| use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gc. | the genome of varicella-zoster virus (vzv) encodes at least three major glycoprotein genes. among viral gene products, the gc gene products are the most abundant glycoproteins and induce a substantial humoral immune response (keller et al., j. virol. 52:293-297, 1984). we utilized two independent approaches to map the gc gene. small fragments of randomly digested vzv dna were inserted into a bacterial expression vector. bacterial colonies transformed by this vector library were screened serologi ... | 1985 | 2981365 |
| distribution of g + c-rich regions in varicella-zoster virus dna. | the distribution of g + c-rich sequences in the genome of varicella-zoster virus (vzv) was investigated by partial denaturation, equilibrium sedimentation and southern blot analyses. portions of the irs and trs repeat sequences bounding the us region of the dna were found to have a g + c content 10 to 20% greater than the overall 47% g + c content of the vzv genome. a stretch of dna (approx. 1500 base pairs) at the ul-irs junction and repeated at the terminus of the trs sequences was found to be ... | 1985 | 2981960 |
| immunochemical characterization of pyrimidine kinase induced by varicella-zoster virus. | thymidine kinase (tk) induced by varicella-zoster virus (vzv) was precipitated with ammonium sulphate and purified by sephadex g-150, qae-sephadex and blue sepharose column chromatographies. the purified tk fraction also contained deoxycytidine kinase (dck) activity and a 35000 mol. wt. (35k) polypeptide as a major component. the tk and dck activities were both neutralized by anti-vzv serum. antiserum to an extract of cells infected with a bromodeoxyuridine (budr)-resistant mutant virus containe ... | 1985 | 2981965 |
| herpes zoster following varicella vaccine in a child with acute lymphocytic leukemia. | | 1985 | 2982006 |
| structural analysis of the varicella-zoster virus gp98-gp62 complex: posttranslational addition of n-linked and o-linked oligosaccharide moieties. | varicella-zoster virus specifies the formation of several glycoproteins, including the preponderant gp98-gp62 glycoprotein complex in the outer membranes of virus-infected cells. these viral glycoproteins are recognized and precipitated by a previously described monoclonal antibody designated monoclone 3b3. when an immunoblot analysis was performed, only gp98 was reactive with monoclone 3b3 antibody; likewise, titration in the presence of increased concentrations of sodium dodecyl sulfate during ... | 1985 | 2983087 |
| long-term protective immunity of recipients of the oka strain of live varicella vaccine. | in spite of close contacts with patients who had varicella, 101 of 106 (95%) healthy and sick children (142 of 147 (97%) exposures of these children) who had received the oka strain of live varicella vaccine 7 to 10 years earlier were protected against the disease completely. among them, 37 of 38 (97%) vaccine recipients who received immunologic testing had varicella-zoster virus (vzv) antibodies tested by fluorescent antibody to membrane antigen method with a geometric mean titer of 1:9.3, and ... | 1985 | 2984636 |
| use of sonication for viral isolation. | a viral passage method using sonication to obtain cell-free virus was compared with the conventional viral cell culture passage technic. the recovery of 121 varicella zoster virus and cytomegalovirus isolates in human fibroblast vials from sonicated versus nonsonicated passage suspensions was studied. these fibroblast vials with cytopathic effect were identified using monoclonal fluorescent antisera. twenty-eight (29%) of cytomegalovirus isolates were recovered only from sonicated passages, and ... | 1985 | 2984919 |
| herpes simplex virus vaccines--where are we? | | 1985 | 2985314 |
| fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus dna. | a strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (vzv) dna was found to be due to an insertion or deletion of dna sequences at a single site. dna sequence analysis showed that the nucleotide sequence ccgccgatggggagggggcgcggtacc is tandemly duplicated a variable number of times in different vzv strains and is responsible for the observed variation in mobilities of restriction fragments from this region of vzv dna. the variable ... | 1985 | 2985828 |
| [herpes simplex and varicella-zona viral disorders. virologic review]. | | 1985 | 2986294 |
| the significance of specific iga antibodies in the serum in the early diagnosis of zoster. | | 1985 | 2989386 |
| intrathecal synthesis of igg antibodies to varicella-zoster virus in two cases of acute aseptic meningitis syndrome with no cutaneous lesions. | igg antibodies to varicella-zoster virus (vzv) were detected by indirect enzyme-immunoassay (eia) in csf of two patients with acute aseptic meningitis syndrome (aams) not associated with evident cutaneous lesion or recent history of zoster infection. their characteristic features and serological data are compared with those observed in two patients with aams and zoster cutaneous lesions, and in 13 patients with aams of unknown or other etiology. according to several indexes applied to assess the ... | 1985 | 2989422 |
| varicella-zoster virus envelope glycoproteins: biochemical characterization and identification in clinical material. | varicella-zoster virus (vzv)-infected human foreskin fibroblasts synthesize viral glycoproteins of 125,000 (gp125), 118,000 (gp118), 92,000 (gp92), 63,000 (gp63), 59,000 (gp59), and 47,000 (gp47) da. in biochemical studies, all of these vzv glycoproteins were shown to contain asparagine-linked (n-linked) oligosaccharide chains and, except for gp125 and gp47, to be sialoglycoproteins. experiments with endo-beta-n-acetylglucosaminidase h (endo h) demonstrated that gp92 contained only complex type ... | 1985 | 2990103 |
