Publications

TitleAbstractYear
Filter
PMID(sorted descending)
Filter
restriction fragment length polymorphisms in australian and new zealand isolates of leptospira interrogans serovar pomona. 19968894026
effect of leptospira interrogans serovar hardjo infection on milk yield in endemically infected dairy herds. 19968893491
production and characterization of monoclonal antibodies to the edta extract of leptospira interrogans, serovar icterohaemorrhagiae.monoclonal antibodies (mabs) were produced against an ethylenediaminetetraacetate (edta) extract of leptospira interrogans serovar icterohaemorrhagiae being characterized by gel precipitation as igm and igg (igg1 and igg2b). the edta extract was detected as several bands by silver staining in sds-page. in the western blot the bands around 20 kda reacted with a monoclonal antibody, 47b4d6, and was oxidized by periodate and was not digested by pronase, suggesting that the determinant is of carbohy ...19968885673
the development of a ligase mediated pcr with potential for the differentiation of serovars within leptospira interrogans.a ligase mediated polymerase chain reaction (lmpcr) was developed to amplify between the repetitive element, is1533, of leptospira and adjacent chromosomally located bg/ii restriction endonuclease enzyme sites. to do this, complimentary oligonucleotide linkers designed to anneal together with an overhanging bg/ii end were ligated to bg/ii digested dna from 35 leptospiral reference strains and field isolates. this ligated dna was used as template for pcr with oligonucleotide primers specific for ...19968870196
protective activity of rabbit polyclonal anti-idiotype antibody against leptospira interrogans infection in hamsters.we prepared an anti-idiotype (id) antibody against leptospirosis. serum from rabbit immunized with monoclonal antibody (mab) lw2, which reacted to the main protective antigen prepared from leptospira interrogans serovar lai, inhibited agglutination of the organism by mab lw2. the immune rabbit serum was applied to a column coupled with normal mouse igg as a ligand (first column), and the unbound fraction eluted was applied to a column coupled with mab lw2 as a ligand (second column). the bound f ...19968860969
reduced conception rates in dairy cattle associated with serological evidence of leptospira interrogans serovar hardjo infection.fertility data from 673 cows in five dairy herds with a moderate to high seroprevalence of microscopic agglutination titres (mat) of > or = 1:10 against leptospira interrogans serovar hardjo were collated to assess the relationship between pregnancy rates and antibody titres to serovar hardjo. a significant proportion of failures of conception (10 to 13 per cent, p < 0.001) were associated with mats of 1:10 to 1:100; the overall pregnancy rate of the seronegative cows was 28.5 per cent higher (p ...19968856888
leptospira interrogans in the genital tract of sheep. research on ewes and rams experimentally infected with serovar hardjo (hardjobovis).to verify if leptospira hardjo can colonize the male and female genital organs of sheep, 9 animals (6 non pregnant ewes and 3 mature rams) were infected with a strain of l. hardjobovis recently recovered from the kidneys of a seropositive ewe. postinfection controls (bacteriologic, serologic, immunohistochemistry and electron microscopy) failed to disclose the presence of leptospires in the uterus and oviducts, testicles, epididymis, prostate and bulbourethral glands of animals used for the expe ...19968841039
leptospira interrogans serovar grippotyphosa infection in dogs.leptospirosis attributed to infection with serovar grippotyphosa was diagnosed in 11 dogs. in naturally and experimentally infected dogs, a stereotypic serologic response to infection with leptospira serovar grippotyphosa was detected. although the highest serum antibody titers developed against serovar grippotyphosa, most dogs also had lower titers against serovars bratislava and pomona. acute renal failure was evident in 10 dogs. one dog died prior to initiation of treatment; the remaining 10 ...19968837647
acute renal disease due to leptospira interrogans in a weanling. 19968818600
correlation between dna restriction fragment length polymorphisms in leptospira interrogans serovar pomona type kennewicki and host animal source.isolates (n = 147) of leptospira interrogans serovar pomona type kennewicki from cattle, swine, horses, and wildlife were analyzed by dna restriction endonuclease analysis. restriction fragment length polymorphisms were identified in dna digested with hpaii, and the restriction fragment length polymorphisms were correlated with the host animal source of the isolates. these results will be useful in understanding the epidemiology of serovar pomona infections in livestock.19968789028
experimental immunization of hamsters with an edta extract of leptospira interrogans, serovar icterohaemorrhagiae.the edta extract was prepared from the leptospira interrogans serovar icterohaemorrhagiae. when inoculated subcutaneously in hamsters it conferred protection from challenge with virulent leptospires with a low dose (10 micrograms/ml) and low agglutinating antibody (40). the protection of animals obtained by the edta extract opens up the perspective of its use as a component of a vaccine for the control of leptospirosis.19968783904
[the molecular genetic and biological aspects of the ecology of pathogenic leptospira (leptospira interrogans)].the results of recent investigations on the application of some genotyping methods (genomic fingerprinting, analysis of restriction length fragment polymorphism of dna, etc.), made in order to study the population structure of pathogenic leptospires and to evaluate their intraspecies heterogeneity with regard to their main ecological features, are reviewed. new data on the use of prc-based amplification test systems for the study of specific features of host persistence of leptospires are presen ...19968771722
intestinal spirochetosis: first cases reported in brazil and the use of immunohistochemistry as an aid in histopathological diagnosis.colonization of the colon and rectum by intestinal spirochetes is detected for the first time in brazil in 4 of 282 (1.41%) patients who had undergone sigmoidoscopy and/or colonoscopy with a histopathological diagnosis of chronic non specific-colitis. this frequency is probably underestimated, since surgically obtained specimens were not considered in the present study. histopathological diagnosis was performed using routine stains like hematoxylin-eosin which showed the typical, of 3-microns th ...19968762639
