Publications

TitleAbstractYear
Filter
PMID
Filter
[molecular characterization of coxsackievirus b3 isolated from an outbreak of aseptic meningitis in shandong province, china].to identify the pathogen caused an outbreak of aseptic meningitis in tancheng county of shandong province in 2008, and to analyze the molecular characterization of vp1 gene of the coxsackievirus b3(cvb3) isolates.200920718355
complete genome sequence of a coxsackievirus b3 recombinant isolated from an aseptic meningitis outbreak in eastern china.coxsackievirus b3 (cv-b3) has frequently been associated with aseptic meningitis outbreaks in china. to identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08tc170, a representative strain isolated from cerebrospinal fluid (csf) samples from an outbreak in shandong in 2008, was determined, and the coding regions for p1-p3 and vp1 were aligned. the first 21 and last 20 residues were "ttaaaacagcctgtgggttgt" and "attctccgcattcggtgcgg", ...201627236460
environmental surveillance of human enteroviruses in shandong province, china, 2008 to 2012: serotypes, temporal fluctuation, and molecular epidemiology.environmental surveillance is an effective approach in investigating the circulation of polioviruses (pvs) and other human enteroviruses (evs) in the population. the present report describes the results of environmental surveillance conducted in shandong province, china, from 2008 to 2012. a total of 129 sewage samples were collected, and 168 pvs and 1,007 nonpolio enteroviruses (npevs) were isolated. vp1 sequencing and typing were performed on all isolates. all pv strains were sabin-like, with ...201424837389
recombinant human coxsackievirus b3 from children with acute myocarditis in china.recombination events were found in two human coxsackievirus b3 strains, beijing0811 and sd2012chn. the strains were isolated separately from five newborns diagnosed with severe hospital-acquired acute myocarditis in beijing in 2008 and from two children diagnosed with hand, foot, and mouth disease with concurrent acute myocarditis in shandong in 2012.201323804378
coxsackievirus b3, shandong province, china, 1990-2010.to determine the cause of a 2008 outbreak of aseptic meningitis in shandong province, china, we analyzed samples from outbreak patients and coxsackievirus b3 samples collected during 1990-2010 surveillance. the cause of the outbreak was coxsackievirus b3, genogroup d. frequent travel might increase importation of other coxsackievirus b3 genogroups.201223092737
Displaying items 1 - 5 of 5