| prevention and control of herpesvirus diseases. part 1. clinical and laboratory diagnosis and chemotherapy. a who meeting. | the herpesvirus diseases are increasing in importance as a public health problem throughout the world. members of the human herpesvirus family are global in distribution and infect 60-95% of the world's population, both in developed and in developing countries. illnesses associated with herpesviral infections vary from simple blisters to deadly encephalitis. in numerical terms, primary cytomegalovirus infection is a more common cause of congenitally acquired disease than primary rubella and resu ... | 1985 | 2990748 |
| immunity to varicella-zoster virus in a normal adult population. | sera from 489 trainee nurses were examined, by the elisa technique, for the presence of varicella-zoster virus specific antibody; antibody was found in 446 (91.2%). in more detailed investigations of specific immunity in 33 healthy adults with a past history of chickenpox, 32 (97%) showed a positive lymphocyte transformation test, but only 11 out of 23 examined (48%) demonstrated mononuclear cell production of specific antibody in vitro; serum antibody was found in 30 (91%) by the elisa and in 2 ... | 1985 | 2991523 |
| human monoclonal antibodies neutralizing varicella-zoster virus. | hybridomas secreting human monoclonal antibodies to varicella-zoster virus were produced by fusing b cells of a patient recovering from acute varicella infection with a human-mouse cell line. two hybrid lines have continued to secrete igg1, one with kappa and the other with lambda chains, for at least 12 months. each antibody neutralizes virus infectivity between 1-5 micrograms of partially purified immunoglobulin/ml, each shows a different pattern of immunofluorescent staining of virus-infected ... | 1985 | 2993433 |
| effect of cyclosporin a on natural killer cells' response during viral infections. | in the this study the modification of lymphocyte subsets (t3, t4, t8) and natural killer (nk) cells in organ transplanted patients treated with cyclosporin a (cya) in the course of viral infection, have been analyzed. different subsets have been studied with the monoclonal antibody method and infective processes have been verified by serological data of seroconversion. our study has shown that cya at the adopted doses does not alter nk response to viral infection; in fact, in patients with seroc ... | 1985 | 2993825 |
| t lymphocyte responses to coxsackie b4 and mumps virus. i. influence of hla-dr restriction elements. | the proliferative t lymphocyte responses to coxsackie b4-, mumps- and varicella-zoster viral antigens were characterized. no significant difference in responsiveness was found between healthy individuals and patients with type 1 (insulin-dependent) diabetes mellitus. theophyllamine and verapamil decreased antigen-stimulated proliferation, whereas indomethacin in physiologic concentrations (1 microgram/ml) slightly increased proliferation. a major part of the response seemed to be restricted by h ... | 1985 | 2994251 |
| [sero-epidemiological results in subjects receiving a renal transplant]. | in this study a sero-epidemiological investigation on 127 renal allograft recipients was examined. in these patients, treated with cyclosporine a or conventional drugs, antibody response to various antigens (cytomegalovirus, herpes simplex, varicellae/zoster and mycoplasma pneumoniae) was examined. the data were compared to the healthy population and dialyzed subjects. | 1985 | 2994693 |
| determination of immunity to varicella-zoster virus by means of an intradermal skin test. | an intradermal varicella skin test, utilizing heat-inactivated noninfectious viral antigen, was evaluated in 16 adults known to be immune or susceptible to varicella and in 109 adults with no history of varicella. the skin test was well tolerated, compared favorably with established methods of determining immunity to varicella, and accurately predicted which subjects would develop clinical varicella after close exposure. | 1985 | 2995511 |
| live oka/merck varicella vaccine in healthy children. further clinical and laboratory assessment. | a clinical trial among 137 healthy children, ages 1 to 12 years, was conducted with four different doses (4,350, 870, 435, and 43 plaque-forming units [pfu]) of live oka/merck varicella vaccine to evaluate clinical reactions and selected laboratory parameters and to determine the minimum effective dose and induction time of antibody. the vaccine was well tolerated with no significant difference in the rate of reported symptoms by dose. the frequency of varicellalike rash was 3% (4/137); all rash ... | 1985 | 2995697 |
| interaction between polymorphonuclear leukocytes and varicella-zoster virus-infected cells. | the addition of polymorphonuclear leukocytes (pmnl) to human fibroblasts infected with varicella-zoster virus (vzv) resulted in a reduced virus yield. the reduction was greater when antibodies specific for vzv were added to the system. addition of vzv-specific antibodies without pmnl also reduced virus yield, but a 10-fold greater concentration of antibodies was required to effect the same reduction. pmnl adhered to and formed rosettes around vzv-infected cells. by electron microscopy, it was po ... | 1985 | 2997077 |
| immunological cross-reactivities among three herpesviruses. | sixty adults were tested for humoral and cell-mediated immunity to varicella zoster virus (vzv), type 1 herpes simplex virus (hsv-1) and the human cytomegalovirus (cmv). since herpesviruses share common antigens, we compared results in these individuals to assess whether our tests gave false positives due to cross-reactions. of the 60, igg antibody to vzv, hsv-1, cmv tested by elisa was detected in 51 (85%), 34 (57%) and 20 (33%) respectively. all possible permutations of results were obtained a ... | 1985 | 2997331 |
| [development of live varicella vaccine]. | | 1985 | 2997506 |
