Publications

TitleAbstractYear
Filter
PMID(sorted ascending)
Filter
[longitudinal study of platelet function in infantile cortical hyperostosis]. 2004355995
[hb-antigen content in cryopreserved erythrocytes]. 2004356027
20 years investigations on cytochrome p-450. 2004356059
clinical significance of the 1-hour biopsy in renal transplantation.biopsy specimens were obtained from 43 transplanted kidneys at the time of excision from the donor but prior to revascularization, and 1 hr after revascularization. two independent laboratories evaluated specimens by immunofluorescent techniques for the presence of igm, iga, igg, c'3, and fibrin. results from the two laboratories examined for reproducibility and immunological specificity, and correlated with clinical course. results show that immunoglobulin deposition seen in the 1-hr renal biop ...1972356358
reduction of microbial contamination from ultrasonic scalers. 2004356863
phase ii clinical trial with high-dose methotrexate therapy and citrovorum factor rescue.one hundred and thirty-four patients with advanced malignant disease were treated with 496 infusions of high-dose methotrexate (hd-mtx) followed by citrovorum factor rescue. most patients had failed to respond to previous combination chemotherapy. the overall response rate was 29% with 33 partial responses and six complete responses observed in patients with a variety of tumors. plasma mtx levels were monitored in all patients during each course of therapy in order to identify those patients wit ...2004356984
[memory mechanisms in epileptogenesis]. 2004357016
cloning of chemically synthesized lactose operators. ii. ecori-linkered operators.a 40 base, mainly duplex dna segment, with the following sequence paattccacatgtggaattgtgagcggataacaatttgtt (3') ggtgtacaccttaacactcgcctattgttaaacaccttaap (5') has been synthesized by combination of chemical and enzymatic methods. it consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the ecori restriction endonuclease. this segment has been ligated into the pmb9 plasmid and the resulting operator ...1978357249
guinea pig homologues of tl and qa-2 antigens.the h-2, thymus-leukemia (tl), and qa-2 antigens of mice are encoded by closely linked genes on murine chromosome 17, and have structural similiarity in that each antigen is borne on a approximately 44,000 dalton molecule associated with beta2 microglobulin (beta2mu). the extensive homology of major histocompatibility complex (mhc) products that exists for the mouse and guinea pig suggested that a similar homology might exist for products of genetic regions closely linked to the mhc. by taking a ...1978357657
high-resolution 13c nuclear magnetic resonance studies of glucose metabolism in escherichia coli.high-resolution 13c nuclear magnetic resonance spectra of suspensions of escherichia coli cells have been obtained at 90.5 mhz by using the fourier transform mode. anaerobic cells incubated with [i-13c]glucose show a time course of glycolysis in which the alpha and beta glucose anomers disappear at different rates, lactate, succinate, acetate, alanine, and valine accumulate as end products of glycolysis, and fructose bisphosphate appears as an intermediate. it is shown that fructose bisphosphate ...1978358201
pesticin-dependent generation of somotically stable spheroplast-like structures.homogenous pesticin, a bacteriocin produced by yersinia pestis, promoted rapid dose-dependent killing of escherichia coli phi but permitted residual generation of cell mass. both growing cells and those blocked in net synthesis of nucleic acids or protein were converted by pesticin to osmotically stable spheroplast-like forms. morphology and viability of cells starved for fermentable carbohydrate were not affected by pesticin. similar spheroplast-like structures were formed from sensitive cells ...1978361722
[radiation therapy and the immune response of oncological patients]. 2004362108
murine models of tolerance induction in developing and mature b cells. 2004365709
[a new influenza subunit vaccine: hemagglutinating antibodies one year after vaccination (author's transl)].the antibody response to a new influenza subunit vaccine was compare d one year after vaccination with the responses induced by two other influenza vaccines. the subunit vaccine was given either in a high dose form containing 2100 iu, or in a low dose form containing 700 iu. as comparison a split vaccine was used containing 800 iu and ai(oh)3 as adjuvant and a whole virus vaccine containing 2100 iu. of the 399 vaccinated subjects which had taken part in this study 151 were available for hemagglu ...1978365774
[profile: yasuko higuchi who returned home after 14-year absence, having obtained a doctorate in the united states of america]. 2004368417
[e-antibodies in the sera of animals inoculated against plague and pseudotuberculosis]. 1978371269