rapid distinction between leptonema and leptospira by pcr amplification of 16s-23s ribosomal dna spacer.the pcr amplification of the genomic dna of leptonema illini strain 3055 using primers directed against conserved regions of the rrna operon provided evidence that the 16s and 23s rrna genes were linked via an intergenic spacer region. the sequencing of the intergenic spacer region indicated that it was 435 nucleotides in length and sequence similarity searches revealed that it bore no homology to any known sequences including trna available in databases. further investigations using southern bl ...19968759793
[construction of genomic library of l. interrogans serovar lai and preliminary study of recombinant plasmid pdc38].a genomic library, consisting of approximate 12 000 recombinants, has been constructed for the leptospira interrogans serovar lai in e. coli. using puc18 as the vector. hybridization analysis with the dna fragment containing ompl1 gene was performed and 10 positive clones were screened from the genomic library. one of the positive clones, designated pdc38, showed hybridization signal with the dna of 7 serovars 8 strains of pathogenic leptospires, but not with the dna of nonpathogenic leptospires ...19958732051
effect of vaccination against leptospira interrogans serovar hardjo on milk production and fertility in dairy cattle. 19968730678
leptospira interrogans serovar hardjo in the kidneys and genital tracts of naturally infected sheep.a bacteriological study was carried out to identify possible renal and/or genital carriers of leptospira interrogans serovar hardjo. l. hardjo was found at slaughter in the kidneys of three seropositive ewes, but not in uterus or salpinges of these animals.19968722315
preliminary evaluation of antimicrobial agents for treatment of leptospira interrogans serovar pomona infection in hamsters and swine.to evaluate antimicrobial agents for treatment of models of acute and persistent leptospirosis caused by leptospira interrogans serovar pomona.19968720239
leptospirosis in madras--a clinical and serological study.leptospirosis was confirmed by microscopic agglutination test (mat) and/or elisa in 57 patients admitted to the government general hospital, madras, india, during november and december of 1990 and 1991 with symptomatology suggestive of the disease. fifty (88%) of the 57 cases were males; the mean age of all the cases was 39.6 years (range 17-72). the main clinical features were: fever 100% jaundice 84%, myalgia 82%, acute renal failure 72% and conjunctival suffusion 58%. non-azotemic jaundice oc ...19958713215
reproductive performance of dairy herds infected with leptospira interrogans serovar hardjo relative to the year of diagnosis.to assess the impact of leptospira interrogans serovar hardjo infection on the reproductive performance of nine dairy herds with evidence of infection, forty years' fertility data were analysed relative to the year of first diagnosis. fifty per cent of various fertility variables had their lowest values only in the year of diagnosis. culling rates were highest during the year of diagnosis in five of the herds, and were above 22 per cent in five of nine (55-6 per cent) of the diagnosis years cons ...19968711883
presence of antigen and antibodies in serum and genital discharges of cows from dairy herds naturally infected with leptospira interrogans serovar hardjo.samples of cervico-vaginal mucus from 163 bulling cows (group 1) and post calving discharges from 59 newly calved cows (group 2) in five dairy herds naturally infected with leptospira interrogans serovar hardjo were examined for the presence of antigen and igg and iga antibodies by using two elisa systems which were protein or carbohydrate based. corresponding serum samples were examined for systemic immune responses by using a microscopic agglutination test (mat) and igg-elisa tests. antigen wa ...19968685539
presence of antigen and antibodies in serum and genital discharges of heifers after experimental intrauterine inoculation with leptospira interrogans serovar hardjo.the excretion of leptospira interrogans serovar hardjo in cervico-vaginal mucus (cvm) or urine and the local and systemic immune responses to the organism were monitored in eight susceptible heifers after intrauterine inoculation while six similar heifers served as controls. all the heifers were inseminated at the subsequent oestrous periods. the overall percentage pregnancy rate (the number of pregnancies divided by the total number of inseminations) was lower in the infected heifers than in th ...19968685538
isolation of leptospira interrogans serovar grippotyphosa from a heifer in new south wales. 19968660211
leptospira interrogans exposure in free-ranging elk in washington.exposure to one or more serovars of leptospira interrogans was observed in five of six sampled elk (cervus elaphus roosevelti) killed in november 1993, from an isolated herd in southwest washington, usa (46 degrees 45'n, 123 degrees 6'w). in april 1994, exposure to l. interrogans serovars was documented in nine of 11 captured cow elk from the same herd. leptospires were not isolated from any of the exposed elk, and 10 of the 11 cows were pregnant. the high seroprevalence is evidence that exposur ...19968627923
[leptospira infected rat population as probable cause of a fatal case of weil's disease].in the summer of 1992 a patient died of a leptospiral infection which he probably had contracted while he was swimming in an artificial lake in the region of tübingen/reutlingen. regarding the epidemiological role of leptospirosis the rodent population was investigated, because rats and mice were often seen in the surrounding area. 11 rats and 20 mice could be trapped. from their urine or kidneys two leptospiral serovars were isolated: serovar copenhageni from rattus norvegicus and serovar saxko ...19958593131
is1533-based pcr assay for identification of leptospira interrogans sensu lato serovars.a pcr-based assay was developed for typing l. interrogans sensu lato serovars. the assay is designed to exploit the presence of many copies of the leptospiral insertion sequence is1533 and is1533-like sequences present in the genomes of most leptospiral serovars. the pcr primers were designed to amplify dna of unknown sequence between closely placed is1533 or is1533-like sequences. amplification reactions primed with is1533-based primers generated products of different sizes. when few copies of ...19958586718