| processing of virus-specific glycoproteins of varicella zoster virus. | monoclonal antibodies to varicella zoster virus (vzv) glycoproteins were used to study the processing of three glycoproteins with molecular weights of 83k-94k (gp 2), 64k (gp 3), and 55k (gp 5). immunoprecipitation experiments performed with vzv-infected cells, pulse labeled with [3h]glucosamine in the presence of tunicamycin, suggest that o-linked oligosaccharide is present on the glycoprotein of gp 2. use of the enzyme endo-beta-n-acetylglucosaminidase h revealed that the fully processed form ... | 1985 | 2998004 |
| determination of infection and immunity to varicella-zoster virus with an enzyme-linked immunosorbent assay. | | 1985 | 2999261 |
| replication of epstein-barr virus within the epithelial cells of oral "hairy" leukoplakia, an aids-associated lesion. | we conducted a study to identify the viruses in tissue specimens of oral "hairy" leukoplakia, a lesion that is found in immunosuppressed male homosexuals and that is associated with the subsequent development of the acquired immunodeficiency syndrome. when stained for papillomavirus core antigen, 49 of 67 biopsy specimens (73 per cent) yielded positive results in epithelial-cell nuclei. electron microscopy showed papillomavirus-like particles in all of 25 specimens, and the herpes-type virus des ... | 1985 | 2999595 |
| recovery of herpesviruses from cerebrospinal fluid of immunodeficient homosexual men. | over a one-year period the cerebrospinal fluid (csf) obtained from a series of homosexual men immunocompromised with either hodgkin's disease or acquired immune deficiency syndrome (aids) was cultured to assess the frequency with which infectious viruses could be recovered. of 58 patients examined, 4 (6.9%) had csf cultures that showed a cytopathology consistent with a virus infection. all isolates proved to be herpesviruses. cytomegalovirus (cmv) and varicella-zoster virus were isolated from cs ... | 1985 | 3000285 |
| varicella-zoster virus p32/p36 complex is present in both the viral capsid and the nuclear matrix of the infected cell. | varicella-zoster virus (vzv) directs the synthesis of numerous glycosylated and nonglycosylated infected-cell-specific proteins, many of which are later incorporated into the virion as structural components. in this study, we characterized a nonglycosylated polypeptide complex with the aid of a vzv-specific murine monoclonal antibody clone, 251d9. as detected by indirect immunofluorescence, the antibody bound mainly to antigens located within the nuclei of infected cells and did not attach to an ... | 1986 | 3001341 |
| oral acyclovir in the therapy of acute herpes zoster ophthalmicus. an interim report. | a prospective, randomized, double-masked, placebo-controlled clinical trial was conducted to study the effects of oral acyclovir on 55 patients with acute herpes zoster ophthalmicus. treatment with oral acyclovir resulted in more prompt resolution of signs and symptoms, particularly in patients treated within 72 hours after onset of skin rash (p less than 0.05), and shortened the duration of viral shedding (p = 0.02). vesicular skin lesions involving other dermatomes (microdissemination) occurre ... | 1985 | 3001610 |
| formation of varicella-zoster virus antigens in infected vero cells. | the formation of varicella-zoster (v-z) virus-associated antigens was studied in v-z virus-infected vero cells by means of indirect immunofluorescence. early antigen (ea) was first detected inside v-z virus-infected vero cells 4 to 6 hr after infection, whereas surface membrane antigen (sma) was expressed on the outer surface of infected cells 2 to 3 hr later than ea, and intranuclear late antigen (la) was detected several hours later than sma antigen. ea expression was not inhibited by cytosine ... | 1985 | 3003545 |
| thrombotic cerebral vasculopathy associated with herpes zoster. | we describe the clinical, radiographic, and pathological findings in 3 patients with large-vessel cerebral vasculopathy following herpes zoster. two of the patients were studied at postmortem examination, and a brain biopsy was performed in the third. each of the 3 patients suffered thrombotic occlusions of large vessels without notable inflammatory or granulomatous changes following trigeminal or segmental herpes zoster infection. in the 2 autopsied patients, varicella-zoster virus (vzv) antige ... | 1986 | 3004319 |
| [studies on leukocyte procoagulant activity antigenically stimulated by purified protein derivative and varicella virus antigen]. | | 1985 | 3004393 |
| new common nomenclature for glycoprotein genes of varicella-zoster virus and their glycosylated products. | the accumulation of recent data concerning the reactivity of monoclonal antibodies with particular varicella-zoster virus (vzv) glycoproteins and the mapping of several of their respective genes on the vzv genome has led to a unified nomenclature for the glycoprotein genes of vzv and their mature glycosylated products. homologs to herpes simplex virus glycoprotein genes are noted. | 1986 | 3005621 |
| differentiation of strains of varicella-zoster virus by changes in neutral lipid metabolism in infected cells. | eleven isolates of varicella-zoster virus were tested for their effects on the incorporation of [14c]acetate into lipids in infected human embryonic lung cells. by relative percent, all virus isolates demonstrated a shift from polar lipid synthesis to neutral lipid, especially triglyceride, synthesis. by data expressed as counts per minute per microgram of protein, the vzv strains could be separated into two groups: those strains which depressed lipid synthesis and those strains which did not de ... | 1986 | 3005627 |