[phage typing of rough e. coli strains isolated from urine (author's transl)].a differentiation of e. coli rough strains is generally not well established in bacteriological urine diagnosis although these strains are relatively often isolated from urine samples of patients with urinary tract infections (see table 2). an exact characterization of rough strains seems to be necessary especially for the distinction between recurrent and reinfection during therapy and follow-up studies. the application of phage typing for characterization of e. coli rough strains isolated from ...1978373321
[spontaneous respiration with constant positive pressure in the respiratory passages as a method of correcting respiratory insufficiency in children]. 2004373508
the preparation and characterization of a cell-free system from saccharomyces cerevisiae that translates natural messenger ribonucleic acid.a cell-free protein-synthesizing system has been prepared from saccharomyces cerevisiae by differential centrifugation of lysed spheroplasts. the preparation, a modified 100,000 x g supernatant fraction, contains ribosomes and monosomes, ribosomal subunits, translation factors, and aminoacyl-trna synthetases, but no polysomes. after removal of small amounts of remaining mrna with micrococcal nuclease, protein synthesis is stringently dependent on the addition of mrna, as well as amino acids and ...1979374404
odontophilately. 2004375143
isolation of trypanosoma cruzi from the blood of infected mice by column chromatography.trypomastogotes of three strains of trypanosoma cruzi were isolated from the blood of infected mice employing lymphoprep for separation of the red blood cells and a column of deae cellulose for removal of white cells and platelets. an average recovery of 45 to 58 percent of actively motile, infective organisms, free of contaminating blood cells was obtained. protein and carbohydrate assays of the separated organisms revealed significant differences between the tulahuen, a reticulotropic strain, ...1979375218
bacteriophage specificity in the identification of yersinia pestis as compared with other enterobacteria.bacteriophage typing of yersinia pestis and the specificity of the phage among enterobacteriaceae were investigated. the bacteriophage used for rapid identification of y. pestis reacted with representative strains of all recognized species of shigella as well as with salmonella cholerae-suis. reactive shigella serotypes were sh. dysenteriae 1 and 9, sh. flexneri 2a, sh. boydii 1 and 6, and sh. sonnei. patterns consisting of isolated plaques (two cases) or absence of plaques were observed when th ...1978375327
[bacteriophagy and bacteriocinogeny of yersinia enterocolitica]. 1979375639
preserving the exposed pulp: a review. 1970376823
[a recollection of a brilliant epidemiological success that occurred 25 years ago]. 1971377380
artificial reproduction of arthritis in calves by intubation of a virulent strain of mycoplasma mycoides subsp mycoides. 1979377780
[eye movements during reading]. 1969378096
[bactericidal action of formalin on the causative agent of plague].ten per cent neutral formalin in a ratio 1 : 20 was demonstrated to be useful as a desinfecting and fixing substance in pathohistological examinations of organs and tissues animals infected with the causative agent of plague. with test-objects' volume of 1.0 cm3 the optimal period of exposure providing a permanent bactericidal effect is 24 hours, with volumes of 1.5 and 2.0 cm3-2 days. the fixing effect of formalin on tissues is exerted in 3-4 days.1979378193
unusual pattern of nucleoside polyphosphate hydrolysis by the acid phosphatase (optimum ph = 2.5) of escherichia coli. 1979378222
[lidocaine prophylaxis in the pre-hospital phase of acute myocardial infarction (author's transl)].in a double blind study performed in cooperation with 69 emergency doctors and general practitioners in the catchment areas of the university and of the city hospital in lübeck the action of intramuscular lidocaine on mortality and on the incidence of arrhythmias was investigated in patients with acute myocardial infarction aged less than 70 years. the mortality in the lidocaine group was significantly lower than in the placebo group. the incidence of ventricular arrhythmias up to 120 minutes af ...2003378632
mode of action of pesticin: n-acetylglucosaminidase activity.homogeneous preparations of pesticin, a bacteriocin produced by yersinia pestis, neither significantly inhibited net synthesis of deoxyribonucleic acid, ribonucleic acid, or protein in escherichia coli phi nor caused detectable degradation of deoxyribonucleic acid in vivo. accordingly, its mode of action does not resemble that of colicin e2 as suggested by others. however, incorporation of cell wall-specific label ([14c]diaminopimelic acid) into trichloroacetic acid-insoluble material of growing ...1979378975