[seroepidemiologic investigations in the alpine ibex (capra i. ibex) of piz albris in the canton of grigioni (switzerland)].sero-epidemiological investigations in wild animals may allow to assess distribution of selected pathogens that sometimes seem to be involved in sanitary interrelationships between wild and domestic ungulates sharing the same areas. serological studies were carried out to investigate the prevalence of antibody against 8 pathogens in alpine ibex of albris colony (grisons, switzerland). investigated sera came from 89 animals shot by gamekeepers in 1990-1991. antibody against smooth brucella, coxie ...19958584868
[significance of human leptospirosis in mexico. detection of leptospira antibodies in a blood donor population].the presence of specific serum antibodies has been used as a diagnostic test for human leptospirosis. the presence of these antibodies in humans is indicative of an active natural infection. its detection after exposure denotes the presence of immunity. serum samples from 206 adult blood donors were analyzed with a microscopic agglutination assay against 7 serovars of leptospira interrogans. a total of 7% were positive with the following serovar distribution; shermani 53%, canicola 33%, pyrogens ...19958582567
use of nondenaturing silver-stained polyacrylamide gel analysis of polymerase chain reaction amplification products for the differential diagnosis of leptospira interrogans infection.a 285-bp dna fragment was amplified using the polymerase chain reaction from 38 leptospira serovars of six different genomic species. the fragments amplified exhibited differential mobilities on nondenaturing polyacrylamide gels resulting from sequence-dependent conformational alterations. leptospira interrogans serovars could be distinguished from those of other species on this basis.19958582141
antimicrobial activity of two bactenecins against spirochetes.bac5 and bac7 are antimicrobial peptides of bovine neutrophils that act on enteric gram-negative bacteria. we report here that these two peptides immobilize and kill leptospira interrogans and leptospira biflexa with mbcs of 6 to 25 micrograms/ml. conversely, although both peptides bind to borrelia burgdorferi, the organism is resistant to their action.19938514417
association between clinical lameness and borrelia burgdorferi antibody in dairy cows.results of an elisa, indirect fluorescent antibody (ifa) test, and immunoblot analysis (western blotting) for antibody to borrelia burgdorferi in a sample of 216 lactating dairy cows were compared. the microscopic microtitration agglutination test for antibody to 6 serovars of leptospira interrogans was also performed to evaluate possible cross-reactivity between b burgdorferi and l interrogans. using western blotting as the standard test against which the elisa and ifa test were compared, the e ...19938498742
serological survey for canine leptospirosis in the pretoria area.canine serum samples (n = 400) from the pretoria area were tested for leptospira antibodies, using the microscopic agglutination test. the prevalence of antibodies (inconclusive and positive titres) was 1.5%. reactions were only against leptospira interrogans serovars tarassovi and pyrogens. leptospirosis does not appear to be an important canine disease in the pretoria area.19938496894
leptospiral abortion and leptospiruria in horses from the same farm.leptospirosis was documented as the cause of abortion in a 5-year-old mare. leptospires were detected in tissue specimens from fetal kidneys and from placenta by histologic evaluation of silver-stained sections. antibodies against leptospira interrogans serovar pomona were detected in fetal serum at a titer of 1,600 by use of a microscopic agglutination test. the mare had serum titers of 6,400; 0; 400; 800; 3,200; and 6,400 to l interrogans serovars bratislava, canicola, grippotyphosa, hardjo, i ...19938496088
chemotaxis of leptospires to hemoglobin in relation to virulence.a guinea pig-lethal line of leptospira interrogans serovar copenhageni strain shibaura, but not an avirulent line of the same strain, moved in larger numbers toward hemoglobin than toward distilled water (control) in a u-shaped polypropylene tube. l. interrogans serovar lai strains 017 and kh-1, which were also guinea pig lethal, showed a similar move to hemoglobin. no such move toward hemoglobin was shown by 14 avirulent strains of l. interrogans (with one exception) or any of the 8 strains of ...19938478123
restriction-endonuclease analysis of australian isolates of leptospira interrogans serovar hardjo from cattle with agalactia and abortion.polyacrylamide gel electrophoresis and agarose gel electrophoresis were used to resolve restriction endonuclease digests of 20 australian isolates of leptospira interrogans cultured from urine samples of cattle with agalactia and abortion. the restriction endonuclease profiles of 19 isolates closely matched the profiles of l interrogans serovar hardjo subtype hardjobovis reference strains. the remaining isolate had a different restriction profile from subtype hardjobovis and subtype hardjoprajit ...19938476365
bacterial agents detected in a 10-year study of bovine abortions and stillbirths.in a 10-year survey started in 1980, specimens from 8,995 bovine abortions and stillbirths were submitted to the south dakota animal disease research and diagnostic laboratory. of these, 8,962 were suitable for some type of examination. bacteria were determined to be the cause of 1,299 (14.49%). the 5 bacteria most commonly associated with bovine abortion or stillbirth were actinomyces pyogenes, 378 (4.22%); bacillus spp., 321 (3.58%); listeria spp., 121 (1.35%); escherichia coli, 98 (1.09%); an ...19938466983
decision support models of leptospirosis in dairy herds.following the results of a survey which found that 61 per cent of dairy farmers felt that they needed more information about leptospirosis, and the strategies for its control and the costs and benefits involved, this paper describes the construction and preliminary results of two models of the disease intended to help explore the risks and financial implications of leptospira interrogans serovar hardjo infection for dairy producers.19938430482