| specific lysis of varicella zoster virus-infected b lymphoblasts by human t cells. | epstein-barr virus-transformed human b cells expressed cell surface varicella-zoster virus (vzv) antigens after superinfection with vzv although they did not form infectious centers in a plaque assay. the vzv-superinfected cells were lysed by autologous vzv-stimulated t-cell lines and their derivative clones. the effector cells were specific for vzv and an hla dr antigen and were t4+. the specificity of lysis of epstein-barr virus-transformed, vzv-superinfected targets by prestimulated mononucle ... | 1986 | 3005647 |
| alphaherpesviruses possess a gene homologous to the protein kinase gene family of eukaryotes and retroviruses. | the us3 genes of herpes simplex virus serotypes 1 and 2, and the corresponding gene of varicella-zoster virus, encode proteins whose sequences are clearly homologous to members of the protein kinase family of eukaryotes and retroviruses. similarity is most characteristic, and strongest, in an 80 residue region comprising part of the catalytic structure of the kinases. in this region the herpesvirus proteins are most like a yeast cell division control protein, and least like the retrovirus protei ... | 1986 | 3005981 |
| herpesvirus infection in man. | herpesviruses which affect man are herpes simplex virus type 1 and type 2, varicella-zoster virus, cytomegalovirus and epstein-barr virus. the review deals with the more common clinical manifestations of human herpesvirus infections, which occur ubiquitously in all populations throughout the world. primary infections most commonly occur in childhood. it is a characteristic feature of herpesvirus that they generally remain in a latent form after clearance of the primary infection. the overall maj ... | 1985 | 3006233 |
| evolutionary comparisons of the s segments in the genomes of herpes simplex virus type 1 and varicella-zoster virus. | the genomes of herpes simplex virus type 1 (hsv-1) and varicella-zoster virus (vzv) consist of two covalently joined segments, l and s. each segment comprises an unique sequence flanked by inverted repeats. we have reported previously the dna sequences of the s segments in these two genomes, and have identified protein-coding regions therein. in hsv-1, the unique sequence of s contains ten entire genes plus the major parts of two more, and each inverted repeat contains one entire gene; in vzv, t ... | 1986 | 3007657 |
| cytomegalovirus (cmv) infections in renal transplant recipients. preliminary results of prophylaxis by an intramuscular human hyperimmune cmv igg. | infectious diseases are the most serious complications in immunosuppressed patients and the major cause of death in renal transplant recipients (23, 44). besides bacterial, fungal and protozoan infections, viruses of the human herpes group (herpes simplex virus, varicella-zoster virus, epstein-barr virus, cytomegalovirus) are known to be of major importance (21, 37). the most common and clinically relevant virus of this group is the cytomegalovirus (cmv). | 1985 | 3008312 |
| demonstration of nk cell-mediated lysis of varicella-zoster virus (vzv)-infected cells: characterization of the effector cells. | infection with varicella-zoster virus (vzv) rendered raji cells more susceptible to lysis by non-adherent blood lymphocytes. at an effector to target ratio of 80:1 the mean percentage of 51cr release of vzv-infected raji cells was 41 +/- 12%, whereas that of uninfected raji cells was 15 +/- 6%. the increased susceptibility to lysis was associated with increased effector to target conjugate formation in immunofluorescence binding assays. the effector cells cytotoxic for vzv-infected raji cells we ... | 1986 | 3009620 |
| clinical and subclinical reactivations of varicella-zoster virus in immunocompromised patients. | the frequencies of reactivated disease due to varicella-zoster virus (vzv) in immunocompromised patients were determined by enzyme-linked immunosorbent assay for antibody and also by the lymphocyte proliferation response to vzv antigen. subclinical reactivations were as common as classical herpes zoster in all patient groups. among bone marrow transplant (bmt) recipients, 36% developed herpes zoster and 26%, a subclinical reactivation. the corresponding frequencies for patients with leukemia dur ... | 1986 | 3009635 |
| interferon response to mitogens and viral antigens in elderly and young adult subjects. | | 1986 | 3009640 |
| excretion of varicella-herpes zoster virus in breast milk. | two cases involving breast-feeding and varicella-herpes zoster virus infection are presented. the possibility of viral excretion in the breast milk and its effects on continued breast-feeding are discussed. in neither case was the virus isolated from the breast milk. | 1986 | 3010724 |
| inoculation of guinea pigs with varicella-zoster virus via the respiratory route. | guinea pigs were inoculated by the respiratory route with wild-type (cyr) or vaccine (oka) strain varicella zoster virus (vzv). wild-type cell-free virus obtained by sonication produced neutralizing antibody responses in steroid-treated animals when given via the intratracheal route, and induced neutralizing antibody as well as a pneumonitis in normal animals when given via the intrabronchial (i.b.) route. a humoral response also followed i.b. instillation of cell-associated wild-type or vaccine ... | 1986 | 3010908 |
| development of an immunofluorescence test for the serodiagnosis of herpes zoster ophthalmicus. | an indirect immunofluorescence test has been developed and evaluated for the serodiagnosis of herpes zoster ophthalmicus (hzo) by the detection of antivaricella zoster virus (vzv) antibody. the results show that, in patients with hzo, anti-vzv igg antibody titre usually rises rapidly after onset. one hundred and seven of the 134 sera (80%) from patients with a clinical diagnosis of hzo had an anti-vzv igg titre of greater than or equal to 256, and igm antibody at a level of 1 in 8 was present in ... | 1986 | 3013281 |