[anosmia and hypogonadism (kallman's or maestre de san juan's syndrome (author's transl)].a patient, aged 15 years and three months, with hypogonadism and anosmia (kallman's syndrome or maestre de san juan's syndrome) is presented. it is an sporadic case, with no associated abnormalities, who had been seen due to a lack of sexual development. basal levels of plasmatic lh and fsh were lower than the sensitivity threshold of the method: 1.5 mlu/ml. administration of 100 ng of gnrh alone in one dose did not evoke any change of these levels; when the same dosage was given during five con ...1972380425
pharmacological investigation on asclepin--a new cardenolide from asclepias curassavica. part ii. comparative studies on the inotropic and toxic effects of asclepin, g-strophantin, digoxin and digitoxin).the cardiac effects of asclepin, a new glycoside from the plant asclepias curassavica, were studies in vitro (isolated atrium and heart of guineapig) and in vivo (anaesthetized cat) and were compared with g-strophanthin, digoxin, digitoxin, or digitoxigenin, resp. asclepin showed a marked positive inotropic effect as evidenced by the increase in the force of contraction, measured by (dp/dt)max and (formula: see text). it was found to be more active than the other glycosides.1978380581
epidemiologic survey of sylvatic plague by serotesting coyote sentinels with enzyme immunoassay.the geographic distribution and areas of high sylvatic plague activity in california were verified by using coyotes (canis latrans) as sentinel animals. antibody levels against yersinia pestis were tested using the enzyme-labelled antibody (ela) test and the microtiter passive hemagglutination and hemagglutination inhibition. a survey using the ela test indicated that the overall antibody prevalence among 143 coyotes was 21%. by geographic regions, the highest antibody prevalence was 27% among c ...1979382839
site-specific recombination leading to the integration of phages p1 and p7. 1979385221
[60 years of work for the people's health]. 2004387245
mercury in the ottawa river. ottawa river project group. 2004387406
u.s. court stops hew's selection of intermediary. 1979387571
[nuclease-antibodies in infections with serratia marcescens (author's transl)].a total of 467 presumable healthy men of age eighteen yielded titres of anti-serratia-nuclease that ranged from 1:4 to 1:6. one third of 56 patients, who had been infected with serratia marcescens (urinary-, wound-, respiratory-infections, and bacteremia) yielded raised anti-nuclease titres, which amounted maximaly 1:16. the diagnostic utility of this serological test was discussed.1979387574
moorcroft: the first modern eye-surgeon in punjab. 2004387585
[comparative study of the diffusion in the gingival fluid and saliva of different antibiotics]. 2004387587
synthesis and properties of fluorescent nucleotide substrates for dna-dependent rna polymerases.a new class of fluorescent nucleotide analogs which contain the fluorophore 1-aminonaphthalene-5-sulfonate attached via a gamma-phosphoamidate bond has been synthesized. both the purine and pyrimidine analogs have fluorescence emission maxima at 460 nm. cleavage of the alpha-beta-phosphoryl bond produces change in both the absorption and fluorescence emission spectra. the fluorescence of the pyrimidine analogs is quenched; cleavage of the alpha-beta-phosphoryl bond of the utp analog produces abo ...1979387781
the association of var1 with the 38 s mitochondrial ribosomal subunit in yeast. 1979387793
christopher george attenborough 1922-1979. 2004387802
api and minitek systems in identification of clinical isolates of anaerobic gram-negative bacilli and clostridium species.a comparison of the api and minitek methods of biochemical testing was made on a variety of anaerobic bacteria. although api and minitek results were not compared to more standardized or conventional procedures of identification, multiple repeat testing of the two systems was done on routine clinical isolates and known organisms to determine (i) whether the reactions were reliably consistent, (ii) the ease of reading the two systems with respect to the frequency of questionable results, and (iii ...1979387809
primary plate identification of group a beta-hemolytic streptococci utilizing a two-disk technique.a two-disk system is described which allows primary plate identification of group a beta-hemolytic streptococci. group a beta-hemolytic streptococci could be visualized on primary throat culture plates by using trimethoprim-sulfamethoxazole to inhibit normal flora. in the heavily inoculated area of trypticase soy agar plates containing 5% sheep blood, a 25-microgram/ml trimethoprim-sulfamethoxazole disk was placed contiguous to a 0.04-u bacitracin disk. a total of 259 throat specimens were exami ...1979387811