prevalence of leptospiral agglutinins among conservancy workers in madras city, india.in a study of 584 corporation conservancy (sanitation) workers who lived mostly in slums, and who worked in four corporation circles of madras city, india, 192 (32.9%) were found to be positive for agglutinins to leptospira interrogans. seropositivity prevalence increased with age, but was similar in males and females except in the youngest age group, where males predominated. prevalence in the four study areas ranged between 17.8 and 40.5% (p < 0.01). among 152 sera in which one serogroup predo ...19938429573
a new leptospiral serovar in the icterohaemorrhagiae serogroup isolated from an ox in zimbabwe.a strain of leptospira interrogans that was isolated from an ox slaughtered in zimbabwe and belonged to serogroup icterohaemorrhagiae could not be identified when we compared it with 18 reference strains belonging to this serogroup by using cross-agglutinin absorption, monoclonal antibody, and restriction endonuclease dna analyses. the name zimbabwe is proposed for the new serovar containing this strain; the type strain of this serovar is strain sbf 23.19938427806
identification of species-specific, non-cross-reactive proteins of borrelia burgdorferi.the low specificity of diagnostic tests for lyme disease is due to the fact that borrelia burgdorferi possesses many antigenic proteins that are cross-reactive with other spirochetes and bacteria. the low sensitivity is a result of high (> or = 1:100) dilutions used for patient sera during testing to eliminate non-specific cross-reactivity. the present study was conducted to identify species-specific non-cross-reactive protein(s) of b. burgdorferi that might be used as antigen(s) in serologic te ...19938425377
opsonization of treponema pallidum is mediated by immunoglobulin g antibodies induced only by pathogenic treponemes.rabbit antisera to leptospira interrogans, borrelia hermsii, and treponema phagedenis biotype reiter, reactive to shared spirochetal antigens, failed to enhance phagocytosis of treponema pallidum by macrophages, while immunoglobulin g to treponema pallidum subsp. pertenue and treponema paraluiscuniculi promoted phagocytosis. opsonic antibodies are directed to pathogen-restricted, not shared spirochetal, antigens.19938423106
outbreak of leptospirosis associated with swimming.between july 7 and 18, 1991, five boys from a small town in rural illinois experienced the onset of an acute febrile illness subsequently confirmed as leptospirosis by serologic tests. a cohort study found that swimming in a small swimming hole, steel tunnel pond, was associated with disease (p < 0.01), the attack rate being 28%. leptospira interrogans serovar grippotyphosa was isolated from urine cultures from two of the case patients and from a culture of steel tunnel pond water. a high seropr ...19938417426
[a severe course of leptospirosis with acute kidney failure and extensive icterus (weil disease)].a 77-year-old man developed a fever up to 38.4 degrees c, with diarrhoea, acute renal failure (creatinine up to 8.7 mg/dl; urea up to 308 mg/dl) and marked jaundice (total bilirubin up to 24.3 mg/dl). in addition there was thrombocytopenia, conjunctivitis and epistaxis, as well as cerebral symptoms with somnolence and general slowing up. at first he was thought to have cholangitis resulting from previously diagnosed gall-stones, and he was therefore treated with ampicillin, 2 g two times daily, ...19938404498
antimicrobial effects of a new carboxyquinolone drug, q-35, on five serogroups of leptospira interrogans.new carboxyquinolone drugs, including the recently developed q-35, were evaluated for their in vitro potency against five serogroups of leptospira interrogans. q-35, ofloxacin, ciprofloxacin, and tosufloxacin showed mics (0.05 to 0.20 microgram/ml) comparable to those of tetracycline. however, mbcs of these drugs varied between 10- and 100-fold above the mic for most strains tested. q-35 was shown to be active against l. interrogans in vitro as judged by the mics obtained.19938388204
cloning and analysis of the leub gene of leptospira interrogans serovar pomona.the leub gene of leptospira interrogans serovar pomona strain kenniwicki has been cloned on a 9.5 kb plasmid, pwvl1, by complementation of escherichia coli leub mutants. subcloning and tn5 mutagenesis showed that the region required for complementation was approximately 1.2 kb in length. enzyme assays showed that the product of the cloned gene was a beta-isopropylmalate dehydrogenase. defects in the leua, leuc and leud genes of e. coli were not complemented by pwvl1. the nucleotide sequence of t ...19938336106
isolation of leptospira interrogans serovar grippotyphosa from the skin of a dog.leptospira interrogans serovar grippotyphosa was isolated from the skin of a 14-year-old male dog with deteriorating health. necropsy revealed numerous lesions characteristic of aged dogs, but no evidence of acute hepatitis or nephritis, which are common features of pathogenic leptospira infections. antibody to leptospira was not detected in the dog's serum by microagglutination. leptospires grew slowly in barbour-stoenner-kelly medium, a medium commonly used to isolate borrelia, but then grew a ...19938288477
[amplified 23s rrna gene of 52 strains of leptospira and detection of leptospiral dna in 55 patients by pcr].based upon the polymerase chain reaction (pcr), we have developed a sensitive assay for leptospira interrogans, the agent of leptospirosis. dna amplification was carried out using primer a: 5'gatctaattcgctgtagcagg3' and primer b: 5'actttcaccctctatggtcgg3'. after 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. a segment (124 bp) was amplified in all strains of l. interrogans including 20 serogroups, 49 serovars tested, but it was not detected in patoc i s ...19938288193
identification of leptospira interrogans strains by monoclonal antibodies and genomic analysis.a recombinant probe derived from a genomic library of serovar hardjo strain hardjoprajitno, and a panel of serovar specific monoclonal antibodies (mabs) were used for the characterization of 31 leptospira isolates from cattle and swine. the two methods performed equally well in serovar identification except for the distinction of the genotypes hardjoprajitno and hardjobovis within serovar hardjo which could only be obtained by genomic analysis. the combination of immunological and genetic inform ...19938264422