| varicella-zoster-specific immune responses in acute herpes zoster during a placebo-controlled trial of oral acyclovir therapy. | during a placebo-controlled trial of oral acyclovir therapy for acute zoster in immunocompetent patients, we examined the blastogenic response of peripheral blood mononuclear cells and antibody titers in both placebo and acyclovir recipients to determine whether the drug affected the cell-mediated or humoral immune responses. proliferative responses to mitogens and two dilutions of varicella-zoster virus antigen were not inhibited when fresh peripheral blood mononuclear cells were simultaneously ... | 1986 | 3013495 |
| rapid assay for antibodies to varicella-zoster virus (vzv) using a vzv-hem preparation. | a freeze-dried, formalized-erythrocytes-bound vzv antigen for indirect haemagglutination, vzv-hem, was prepared. it was used to test serologically 46 children, all of them patients of prague paediatric clinics, with a known history of chickenpox. for comparison, the same sera were tested by the indirect haemagglutination reaction with freshly prepared vzv antigen and by elisa. all three serological tests gave congruent results in 97.8% of cases. the advantages of the vzv-hem assay are results ob ... | 1986 | 3013988 |
| a longitudinal study of varicella immunity in pediatric renal transplant recipients. | | 1986 | 3014014 |
| varicella vaccine in children with chronic renal insufficiency. | this study reports the antibody response and clinical follow-up of uraemic children awaiting kidney transplantation after administration of the oka-strain varicella vaccine (varilirix). seroconversion was observed in 20 out of 23 patients found to be seronegative when tested by the fluorescent antibody to membrane antigen technique, and an antibody booster response was observed in 41 out of 47 seropositive patients. mild clinical varicella occurred in 5 vaccinated patients and herpes zoster in 3 ... | 1985 | 3014466 |
| live varicella vaccine in healthy individuals. | eight hundred healthy seronegative children and 32 adults were vaccinated with the oka-strain live attenuated varicella vaccine (varilrix), manufactured by smith kline-rit, belgium. the vaccine was safe (no side effects) in healthy individuals, highly immunogenic (dose-dependent induction of humoral antibodies and specific cell-mediated immune response), and highly protective against clinical varicella. the simultaneous administration of a measles-mumps-rubella vaccine together with the varicell ... | 1985 | 3014469 |
| delayed hypersensitivity skin test to detect susceptibility to varicella and zoster. | a crude varicella skin-test antigen corresponding to an inactivated partly-purified high-titre varicella oka-strain vaccine was prepared at smith kline-rit. it was used for a delayed hypersensitivity skin test in 60 healthy adults for determination of their immune status. the findings were analysed according to the presence or absence of humoral antibodies to varicella-zoster virus (vzv), and of a specific cell-mediated immune (cmi) response as measured by the vzv-specific lymphocyte transformat ... | 1985 | 3014471 |
| restoration of varicella-zoster virus cell-mediated immune response after varicella booster vaccination. | in older age groups, an increasing proportion of healthy adults with a positive varicella history have lost their capacity for a cell-mediated immune (cmi) response to varicella-zoster virus (vzv) antigen despite the presence of virus-specific humoral antibodies. while it remains a matter of speculation whether this decline is connected with a predisposition to herpes zoster, it is known that a second zoster attack is rare in immunocompetent individuals. in order to determine whether the vzv-spe ... | 1985 | 3014472 |
| the future of varicella vaccine. | based on conservative figures, an estimated 60 million varicella-zoster cases occur annually worldwide, highlighting the global significance of this disease. the development of a viable varicella vaccine, therefore, raises important questions as to the indications for its use in normal children, normal seropositive and seronegative adults, and immunocompromised patients. a review of the available data addresses the potential future role of the varicella vaccine in these groups. | 1985 | 3014474 |
| vaccination of children with malignant disease against varicella. | nineteen seronegative children and one young adult with malignant disease in remission and on maintenance chemotherapy were immunized with the oka-strain live attenuated varicella vaccine (varilrix). side effects were moderate and a rash was seen in 50% of the patients after vaccination. humoral immune response to the vaccine was tested by the fluorescent antibody to membrane antigen (fama) test, a simpler indirect immunofluorescence test (ift), and an enzyme-linked immunosorbent assay (elisa). ... | 1985 | 3014484 |
| live varicella vaccine in severely immunodepressed children. | one dose containing 3,100 pfu of a live attenuated oka-strain varicella vaccine (varilrix, smith kline-rit, belgium) was administered subcutaneously to 45 children, 26 of whom were suffering from acute leukaemia and 19 from solid malignant tumours. their immunological status had been severely compromised by chemotherapy as evidenced by markedly low values for all immunological parameters. of the 31 children seronegative for varicella at the time of vaccination, 70%, 85%, 75%, and 40% had varicel ... | 1985 | 3014486 |
| immunity to varicella-zoster viral glycoproteins, gp i (gp 90/58) and gp iii (gp 118), and to a nonglycosylated protein, p 170. | humoral and cellular immunity against two major glycoproteins (gp) of varicella-zoster virus (vzv), gp i (gp 90/58) and gp iii (gp 118), and against a nonglycosylated phosphoprotein (p 170) was demonstrated in human subjects. primary vzv infection was accompanied by the development of igg to gp i (mean titer 1:200), gp iii (mean titer 1:132), and p 170 (mean titer 1:331). increased igg antibody production to each of the vzv proteins occurred during recurrent vzv infection with mean titers to gp ... | 1986 | 3016094 |