metabolism of arachidonic acid in ionophore-stimulated neutrophils. esterification of a hydroxylated metabolite into phospholipids.[14c]arachidonic acid incubated with human neutrophils was esterified into phospholipids and triglycerides. stimulation of these labeled neutrophils with ionophore a23187 (2 microm) results in release of [14c]arachidonate from phospholipid and its metabolism to prostaglandin e2 and 5-hydroxy-6,8,11,14-eicosatetraenoic acid (5-hete), a lipoxygenase product. the released arachidonate is also metabolized to a polar lipid of unknown composition here disignated compound a. 5-hete was found to be rele ...1979387819
effects of neomycin alone and in combination with cholestyramine on serum cholesterol and fecal steroids in hypercholesterolemic subjects.effects of neomycin were studied on serum cholesterol and fecal steroids in hypercholesterolemic patients during a short treatment period (4 wk) and a long treatment period (16 mo), using small (1.5 g/d) and large (up to 6 g/d) doses alone and in combination with cholestyramine. in the short-term low-dose study the decrease in serum cholesterol by 21% was associated with a proportionate increase in fecal cholesterol elimination as neutral sterols through impaired cholesterol absorption. serum ch ...2004387820
ada honors dr. lynch, bestows 7 honorary memberships. 2004387851
serum opsonic activity in rodent malaria: functional and immunochemical characteristics in vitro.the functional and immunochemical characteristics of serum opsonic activity in rodent malaria were examined in the present study. schizont- and late trophozoite-enriched populations of plasmodium berghei-infected red blood cells (irbc) were isolated on a ficoll density-gradient and used in an in vitro phagocytosis system composed of serum and monolayer cultures of rat peritoneal macrophages. hyperimmune serum augmented the phagocytosis of irbc to a greater degree than did nonimmune serum. when e ...1979387873
[inductions of adjuvant arthritis in rats and footpad swelling reaction in mice by injection with the purified cell wall fraction from in vitro grown mycobacterium lepraemurium hawaii (author's transl)]. 1979389918
human plasma angiotensinogen: a review of purification procedures.the current status of the purification and characterization of human angiotensinogen is reviewed. one problem encountered in the past has been the copurification of a protein with similar porperties. this protein has tentatively been designated alanine-protein. an efficient separation of angiotensinogen and alanine-protein was obtained on a zinc chelate column. alanine-protein has been purified and its amino acid and carbohydrate composition determined. the cooh-terminal amino acid and the nh2-t ...1979390363
[properties of plague microbe revertants obtained from l forms]. 1979390929
isolation of pathogens other than yersinia pestis during plague investigations.from 1975 to 1978, 37 isolates of pasteurella multocida, 1 of salmonella enteriditis, and 5 of francisella tularensis were recovered from 42 mammalian specimens and 1 flea pool submitted for examination for evidence of infection with yersinia pestis. most of the specimens were collected during investigations of either a human plague infection or a reported epizootic among rodent populations. all specimens were of species regularly or occasionally involved in plague or tularemia cycles in nature ...1979392123
lung compliance and lung morphology following artificial ventilation in the premature and full-term rabbit neonate.rabbit neonates delivered on day 27--30 of gestation were subjected to intermittent positive pressure ventilation (ippv) for 60 min. tidal volume was standardized to 10 ml/kg, and the insufflation pressure required to maintain this tidal volume was recorded. the quasistatic compliance of the lung-thorax system, corrected for variations in body weight, was significantly lower in animals delivered on day 27--28 than in those delivered on day 29--30. immature animals with low lung-thorax complianc ...1979394314
the classic. recurrent dislocation of the patella: operative treatment. 1994394898
memoir of robert henry ivy 1881-1974. 2004395739
[20th anniversary society of physiotherapists and health resort specialists of the ukrainian republic]. 2004395753
[the molecular biology of aging -- 15: structure and function of the genetic apparatus in aging. ii. synthesis and metabolism of rna].with aging in different organs there are similar or tissue specific changes of the ribonucleic acids in respect of the quantity, the spectrum of different rna species and the metabolism of rna. among these processes the template function of the chromatin and the behaviour of the rna polymerases are important influencing factors. in aging the sensitivity of the rna synthesis against hormonal stimulation is decreased in the most cases. a survey about the results of many in vivo and in vitro experi ...1979395770