serologic survey for leptospirae in european brown bears (ursus arctos) in croatia.from 1981 to 1991, sera of 42 european brown bears (ursus arctos) from three areas in croatia were tested for antibodies against 12 leptospira interrogans serovars: grippotyphosa, sejroe, australis, pomona, canicola, icterohaemorrhagiae, tarassovi, saxkoebing, ballum, bataviae, poi, and hardjo. diagnostic levels of antibody were found in 17 (40%) of 42 sera. evidence of exposure to at least one of the serovars was found in seven of 14 free-ranging bears from the lika region, four of 12 free-rang ...19938258865
isolation of leptospira interrogans serovars hardjo and zanoni from a dairy herd in north queensland. 19938257323
[antigen analysis of mcab e4b7d5 directed against outer envelope of leptospira interrogans serovar lai by sds-page and immunoblot].mcab e4b7d5 was prepared by hybridoma technology in balb/c mice immunized to outer envelope of leptospira interrogans serovar lai. this mcab agglutinated specifically with all the 13 serovars of icterohaemorrhagiae serogroup in mat test at high titres and protected the guinea pigs against the attack of virulent strain (017) of serovar lai. sds-page and immunoblot were used to analyse the reaction of the outer envelopes of the five strains of leptospira (leptospira interrogans icterohaemorrhagiae ...19938244286
cross-reactivity between b. burgdorferi and other spirochetes affects specificity of serotests for detection of antibodies to the lyme disease agent in dogs.western immunoblots, the kinetics-based enzyme-linked immunosorbent assay (kela), and the microagglutination test were used to evaluate cross-reactivity among antibodies to serovars of leptospira interrogans (leptospiral serovars), and b. burgdorferi from naturally infected dogs, and to serpulina (treponema) hyodysenteriae from vaccinated rabbits. whole-cell lysates from borrelia spp., leptospiral serovars, and serpulina spp. were used for sds-page, western blots, and kela. crossreactivity occur ...19938236777
association between cessation of leptospiruria in cattle and urinary antibody levels.the shedding of leptospira interrogans serovar hardjo in the urine of cattle and the local and systemic response to these organisms was monitored in experimentally and naturally infected animals. twenty yearling heifers, 10 infected by the instillation of leptospires into the conjunctival sac (supraconjunctival route) and 10 infected intrauterinely, shed leptospires for up to 60 weeks after infection. five of 15 naturally infected pregnant heifers with microscopic agglutination test titres > or ...19938235087
[the use of nonpathogenic leptospira as diagnostic antigens for the diagnosis of leptospira infections in cattle].the seroprevalence of leptospira antibodies was determined in 4377 bovine sera by microagglutination assay using 11 leptospira interrogans serovars. in 10% (439 samples) of the sera, a positive reaction was detected. these included 275 sera (62.6%) with reaction to l. grippotyphosa, 159 (36.2%) to l. saxkoebing and 5 (1.1%) sera with reactions to other serovars. multiple reactions were found in 9.8% of the 439 positive sera, whereby the sejroe group dominated (65%) within the possible combinatio ...19938216195
leptospirosis in equine fetuses, stillborn foals, and placentas.leptospirosis was diagnosed in 51 equine fetuses and 16 stillborn foals with gestational ages from 3 1/2 to 11 months. diagnosis was based on one or more of the following: positive fetal antibody titer, positive fluorescent antibody test, demonstration of spirochetes in kidney and/or placental sections stained by the warthin-starry technique, high leptospiral titers in aborting mares, or isolation of leptospira spp. from fetal organs. gross lesions were observed in 80.3% of the fetuses, stillbor ...19938212458
[restriction endonuclease analysis of pomona serogroup of leptospira interrogans].restriction endonuclease analysis (rea) was performed on dnas from the type strains of the pomona serogroup of leptospira interrogans by using ecori and hhai restriction enzyme, and the electrophoretic patterns obtained were compared with patterns obtained from 27 isolates from pig kidneys collected at abattoirs in victoria, which belong to pomona serogroup previous identified by mat. all of the isolates were identified as serovar pomona.19938178514
[pcr amplification of the leptospiral dnas from different genus and species with the variable sequences of 16s rrna gene].we designed a pair of primers from the variable regions (v2 and v4) of 16s rrna gene of leptospira interrogans, i. e. pi: 5'ggg aac cta ata ctg gat gg; pii: 5' aca tag ttt caa gtg gag gc, and amplified the leptospiral dnas from different genus and species. when denaturing with 55 degrees c, all dnas of l. interrogans had the same products not only in length but also with kpn i-digested pattern. the dna of l. biflexa could be amplified with a c. a. 280 bp-band but not digested by kpn i, while the ...19938150433
[a polymerase chain reaction method for studying host persistence of pathogenic leptospira].polymerase chain reaction has for the first time been shown to be applicable to indication of leptospira interrogans in the organs of infected animals with acute or chronic leptospirosis (on the model of golden syrian hamsters). polymerase chain reaction is superior to microscopic and bacteriological analyses in identification of leptospirae in organ suspensions. the sensitivity of the technique is 1-10 cells per sample in studies of kidney or brain suspensions or 100-1000 cells in studies of li ...19948133845
[development of a test system for detecting leptospira interrogans using the polymerase chain reaction].based on polymerase chain reaction a test-system has been elaborated permitting one to identify the leptospirae of the most common serogroups (icterohaemorrhagiae, canicola, javanica, ballum, pyrogenes, pomona, habdomadis, sejroe, tarassovi) of the species leptospira interrogans. sensitivity of the technique is 1-10 cells in a sample. the specificity of the system has been shown to depend on the temperature of the primers annealing. the elaborated system exceeds all other systems for leptospiral ...19948133844
