 contains a non-transcribed region, the replication origin, followed by a gene encoding a putative 388-amino-acid protein named rep22a. the promoter regions of the rep22a and pc194 cat genes share strong similarities and the pucl22 replicon exerted trans or cis negative control on the pc194 cat gene expression in l. lactis. we suggest that rep22a binds to its o ... | 1993 | 7934861 |
| the lactococcus lactis sex-factor aggregation gene clua. | a gene, clua, was cloned from the chromosomally located sex factor of lactococcus lactis mg1363. sequence analysis revealed significant homology with previously described aggregation proteins in enterococcus and streptococcus species. the possibility that clua was an equivalent protein involved in cell aggregation between donor and recipient bacteria during lactococcal conjugation was confirmed by its expression under the control of a heterologous promoter in l. lactis. analysis of the homology ... | 1994 | 7934889 |
| controlled expression and structural organization of a lactococcus lactis bacteriophage lysin encoded by two overlapping genes. | the phi vml3 bacteriophage lysin is specific for lactococci and could be used to promote enzyme release during cheese manufacture. the level of lysin expression from the cloned gene using its own upstream sequences is very low. expression in escherichia coli by using a synthetic hybrid lysin gene and a series of bal 31 deletions of the original cloned dna fragment suggested that the start of the gene had previously been incorrectly assigned. reevaluation of homology between the lysin and bacillu ... | 1994 | 7944354 |
| prevention of c-terminal autoprocessing of lactococcus lactis sk11 cell-envelope proteinase by engineering of an essential surface loop. | the catalytic domain of the cell-envelope proteinase from lactococcus lactis sk11 has various inserts, situated in external loops of the catalytic domain, compared with the related subtilisins. protein engineering was employed to analyse the necessity and function of one of these extra loops (residues 205-219), that is predicted to be located in close proximity to the substrate-binding region and is susceptible to autoproteolysis. we constructed a deletion mutant which lacks 14 residues of this ... | 1994 | 7945226 |
| genetics of lactose utilization in lactic acid bacteria. | lactose utilization is the primary function of lactic acid bacteria used in industrial dairy fermentations. the mechanism by which lactose is transported determines largely the pathway for the hydrolysis of the internalized disaccharide and the fate of the glucose and galactose moieties. biochemical and genetic studies have indicated that lactose can be transported via phosphotransferase systems, transport systems dependent on atp binding cassette proteins, or secondary transport systems includi ... | 1994 | 7946468 |
| temporal transcription map of the lactococcus lactis bacteriophage sk1. | bacteriophage sk1 is a small isometric-headed lytic phage that infects lactococcus lactis. the phage has a linear double-stranded dna genome of 28 kbp, with cohesive ends. rna was prepared from phage-infected l. lactis cells harvested at various intervals after infection, and the rna molecules were resolved by electrophoresis. northern blots of these gels were hybridized with sk1 dna probes and the results obtained from these experiments, together with the results of primer extension analyses, e ... | 1994 | 7952177 |
| cloning and expression of the plasmid encoded beta-d-galactosidase gene from a lactobacillus plantarum strain of dairy origin. | the beta-galactosidase (beta-gal) gene from lactobacillus plantarum c3.8 was cloned and expressed in lactococcus lactis and escherichia coli. hybridization experiments indicated that the gene is located on a plasmid and is present in other strains of lactobacillus plantarum. its sequence is very similar to a leuconostoc lactis beta-gal gene. expression of the gene, both in lactobacillus plantarum and in lactococcus lactis, was four-fold higher in cells growth in lactose compared to those grown i ... | 1994 | 7958766 |