[low-molecular weight nuclear rna's]. 2004395786
[1st orthopedic textbook of the world for the use of the physician. on the 200th anniversary of the birth of johann christian gottfried jörg]. 2004395945
genetic modification of macrophage functions in relation to antibody responsiveness and resistance to infection. 1979397751
[morphofunctional requirements of upper and lower denture base in complete dentures. impression technic]. 2004400636
[periodontal factors in fixed partial dentures]. 2004400637
immunity in plague: protection of the vervet (cercopithecus aethips) against pneumonic plague by the oral administration of live attenuated yersinia pestis.protection against pneumonic plague by the oral administration of a live, attenuated yersinia pestis vaccine, ev76 (paris) f, was evaluated in the vervet (cercopithecus aethips). six animals were vaccinated with a dose of 1.175 x 10(9) colony-forming units (cfu); all tolerated the dose and developed antibodies to fraction i of y. pestis. three immunized animals were challenged with an inhaled dose of 3.2 x 10(6) cfu (160 ld50 [50% lethal dose]) of virulent y. pestis strain 195/p and two survived ...1977402428
[toxicity of bacterial polysaccharides (a review of the literature)]. 1977402887
aging and the visceral musculature of the adult fruitfly: an ultrastructural investigation. 2003403646
the role of cellular locomotion in leukemic infiltration. an organ culture study on penetration of l 5222 rat leukemia cells into the chick embryo mesonephros.the significance of cellular locomotion for leukemic infiltration was investigated using l 5222 rat leukemia cells. previous cinemicrographic studies have shown that these cells are able to locomote only after formation of a uropod-like posterior extension. this characteristic locomotive configuration of l 5222 cells is easily recognizable in scanning electron micrographs and appropriate sections. leukemia cells were inoculated on slices of chick embryo mesonephros incubated for 24h; at this tim ...1977403674
postoperative platelet function in patients on small subcutaneous doses of heparin.several platelet function tests were performed on 31 patients undergoing major operations, who recieved prophylactically small subcutaneous doses of heparin. a group of 15 similar patients without heparin served as controls. it was found that postoperatively in both groups (a) the platelet retention in glass bead column was significantly increased (p less than 0.001), (b) the platelet aggregation by adp 1 micronm was slightly increased, (c) the collagen-induced aggregation, adp release and the b ...2003403731
marijuana: pro and con. 2003403763
[trial selection of 2 sub-strains of nzb mice based on the level of chromosome aberrations].increased chromosomal breakage is observed in nzb mice. breeding experiments with mice selected according to breakage frequencies provide evidence that the proportion of animals with high and low breakage figures in the first and second generation progeny depends on the phenotype of the parents.2004404059
treatment of diabetic ketoacidosis with continuous infusion of insulin. 2004404413
the myelodysplasia and hydrocephalus program in nebraska: a 15 year review of costs and benefits. 2004412114
complex of iga1-lambda paraprotein and albumin.the complex of iga1-lambda paraprotein and albumin was analysed and its pattern was demonstrated in electrophoresis, immunoelectrophoresis, gel filtration and sedimentation analysis.2004412116
significance of animal play. 2004412172
skin lesions in acquired zinc deficiency due to parenteral nutrition.the skin lesions seen in 10 patients who received parenteral nutrition during treatment of chronic enteropathy are described. all of these patients had a lowered serum zinc concentration. the skin lesions were similar to those seen in acrodermatitis enteropathica. after supplementation with zinc sulphate, the skin lesions disappeared completely. a decrease in the serum alkaline phosphatase level can be regarded as a sign of an impending zinc deficiency. parenteral nutrition formulae should conta ...1974414940
analysis of rna and protein synthesis in temperature-sensitive mutants of tetrahymena pyriformis. 1975415226
identifying electrical hazards and implementing safety measures--the theatre nurse's role. 2004415720
nature of collagens synthesized by monkey periodontal-ligament fibroblasts in vitro.1. first subcultures of fibroblast-like cells from adult monkey periodontal ligament were incubated in the presence of 14c-labelled amino acids and produced significant amounts of type-i and type-iii collagens. 2. the proportion of type-iii collagen produced was calculated on the basis of the recovery of procollagens from deae-cellulose chromatography to be approx. 20%, and at least 10% when analysed as collagens on cm-cellulose chromatography. 3. sodium dodecyl sulphate/polyacrylamide-gel elect ...1978415740