effect of streptomycin treatment on the shedding of and the serologic responses to leptospira interrogans serovar hardjo subtype hardjobovis in experimentally infected cows.shedding patterns of and serologic responses to leptospira interrogans serovar hardjo subtype hardjobovis (l. hardjobovis) have been studied in experimentally infected cows treated with streptomycin in comparison to experimentally infected cows receiving no such treatment. fourteen cows were experimentally infected with l. hardjobovis, and blood and urine samples were collected weekly for 24 weeks. the microscopic agglutination test (mat) and enzyme-linked immunosorbent assay (elisa) were used t ...19938128596
biological activity of a peptidoglycan extracted from leptospira interrogans: in vitro studies.peptidoglycan (pg) has been isolated from some species of spirochaetes, including leptospira interrogans. although leptospiral pg has been chemically characterized, no study has been carried out on its potential biological activity. since pg of treponema and borrelia is biologically active both in vivo and in vitro, we investigated the capacity of a leptospiral pg preparation to induce relevant biological effects. pg extracted from l. interrogans strain teramo was mitogenic at 0.1 microgram ml-1 ...19938126423
the search for improved methods for diagnosing leptospirosis: the approach of a laboratory in brescia, italy.the authors describe work in progress at the laboratory in brescia, italy, on the application of molecular methods to the diagnosis of leptospirosis. this work includes the following: a) development of polymerase chain reaction (pcr) assays capable of amplifying specific deoxyribonucleic acid fragments from most leptospira interrogans strains. b) development of a microtitre-based assay for rapid detection of pcr-positive samples. c) characterisation of leptospira strains through restriction endo ...19938104548
molecular analysis of the hsp (groe) operon of leptospira interrogans serovar copenhageni.a chromosomal gene library of leptospira interrogans serovar copenhageni strain wijnberg was constructed in phage lambda gt11. plaque immunoassay with r alpha p64 antiserum identified one clone expressing a putative groel homologue. dna sequence analysis of the 2.4 kb ecori-bam hi cloned fragment from strain wijnberg revealed two open reading frames encoding polypeptides of 10.5 kda (hsp10) and 58 kda (hsp58). sequence comparison of the deduced amino acid sequences of these orfs confirmed the op ...19938101351
leptospira species categorized by arbitrarily primed polymerase chain reaction (pcr) and by mapped restriction polymorphisms in pcr-amplified rrna genes.reference strains from 48 selected serovars representing eight species of leptospira were examined by two polymerase chain reaction (pcr)-based strategies. first, mapped restriction site polymorphisms (mrsp) were examined in pcr products from portions of rrs (16s rrna gene) and rrl (23s rrna gene). twenty mrsp and 2 length polymorphisms were used to group reference strains into 16 mrsp profiles. species assignments were consistent with those obtained by a second method, genomic fingerprinting wi ...19938094390
leptospirosis complicated by a jarisch-herxheimer reaction and adult respiratory distress syndrome: case report.leptospirosis, severe infection due to leptospira interrogans, is a potentially lethal disease that causes multiple organ failure. in addition to hepatic, renal, and cns involvement, which are classic complications of leptospirosis, the disease may also be complicated by adult respiratory distress syndrome. treatment with penicillin may precipitate a severe jarisch-herxheimer reaction. the mechanisms of leptospira-induced toxicity remain obscure. we report a near-fatal case of leptospirosis in a ...19948086528
the effect of vaccination against leptospira interrogans serovar hardjo infection at the time of service on pregnancy rates in dairy cows.fertility data from 16 dairy herds vaccinated against hardjo infection were used to assess pregnancy rates in cattle vaccinated around the day of mating. there was no improvement in pregnancy rates 30-60 d after vaccination. pregnancy rates in the period 5 d before and 10 d after vaccination were statistically lower than those found in 30-60 d around vaccination.19948038799
detection and identification of leptospira interrogans serovars by pcr coupled with restriction endonuclease analysis of amplified dna.primers for pcr were selected from a sequenced fragment of clone pl590, which contains a repetitive element present in the genome of leptospira interrogans serovar hardjo type hardjoprajitno (m. l. pacciarini, m. l. savio, s. tagliabue, and c. rossi, j. clin. microbiol. 30:1243-1249, 1992). a specific dna fragment was amplified from the genomic dnas of serovar hardjo type hardjoprajitno and nine serovars also belonging to l. interrogans as a consequence of the spread of the same or a closely rel ...19948027346
detection of leptospiral dna by pcr.an ecori fragment (1.2 kb) which is highly conserved among leptospira interrogans isolated in korea was cloned into pbluescript vector from l. interrogans serovar lai wh20. the ecori fragment was sequenced, and a pair of primers (lp1 and lp2) was designed for pcr assay. pcr amplification of target dna obtained from cultured l. interrogans showed that 274 bp could be detected when as little as 100 fg of leptospiral genomic dna was used in the reaction mixture. no amplification of dna was detected ...19948027306
comparative pathogenicity study of leptospira interrogans serovar pomona strains.the comparative pathogenicity study of two leptospira interrogans serovar pomona strains isolated from pig herds of different epizootiological status is reported. using monoclonal antibodies (mabs), the isolates were identified as leptospira interrogans serovar pomona. the results obtained for the reference strain of l. pomona were identical with those of the two isolates, with the exception of monoclonal serum designated 61-7, which gave a 1:30 titre with the reference strain. in a pig herd com ...19938017234
leptospirosis patient with aids: the first case reported.a case of renal icterohemorrhagic leptospirosis involving a patient with acquired immunodeficiency syndrome (aids) is reported. despite the low levels of cd4+ t lymphocytes, the clinical course of leptospirosis was similar to that observed in non-immunodepressed patients, and no worsening of aids occurred due to the infection by the spirochete. serologic conversion was observed in the microscopic agglutination test, with maximum titer of 1:3,200. the patient had positive urine cultures for lepto ...19948008919