| the properties and sequence of glycoprotein h of herpes simplex virus type 1. | the map position of the coding sequence of glycoprotein h of herpes simplex virus type 1 was determined by marker transfer studies in which dna fragments cloned from a virus resistant to neutralisation by an anti-gh monoclonal antibody were used to transfer antibody resistance to wild type virus dna following cotransfection. the gh coding sequence was mapped to the bglii "m" fragment of hsv-1 dna (map coordinates 0.27-0.312), confirming the map position previously determined by intertypic recomb ... | 1986 | 3016991 |
| vestibular neuronitis--serum and csf virus antibody titer. | the cerebrospinal fluid (csf) findings of patients with vestibular neuronitis were virologically evaluated and discussed in contrast to those of herpes zoster. csf samples obtained from seven patients with vestibular neuronitis, aged 28 to 55 years, were examined. the results were as follows: the csf protein level in the vestibular neuronitis showed the peculiar change; i.e. its level was normal at the onset period of vertigo, but it rose to abnormal levels mostly in the period of two weeks, whi ... | 1986 | 3017280 |
| analysis of varicella-zoster virus dnas of clinical isolates by endonuclease hpai. | the dnas of 20 strains of varicella-zoster virus (vzv) isolated from epidemiologically unrelated individuals, and of 15 strains isolated from vesicles of vaccinees with varicella or zoster after vaccination, were compared by restriction enzyme cleavage using hpai. differences were found in the sizes of the hpai-f, -g and -k fragments of the wild strains. the gel migration patterns of the hpai-f and -g fragments, but not of the hpai-k fragment, were polymorphic in the different strains isolated f ... | 1986 | 3018125 |
| antibodies against herpes simplex virus in a group of healthy humans without reactions to herpes simplex virus antigens in blasttransformation assays. | 22 healthy individuals with different reactions in humoral and cell-mediated immunity to herpes simplex virus (hsv), as found in complement-fixation, neutralization, and blasttransformation assays have been further investigated using antibody-dependent cell-mediated immunity (adcc) as a serological test. sera from all individuals were absorbed on hsv-infected, varicella zoster virus (vzv)-infected or uninfected cell monolayers, before they were used in adcc with hsv-infected cells, as target. th ... | 1986 | 3018253 |
| use of lambda gt11 to isolate genes for two pseudorabies virus glycoproteins with homology to herpes simplex virus and varicella-zoster virus glycoproteins. | a library of pseudorabies virus (prv) dna fragments was constructed in the expression cloning vector lambda gt11. the library was screened with antisera which reacted with mixtures of prv proteins to isolate recombinant bacteriophages expressing prv proteins. by the nature of the lambda gt11 vector, the cloned proteins were expressed in escherichia coli as beta-galactosidase fusion proteins. the fusion proteins from 35 of these phages were purified and injected into mice to raise antisera. the a ... | 1986 | 3018284 |
| varicella-zoster dilemma: common sense in medical education. | | 1986 | 3021007 |
| generation of phenotypically different t cell populations by cell-free or cell-bound preparations of varicella zoster virus. | we used three different preparations of varicella zoster virus (vzv) to sensitise mononuclear cells obtained from vzv immune donors. these were autologous infected fibroblasts, live cell free virus and heat inactivated cell free virus. after 14 days of in vitro sensitisation and expansion with interleukin-2, the mononuclear cells which had been exposed to autologous infected fibroblasts had generated mainly cells of the cytotoxic/suppressor phenotype (cd8) while those stimulated with cell free v ... | 1986 | 3021616 |
| prevalence of antibodies to enteroviruses and varicella-zoster virus among residents and overseas volunteers at agricultural settlements in israel. | within the framework of a comprehensive study of the correlation between enteric diseases and wastewater utilization in agricultural settlements (kibbutzim) the prevalence of several viral antibodies was examined among kibbutz residents and overseas volunteers. the latter were assumed to be a group highly susceptible to local pathogens. for the purpose of this study the presence of antibodies against eight enteroviruses [coxsackieviruses (cox) types a9, b1, b3, and b4, echoviruses (echo) types 4 ... | 1986 | 3021900 |
| herpes zoster and zosteriform herpes simplex virus infections in immunocompetent adults. | among 111 immunocompetent patients referred to a general hospital setting with the clinical diagnosis of herpes zoster, viral cultures were obtained from 47 patients. six of these patients (13 percent) had herpes simplex virus isolated, with four of the six infections involving the facial distribution, and the other two involving the t4 (breast) distribution. excluding those in whom herpes simplex virus was isolated, the mean age (+/- sd) of the remaining 105 patients was 50 +/- 19 years. thirty ... | 1986 | 3022586 |
| reactivation of herpesvirus in neurosurgical patients. | the authors are presenting seven patients who had operations between july 1984 and july 1985 and who developed herpes infections postoperatively. four of the patients developed their infections in a dermatomal distribution that correlated with the nerve roots manipulated at operation. a spectrum of localized herpes reactivation is demonstrated in this series. the use of corticosteroids and other associated variables are discussed. like reactivation of herpes simplex after trigeminal nerve operat ... | 1986 | 3024061 |