amino acid degrading enzymes for cancer therapy.the development of microbial enzymes for cancer therapy presents difficulties not commonly experienced with biological drugs. the development of the enzyme asparaginase from escherichia coli in the usa and of the serologically different asparaginase from the plant pathogen erwinia carotovora in this establishment, has not only added to the choice of antileukaemia drugs but also provided a valuable guide to the selection and development of new therapeutic enzymes. our own programme has led to the ...1977415922
effect of atropine on cerebrovascular responsiveness to carbon dioxide.effects of cholinergic inhibition by atropine on cerebral circulation were studied in 15 baboons anesthetized with sodium pentobarbital. intravertebral infusion of atropine, 0.1 mg/kg, did not cause any changes in cerebral blood flow (cbf), superior sagittal sinus wedge pressure (sswp), epidural pressure (edp), cerebral perfusion pressure, or cerebral vascular resistance under normal conditions. cerebrovascular responsiveness to carbon dioxide (co2) inhalation was not influenced by atropine. the ...1971416181
development of a pulmonary technique to assess inhaled bronchoactive agents in the conscious rhesus monkey. 1978416200
[profile of a nurse. ms. seiko tateyama, president, akita nursing association, who has started the campaign for not accepting gifts from patients]. 1971416268
[the simultaneous determination of 125j-hippuran and 51cr-edta clearance in children]. 2004416462
[detection of ovulation by changes in the color in the cervical mucus]. 2004416471
[conservative management of postmastectomy lymphedema]. 2004419468
[gastroduodenal fistula]. 2004419609
[carbon polymer stomata in vesicostomy and other urinary diversion procedures (author's transl)].implants of pure carbon are ideal for prosteses because of their tissue acceptability and lack of incrustation. animal experiments with biocarbon implants were tested as subfascial implantations, coeco-, ileo-, and vesicostomies, (n = 37). the results showed lack of reaction and good healing of the stomata, lack of incrustation, and water tight urinary diversion. based on these animal experiments biocarbon vesicostomies were carried out successfully in six patients. the follow up period was 3--1 ...1979419640
[an aid to the improvement of living conditions for the metally retarded in permanent facilities]. 2004419781
operation of the coconut fiber/burnt rice husks filter for supplying drinking water to rural communities in southeast asia. 2003420360
the role of the epididymis in descensus testis and the topographical relationship between the testis and epididymis from the sixth month of pregnancy until immediately after birth.the position of the testis, the relationship between the epididymis and the testis, as well as the development and regression of the gubernaculum were investigated in 18 testicles of children from the 26th week of pregnancy until a few weeks after birth. the most important role in descensus testiculorum is ascribed to the differentiation of the epididymis and the ductus deferens. it is androgen dependent. the testis descends in the processus vaginalis, being attached to its dorsal wall.2004420407
localized fibrous "mesothelioma" of pleura (submesothelial fibroma): a clinicopathologic study of 18 cases.eighteen cases of solid fibrous tumors of the visceral pleura are studied. the series includes neoplasms of various sizes removed during the last 17 years at the mount sinai hospital. most tumors showed consistent gross and light microscopic features, such as encapsulation, preservation of pedicle, origin from visceral pleura, predominance of spindle cells with more or less hyalinized stroma, little or no pleomorphism or mitotic activity and no infiltration of the underlying lung. no sex predomi ...1977421185
n-nitrosamines in the diet of experimental animals. 1977421197
allergic reactions to benzalkonium chloride. 1977421467
legionnaires' disease presenting with empyema.legionnaire's disease presenting as empyema has not been previously described, although pleural effusions are not uncommon. a 56-year-old woman had a ten-day history of pleuritic chest pain and a large loculated empyema. legionnaires' disease was documented by serum indirect fluorescent antibody studies.2004421592
fiberoptic bronchoscopy in pulmonary abscess. 2004421596
[treatment of trochanteric fractures by means of intramedullary nailing from the distal metaphysis]. 2004421608
[stable and compressions osteosynthesis by means of osteo plates in the treatment of mandibular fractures]. 2004421610
the in vivo radiation response of an experimental tumor: the effect of exposing tumor-bearing mice to a reduced oxygen environment prior to but not during irradiation. 1972422416
what is your diagnosis? 1979422469
Displaying items 901 - 1000 of 10897