seroprevalence of leptospirosis in a rural flood prone district of bangladesh.leptospirosis is a worldwide zoonotic disease. in the present investigation, a total of 89 human sera from a flood prone district of bangladesh was screened by a one-point microscapsule agglutination test (mcat). mcat-positive and -doubtful sera were further tested by microscopic agglutination test (mat) against 16 reference serovars of leptospira interrogans, and the antibody titres determined. in mcat, 34 sera were positive and 22 were doubtful. among those positive and doubtful sera, 33 and 2 ...19948005218
decreased erythrocyte osmotic fragility during canine leptospirosis.erythrocyte osmotic fragility (eof) was carried out in nineteen dogs naturally infected by leptospira interrogans serovar icterohaemorrhagiae/copenhagi. a decreased eof was observed, suggesting a modification of erythrocyte components secondary to disturbances that occur during canine leptospirosis, such as renal damage and hepatic disease.19947997768
return to oestrus after first insemination in sow herds (incidence, seasonality, and association with reproductivity and some blood parameters).as no systematic study has been done to get an accurate estimate of the incidence of return to oestrus after first insemination in sows in the netherlands, the objectives of this investigation were: 1) to obtain an estimate of the incidence of return to oestrus after insemination at the herd level; 2) to investigate the association between incidence of return to oestrus after first insemination and reproduction characteristics in order to get an impression of the economic importance of reproduct ...19947985351
characterization of an antigenic oligosaccharide from leptospira interrogans serovar pomona and its role in immunity.an antigenic oligosaccharide fraction derived from the lipopolysaccharide of leptospira interrogans serovar pomona was isolated by endo-glycosidase h digestion and column chromatography. the oligosaccharide contained rhamnose, ribose, glucose, and glucosamine and inhibited the binding of opsonic, protective monoclonal antibodies directed against the lipopolysaccharide. when conjugated to diphtheria toxoid, the oligosaccharide elicited the production of agglutinating, opsonic antibodies.19947960129
survey of antibodies against various infectious disease agents in racing camels in abu dhabi, united arab emirates.prevalence of antibodies against some important disease agents in sera from racing camels in abu dhabi (united arab emirates) is reported. antibodies against brucella abortus were detected in 1.5% of racing camels, but only 0.76% had titres sufficient for the animals to be considered infected. the complement fixation test revealed antibodies against coxiella burnetii (causative agent of q fever) in 7.9% of camels (with a geometrical mean titre of 13) and against parainfluenza virus type 3 in 5.6 ...19947949353
seroprevalence to leptospira interrogans serovar hardjo in merino stud rams in south australia.a serological survey of 2160 merino stud rams on 36 farms detected positive reactions greater than or equal to 1/100 in 42% of animals using the microscopic agglutination test (mat) to leptospira interrogans serovar hardjo. twenty flocks had seroprevalence values greater than 30% with 15 flocks having values > or = 60%. the enzyme-linked immunosorbent assays showed that 47% and 3% of rams on the 36 farms were positive for igg and igm antibodies, respectively. forty-five percent of hardjo reactio ...19947945098
lyme disease spirochetes in a wild fox (vulpes vulpes schrencki) and in ticks.lyme disease spirochetes were demonstrated in a wild female fox (vulpes vulpes schrencki) and in ixodes persulcatus ticks collected from the fox on sapporo, hokkaido, japan. spirochetes were detected in i. persulcatus, as well as skin lesions, brain, heart, kidney, and liver of the fox. five of seven isolates reacted with a monoclonal antibody against borrelia afzelii specific osp b. deoxyribonucleic acid (dna) relatedness of a brain isolate was 89% to b. afzelii, and ranged from 50 to 67% to th ...19947933292
rapid and specific detection of pathogenic leptospira species by amplification of ribosomal sequences.we have developed an assay for the detection of pathogenic leptospira that is based on the polymerase chain reaction. with the combination of agarose gel electrophoresis and blotting, pathogenic leptospira can be discriminated specifically from nonpathogenic leptospira and other bacterial species. this method, based on the amplification of 16s ribosomal rna sequences, is able to detect 10 leptospiral cells/ml in cattle urine samples and 100 leptospiral cells/ml in pig urine samples. using this a ...19947866864
a review of laboratory techniques and their use in the diagnosis of leptospira interrogans serovar hardjo infection in cattle.this paper reviews the laboratory diagnosis of leptospira hardjo infection in cattle. two genotypes of l hardjo, hardjoprajitno and hardjobovis, have been identified in cattle, but only hardjobovis has been isolated in australia. there are problems with diagnosis and control of bovine leptospirosis. infection is usually subclinical and the serological titres vary greatly in peak and duration. leptospires may be excreted in urine for up to 18 months. low microscopic agglutination test titres may ...19947818437
sheep as maintenance host for leptospira interrogans serovar hardjo subtype hardjobovis.transmission of leptospira interrogans serovar hardjo subtype hardjobovis from naturally infected sheep to uninfected sheep and calves was studied. a microscopic agglutination test and elisa were used to determine specific antibody responses in serum. polymerase chain reaction was used to detect bacterial shedding in urine. six sheep were derived from a dairy farm where cows were infected with l hardjobovis. three of these sheep were seropositive for l hardjobovis, and 1 also shed leptospires in ...19947802389
evaluation of an enzyme-linked immunosorbent assay that uses the 41-kd flagellin as the antigen for detection of antibodies to borrelia burgdorferi in cattle.an elisa was developed to detect antibodies to the 41-kd flagellin (p41) of borrelia burgdorferi in serum obtained from cattle. absorption studies, immunoblot analysis, immunoelectron microscopy, and correlation of results of the p41-elisa and the p39-elisa as well as measurement of the antibody to p41 in calves challenge-exposed with borrelia theileri were used to assess the specificity of the p41-elisa. antigens derived from escherichia coli, leptospira interrogans serovar hardjo, and b burgdo ...19947802386