| incidence of chickenpox in adults and recruitment of plasma donors for manufacture of zoster immunoglobulin. | | 1986 | 3024773 |
| failure of varicella-zoster immunoglobulin in modification of severe congenital varicella. | | 1986 | 3025821 |
| [antiviral effect of glycyrrhizin on varicella-zoster virus replication in vitro]. | | 1986 | 3027210 |
| antiviral sensitivities of the acute retinal necrosis syndrome virus. | varicella zoster was isolated from the vitreous of a patient with the acute retinal necrosis (arn) syndrome. we utilized a plaque reduction assay to determine the in vitro susceptibility of the arn isolate to 6 antiviral drugs. the effective doses for 50% inhibition of plaque numbers were 5.3 microm for for acyclovir, 4.7 microm for dhpg, 8.7 microm for ara-a, 100.7 microm for phosphonoacetic acid, 0.07 microm for bvdu and 2.4 microm for iudr. similar inhibitory values were obtained for the oka ... | 1987 | 3030644 |
| [immunization of healthy children with live attenuated varicella vaccine (oka strain)]. | | 1986 | 3031180 |
| intravenous hyperimmunoglobulin to prevent varicella-zoster infection. | | 1987 | 3031577 |
| lymphocyte responses to varicella zoster virus in the elderly. | elderly subjects (age 75-95 years) immune to varicella zoster virus (vzv) were identified by the presence of serum igg antibody. the frequency of lymphocytes in their blood which proliferated in varicella zoster virus antigen-stimulated cultures was 1:78,000 +/- 6600. this is less than the 1:14,000 +/- 2000 frequency of vzv-responsive lymphocytes in blood from younger adult (20-43 years) donors. elderly donors' blood mononuclear cells were less efficient than those of younger adults at lysing vz ... | 1987 | 3033012 |
| live attenuated varicella vaccine. | live attenuated varicella vaccine will in all probability soon be licensed in the united states for immunization of healthy children and adults and certain immunocompromised children. this vaccine can be expected to protect susceptibles from varicella (or to modify it) in those subsequently exposed to the wild virus. the vaccine is safe, immunogenic, and is not associated with an increase in the incidence of zoster. | 1987 | 3034136 |
| detection of herpes simplex virus in direct specimens by immunofluorescence assay using a monoclonal antibody. | a monoclonal antibody (mab), designated cha 437, was developed against herpes simplex virus (hsv). this mab (isotype, immunoglobulin g2b k) reacted with hsv type 1 and hsv type 2. it showed no cross-reactivity with varicella-zoster virus, cytomegalovirus, or epstein-barr virus. direct detection of hsv antigen in clinical specimens using indirect immunofluorescence with this mab was compared with tissue culture isolation. for the 682 specimens tested, the direct specimen test gave a sensitivity o ... | 1987 | 3034970 |
| serum and urine concentrations of oral bromovinyldeoxyuridine in humans as monitored by a bioassay system based on varicella-zoster virus focus inhibition. | a simple and sensitive bioassay method for measuring (e)-5-(2-bromovinyl)-2'-deoxyuridine (bvdu) concentrations in human serum and urine has been established. this method is based on the inhibitory effect of bvdu on varicella-zoster virus (vzv) focus formation in vitro. the minimal concentration of bvdu that could be detected in serum by this method was 0.2 microgram/ml. following a single oral administration of 250 mg bvdu, serum bvdu concentrations of 1.2-2.2 micrograms/ml were attained 1 hr l ... | 1987 | 3035076 |
| varicella-zoster virus infection of human mononuclear cells. | varicella-zoster virus (vzv) dna was detected in mononuclear cells (mnc) of 7 humans with acute zoster 1-23 days after the onset of skin lesions. to further study the interaction of vzv with human mnc, cells obtained from seropositive normal donors were infected with vzv and analyzed for the presence of viral dna and proteins. vzv-dna was detected in t, b, and okm 1 (monocyte-macrophage) positive cells, and virus-specific proteins were demonstrated by indirect immunofluorescence and immunoprecip ... | 1987 | 3035815 |
| pneumonias in adults due to mycoplasma, chlamydiae, and viruses. | pneumonias in adults due to mycoplasma, chlamydiae, and viruses are a common clinical problem. these microorganisms contribute to the etiologies in 6-35% of all cases of pneumonia and are the sole pathogens in 1-17% of hospitalized cases. important trends and developments in the field include the emergence of a chlamydia psittaci strain (twar) that is passaged from human to human, causes a mycoplasma-like illness, and that is relatively resistant to erythromycin, the recognition of respiratory s ... | 1987 | 3037901 |
| assembly and processing of the disulfide-linked varicella-zoster virus glycoprotein gpii(140). | varicella-zoster virus (vzv) specifies the synthesis of at least four families of glycoproteins, which have been designated gpi, gpii, gpiii, and gpiv. in this report we describe the assembly and processing of vzv gpii, a structural protein of an apparent mr of 140,000, which is the homolog of gb of herpes simplex virus. for these studies, we used two anti-gpii monoclonal antibodies which exhibited both complement-independent neutralization activity and inhibition of virus-induced cell-to-cell f ... | 1987 | 3039175 |
| magnetic resonance imaging of the brain in childhood herpesvirus infections. | we used magnetic resonance imaging (mri) to evaluate nine children with neurologic disorders caused by infections with members of the herpesvirus family. mri studies were abnormal in eight children and demonstrated a wide range of central nervous system lesions, including cystic encephalomalacia, ventricular enlargement, cerebral atrophy and focal parenchymal lesions. when compared with conventional computed tomographic scanning, mri was more sensitive in detecting abnormalities of white matter ... | 1987 | 3039447 |
