Publications

TitleAbstractYear
Filter
PMID
Filter
etiology of multiple non-ev71 and non-cva16 enteroviruses associated with hand, foot and mouth disease in jinan, china, 2009-june 2013.hand, foot, and mouth disease (hfmd) is an infectious disease caused by human enterovirus 71 (ev71), coxsackievirus a16 (cva16) and other enteroviruses. it is of interest that other enteroviruses associated with hfmd in jinan have been rarely reported. the aim of the present study is to detect and characterize the circulating serotypes of non-ev71 and non-cva16 enteroviruses associated with hfmd in jinan city, shandong province, china. a total of 400 specimens were collected from clinically diag ...201526562154
seroprevalence of enterovirus a71 and coxsackievirus a16 in healthy people in shandong province, china.hand, foot, and mouth disease has become very common in mainland of china in recent years, and enterovirus a71 and coxsackievirus a16 are its major etiologic factors. here we investigated the seroprevalence of enterovirus a71 and coxsackievirus a16 based on a large group of healthy individuals in shandong province, china.201627611441
[identification and genetic characterization of coxsackievirus a24 isolated from patients with acute hemorrhagic conjunctivitis in shandong province].to identify the pathogen of acute hemorrhagic conjunctivitis (ahc) in shandong province in 2010, eye mucous swab samples were collected from 26 patients in qingdao and linyi city. real time-pcr assays for ev70, cva24 and adenovirus were performed on these samples. the result showed 17 samples (65.39%) were cva24 positive while all the samples for hev70 and adenovirus detection were negative, which implied that cva24 was the causative pathogen of this outbreak. a total of 10 virus strains isolate ...201223367567
[epidemiology of hand, foot, and mouth disease and genetic characterization of enterovirus a71: a survey from 2007 to 2012 in linyi of shandong province, china].to investigate the epidemiology of hand, foot, and mouth disease (hfmd) and the genetic characteristics of enterovirus a71 (ev-a71) in linyi of shandong province, china during 2007-2012. the number of reported hfmd cases were obtained from the national notifiable disease reporting system (nndrs) were analyzed by descriptive epidemiology method; the vp1 region of ev-a71 isolated from hfmd patients in linyi was amplified and sequenced. finally, the genetic variability and phylogenecity of vp1 sequ ...201425118378
[investigation of a patient with pre-vaccine-derived poliovirus in shandong province, china].to analyze the genetic characteristics of a polio-i highly variant vaccine recombinant virus in shandong province (china) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (afp) and 40 stool specimens from his contacts were collected for virus isolation. the complete genome of poliovirus and vp1 coding region of the non-polio enterovirus were sequenced. homologous comparison and phylogenetic analyses based on vp1 sequences w ...201526738293
an outbreak of aseptic meningitis caused by a distinct lineage of coxsackievirus b5 in china.in 2009, an outbreak of aseptic meningitis caused by coxsackievirus b5 (cvb5) occurred in china. epidemiological investigations of this outbreak revealed that the proportion of severe cases (14/43, 33%) was higher than in other outbreaks associated with cvb5 in china. phylogenetic analysis of the entire vp1 sequences demonstrated that the cvb5 isolates from the severe cases form a distinct lineage belonging to genogroup e with the shandong isolates of 2009. a substitution of serine (s) to aspara ...201424747088
a coxsackievirus b5-associated aseptic meningitis outbreak in shandong province, china in 2009.in 2009, a major outbreak of aseptic meningitis was noted in linyi city, shandong province, china. from june to september 2009, a total of 2,104 cases were involved in this outbreak, and 98.6% of patients were <16 years of age. to determine the pathogen of the outbreak, 42 cerebrospinal fluid specimens collected from aseptic meningitis cases were tested for cell culture, and 17 (40.5%) enteroviruses were isolated and identified as coxsackievirus b5 (cvb5). homologous comparison indicated that th ...201323212939
[molecular characterization of coxsackievirus b3 isolated from an outbreak of aseptic meningitis in shandong province, china].to identify the pathogen caused an outbreak of aseptic meningitis in tancheng county of shandong province in 2008, and to analyze the molecular characterization of vp1 gene of the coxsackievirus b3(cvb3) isolates.200920718355
recombinant human coxsackievirus b3 from children with acute myocarditis in china.recombination events were found in two human coxsackievirus b3 strains, beijing0811 and sd2012chn. the strains were isolated separately from five newborns diagnosed with severe hospital-acquired acute myocarditis in beijing in 2008 and from two children diagnosed with hand, foot, and mouth disease with concurrent acute myocarditis in shandong in 2012.201323804378
multiple transmission chains of coxsackievirus a4 co-circulating in china and neighboring countries in recent years: phylogenetic and spatiotemporal analyses based on virological surveillance.coxsackievirus a4 (cv-a4) has been reported frequently in association with many infectious diseases and cases of hand, foot, and mouth disease potentially associated with cv-a4 infection are also identified. this study summarized the shandong cv-a4 strains isolated from 25years acute flaccid paralysis surveillance, with an emphasis on exploring the phylogenetic analyses and spatiotemporal dynamics of cv-a4 at the global scale. we sampled 43 cv-a4 isolates and utilized vp1 gene to construct phylo ...201828942015
coxsackievirus b3, shandong province, china, 1990-2010.to determine the cause of a 2008 outbreak of aseptic meningitis in shandong province, china, we analyzed samples from outbreak patients and coxsackievirus b3 samples collected during 1990-2010 surveillance. the cause of the outbreak was coxsackievirus b3, genogroup d. frequent travel might increase importation of other coxsackievirus b3 genogroups.201223092737