| efficacy of varicella vaccine in patients with solid tumours. | thirty nine children with malignant disease and without antibodies to varicella zoster virus were immunised with a live oka strain varicella vaccine. seroconversion was shown in 24 of those who were vaccinated but five of 18 who responded to the vaccine who were followed up for over six months subsequently lost their antibodies. of 10 children who were revaccinated, nine responded to the second dose but three lost their antibodies within six months to two years. four children developed reactions ... | 1987 | 3039925 |
| perinatal viral infections. | in comparison to older children and adults, neonates are immunologically incompetent. they are susceptible to infections caused by a variety of microorganisms, including bacteria, fungi and viruses. these infectious agents may be acquired by neonates either prenatally, during the intrapartum period or postnatally. the purpose of this review is to emphasize the potential impact of viral infections contracted by neonates at the time of delivery or within the neonatal period. the viruses reviewed i ... | 1987 | 3040392 |
| immunization of monkeys with varicella-zoster virus glycoprotein antigens and their response to challenge with simian varicella virus. | african green monkeys (cercopithecus aethiops) were immunized with three intramuscular injections of gpi, gpii, or gpiii glycoprotein antigens of varicella-zoster virus (vzv). antibody responses to vzv were determined by enzyme-linked immunosorbent assay (elisa) and to simian varicella virus (svv) by immunofluorescence and by serum neutralization assays. two weeks following the third immunization with vzv glycoproteins, the monkeys were challenged by inoculation of svv. antibodies to gpii or gpi ... | 1987 | 3040898 |
| human immunodeficiency virus infection of the brain. ii. detection of intrathecally synthesized antibodies by enzyme linked immunosorbent assay and imprint immunofixation. | sera and csf from 29 patients in early and late stages of hiv infection were analysed for intrathecal antibody production. elevated csf-igg indices indicating intrathecal igg synthesis were demonstrated in 9 patients while 4 of 18 patients tested had oligoclonal igg bands in the csf. analysis of hiv-specific antibodies by enzyme-linked immunosorbent assay (whole antigen and site-directed elisa) and calculation of "antibody indices" (csf/serum antibody quotient divided by csf/serum albumin quotie ... | 1988 | 3142965 |
| latent herpesvirus infections of neurons in guinea pigs and humans. | latent herpes simplex virus (hsv) infection of the trigeminal ganglion of guinea pigs and latent varicella-zoster virus (vzv) infection of the trigeminal ganglion of humans were studied by in situ nucleic acid hybridization. guinea pig trigeminal ganglia were removed during the period of viral latency (four to five weeks after corneal inoculation of hsv), and human ganglia were removed at autopsy. radiolabeled hsv and vzv dnas were used to probe ganglion tissue sections for viral-specified rna. ... | 1987 | 3495074 |
| activity of 1-(2'-deoxy-2'-fluoro-beta-d-arabinofuranosyl)-5-iodouracil against simian varicella virus infections in african green monkeys. | the fluorinated pyrimidines 1-(2'-deoxy-2'-fluoro-beta-d-arabinofuranosyl)-5-iodouracil (fiau) and 1-(2'-deoxy-2'-fluoro-beta-d-arabinofuranosyl)-5-methyluracil (fmau) are highly effective inhibitors of herpesvirus infections in vitro and in vivo. this report is concerned with an evaluation of their activities in african green monkeys (cercopithecus aethiops) infected with simian varicella virus, a herpesvirus closely related to human varicella-zoster virus. oral or intravenous administration of ... | 1986 | 3729332 |
| a novel selective broad-spectrum anti-dna virus agent. | a new compound has been found, (s)-9-(3-hydroxy-2-phosphonylmethoxypropyl)adenine ((s)-hpmpa), that has potent and selective activity against a broad spectrum of dna viruses, including herpes simplex virus (types 1 and 2); varicella zoster virus; thymidine kinase-deficient (tk-) mutants of herpes simplex and varicella zoster virus; human cytomegalovirus; phocid, simian, suid, bovid and equid herpesviruses; african swine fever virus; vaccinia virus; and human adenoviruses. it is also active again ... | 1986 | 3762696 |
| human lymphocyte, monocyte and polymorphonuclear leucocyte mediated antibody-dependent cellular cytotoxicity against varicella-zoster virus-infected targets. | the ability of lymphocytes, monocytes and polymorphonuclear leucocytes (pmn) to mediate antibody-dependent cellular cytotoxicity (adcc) against varicella-zoster virus (vzv) infected fibroblasts was tested in 51cr release and single-cell assays. lymphocytes had the greatest lytic activity, monocytes were intermediate in activity and pmn were the least active. lymphocyte-mediated adcc was complete by as early as 4 h, while maximal monocyte and pmn-mediated adcc required 18 h. in single-cell assays ... | 1986 | 3955882 |
| zoster and chickenpox. | | 1971 | 4102057 |
| [varicella]. | | 1971 | 4110890 |
| studies on a human cell line (esp-1) producing type c virus particles. | | 1973 | 4130401 |
| letter: recurrent varicella-like illness in a child with leukaemia. | | 1974 | 4136064 |
| antigenic relationship of varicella-zoster and herpes simplex. | | 1965 | 4157772 |
| [pathogenesis of herpes zoster]. | | 1965 | 4284232 |
| production of varicella-zoster cf antigen in a continuous line of grivet monkey kidney cells. | | 1966 | 4289537 |
| the usefullness of human fibroblast cell lines for the isolation of viruses. | | 1967 | 4289892 |
| [the varicella-zoster virus]. | | 1967 | 4294955 |
| [induction of the "stripping enzyme" in different viruses of the smallpox-vaccinia group]. | | 1966 | 4297720 |
| [electron microscopic findings on the ultrastructure and viruses of the vesicles of varicella]. | | 1966 | 4297740 |