analysis of enterovirus types in patients with symptoms of aseptic meningitis in 2014 in shandong, china.we reviewed the epidemiological and clinical characteristics of 927 aseptic meningitis patients in shandong in 2014, and the phylogeny of predominant enterovirus (ev) types causing this disease was analyzed. a total of 209 patients that were positive for ev were identified by both cell culture and a reverse transcription-seminested pcr in cerebrospinal fluid samples. the positive patients were most likely to be children within 15 years of age, had symptoms such as fever, vomiting and nausea (p< ...201829407377
[molecular-biological identification of pathogens which caused an outbreak of viral encephalitis in jinan area].to investigate the etiology of the outbreak of viral encephalitis in jinan area in 2003.200718322587
molecular characterization of coxsackievirus a21 in shandong, china.coxsackievirus a21 (cv-a21) is a rarely detected serotype belonging to the species enterovirus c (ev-c). in this study, we report the isolation and genetic characterization of cv-a21 in shandong province, china, during 1997 to 2013. a total of 13 strains were obtained from surveillance of cases of acute flaccid paralysis (afp) (n = 9) and from environmental sewage (n = 4). sequence comparison of the vp1 genes revealed high nucleotide sequence similarity (94.1 % to 99.8 % identity) among these sh ...201626563316
environmental surveillance of human enteroviruses in shandong province, china, 2008 to 2012: serotypes, temporal fluctuation, and molecular epidemiology.environmental surveillance is an effective approach in investigating the circulation of polioviruses (pvs) and other human enteroviruses (evs) in the population. the present report describes the results of environmental surveillance conducted in shandong province, china, from 2008 to 2012. a total of 129 sewage samples were collected, and 168 pvs and 1,007 nonpolio enteroviruses (npevs) were isolated. vp1 sequencing and typing were performed on all isolates. all pv strains were sabin-like, with ...201424837389
molecular epidemiology of human enterovirus associated with aseptic meningitis in shandong province, china, 2006-2012.human enteroviruses (hevs) are common causes of acute meningitis. however, there is limited information about hev associated with aseptic meningitis in mainland china because it has not been classified as a notifiable disease.201424587020
non-polio enteroviruses from acute flaccid paralysis surveillance in shandong province, china, 1988-2013.enteroviruses (evs) are important human pathogens associated with various clinical syndromes. this study represents an overview of non-polio enteroviruses (npevs) isolated from acute flaccid paralysis (afp) surveillance in shandong province, china from 1988 to 2013. altogether 792 and 170 npev isolates were isolated from stool specimens of 9263 afp cases and 1059 contacts, respectively. complete vp1 sequencing and typing on all 962 isolates revealed 53 npev types in which echovirus (e) 6 (7.6%), ...201425145609
[identification and genetic characterization of coxsackieviruses a2, 6, 8 and 12 isolated in shandong province].in previous study, molecular typing method was performed to identify human enteroviruses (hevs) isolates collected from acute flaccid paralysis (afp) cases from 1989 to 2011 and hand, foot and mouth disease (hfmd) patients, and 8 hev-a serotypes were identified. in order to explore the genotypes and molecular evolution characteristics of hev-a in shandong province, viral rna of the remaining isolates was extracted and entire vp1 coding region was amplified, sequenced and identified with hev-a pr ...201223233927
complete genome sequence of a coxsackievirus b3 recombinant isolated from an aseptic meningitis outbreak in eastern china.coxsackievirus b3 (cv-b3) has frequently been associated with aseptic meningitis outbreaks in china. to identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08tc170, a representative strain isolated from cerebrospinal fluid (csf) samples from an outbreak in shandong in 2008, was determined, and the coding regions for p1-p3 and vp1 were aligned. the first 21 and last 20 residues were "ttaaaacagcctgtgggttgt" and "attctccgcattcggtgcgg", ...201627236460
[genotype distribution of enterovirus group b isolated in shandong province, china].in order to explore the genotype distribution of human enterovirus group b (hev-b) in shandong province and to study the correlation between hev-b serotypes and disease outbreaks, we sequenced and analyzed the entire vp1 coding region of hev-b isolated from acute flaccid parolysis (afp) system and disease outbreaks in shandong province during 1998-2008. all together twenty nine hev-b serotypes were identified, including twenty echovirus (echo) serotypes, five coxsackievirus b (cvb1-5) serotypes, ...201021043134
molecular characterization of enteroviruses including a new type ev-c99 isolated from xinjiang students in shandong, china in 2011.the last case of infection with wild-type poliovirus indigenous to china was reported in 1994. in 2011, a poliomyelitis outbreak caused by imported wide-type poliovirus occurred in xinjiang uighur autonomous region. here, we report the results of enterovirus (ev) isolation from xinjiang students that returned to school in shandong after summer vacation during this outbreak. stool specimens from 376 students were collected and 10 ev strains were isolated including 4 polioviruses (all sabin strain ...201425298041
epidemiological characterizations, pathogen spectrum and molecular characteristics of coxsackievirus a16 from patients with hfmd in yantai, shandong, china between 2011 and 2015.this study aimed to investigate the epidemiological characterizations and pathogen spectrum of hand, foot, and mouth disease (hfmd) in yantai city, shandong province, china, during 2011-2015, and to study the nucleotide evolution and amino acid variation of coxsackievirus a16 (cv-a16) epidemic strains that caused hfmd. the hfmd epidemic began to rise in march, and became prevalent from may to august, reached its peak in june, and then declined in september every year, children aged one to 5 year ...201728537484
Displaying items 1 - 22 of 22