protective effects of serum thymic factor to leptospira interrogans serovar copenhageni infection in mongolian gerbils.the susceptibility to leptospira interrogans serovar copenhageni in mongolian gerbils treated with 10 micrograms of serum thymic factor (fts) 1 day before infection was examined. susceptibility of gerbils treated 5 times with 10 micrograms of fts was also investigated. mortality of fts-treated gerbils was significantly lower than that of controls when small challenge doses were used. to analyse the fts-induced resistance to leptospiral infection, natural killer (nk) cell activity and macrophage ...19947801529
recognition of leptospira interrogans antigens by vaccinated or infected dogs.antigenic recognition of leptospiral antigens by vaccinated or infected dogs was studied by microagglutination test (mat) and by western blots. in western blots, serovar specific antigens detected by mat migrated in the 18-31 kda zone. the 25-31 zone seemed to be linked to antigens indicating virulence of the strain. these antigens are lps. the first antibodies made after infection are produced against lps migrating in the 14 kda zone. many protein antigens are common in leptospires belonging to ...19947801528
[scientific raisins from 125 years smw (swiss medical weekly). a brief report on the discovery of the pathogen (spirochaeta icterohaemorrhagiae nov. sp.) of so-called weil's disease in japan and on current studies of the disease. 1916]. 19957732354
prevalence of antibodies to different leptospira interrogans serovars in pigs on large farms.a seroepidemiological survey was carried out in the province of badajoz (south-western spain) in order to determine the presence and spread of leptospira interrogans. the 521 sera tested were drawn from breeding sows on 28 large farms (15 with fewer than 60 and 13 with over 60 breeders). immunological testing was performed using the martin-pettit micro-agglutination technique. pigs with titres equal to or greater than 1:100 were considered positive. haemolysed and/or contaminated test sera were ...19947701864
characterization of leptospiraceae by 16s dna restriction fragment length polymorphisms.chromosomal dna from 37 leptospiracae representing genetic species, groups and reference strains together with five leptospire isolates and escherichia coli were digested with the restriction endonucleases bamhi, clai and ecori. the southern blots were hybridized with a biotinylated e. coli 1.5 kb 16s rdna probe and gave 36 reproducible and unique patterns. with the exception of the type strain (leptospira interrogans serovar icterohaemorrhagiae rga) and neotype strain (serovar icterohaemorrhagi ...19937691982
comparison of genetic maps for two leptospira interrogans serovars provides evidence for two chromosomes and intraspecies heterogeneity.genetic maps were constructed for leptospira interrogans serovars icterohaemorrhagiae and pomona. previously we independently constructed physical maps of the genomes for these two serovars. the genomes of both serovars consist of a large replicon (4.4 to 4.6 mb) and a small replicon (350 kb). genes were localized on the physical maps by using southern blot analysis with specific probes. among the probes used were genes encoding a variety of essential enzymes and genes usually found near bacteri ...19937690025
inhibition of na,k-atpase by an endotoxin extracted from leptospira interrogans: a possible mechanism for the physiopathology of leptospirosis.clinical manifestations of leptospirosis include disorders of the electrolytical balance which might be related to inhibition of na,k-atpase. although the physiopathological cellular mechanism of leptospirosis remains unknown, a bacterial endotoxin has been incriminated. therefore, we evaluated whether a glycolipoprotein fraction extracted from leptospira interrogans and known to be cytotoxic might inhibit na,k-atpase. this glycolipoprotein fraction (glp) inhibited na,k-atpase activity in rabbit ...19957671008
[a clinico-epidemiological study of leptospirosis in adults in the province of ciego de avila].a clinical epidemiological study of reported leptospirosis cases in adults in the period 1984-1988 in the province ciego de avila, republic of cuba, was conducted. the most frequent symptoms and signs were: fever, headache and arthralgia. eighty-two percent of patient were anicteric. the most frequent presumptive diagnosis included leptospirosis, virosis, and febrile syndrome. sporadic cases predominated over cluster cases. the incidence of cases was higher from october to december. sixty-five p ...19957667520
need for vaccination of sewer workers against leptospirosis and hepatitis a.this study compared the prevalence of leptospira interrogans and hepatitis a virus (hav) antibodies in serum samples from sewer workers and controls.19957663634
association of leptospiral seroreactivity and breed with uveitis and blindness in horses: 372 cases (1986-1993).recurrent uveitis, a leading cause of blindness in horses, often develops as a sequela to systemic leptospirosis. over a 7-year period, 63 of 112 (56%) horses with uveitis were seropositive for leptospira interrogans serovar pomona, but only 23 of 260 (9%) horses without uveitis were seropositive. odds-ratio analysis revealed that seropositive horses were 13.2 times more likely to have uveitis than were seronegative horses. of the 63 seropositive horses with uveitis, 59% developed blindness, com ...19957591929
seroepidemiologic study of three zoonoses (leptospirosis, q fever, and tularemia) among trappers in québec, canada.this study was undertaken to evaluate the prevalence of antibodies against francisella tularensis, coxiella burnetii, and certain serovars of leptospira interrogans among trappers in québec, canada. muskrat trapping was identified as a risk factor for f. tularensis infection, whereas having a cat at home apparently protected trappers against infection by l. interrogans. high percentages of control sera were positive for antibodies against c. burnetii (15%) and l. interrogans (5%), most frequentl ...19957583933
leptospira interrogans serovar sejroe infection in a group of laboratory dogs.interstitial nephritis was seen histologically in 19 (59%) out of 32 pure-breed beagle dogs (16 males and 16 females) subjected to standard safety tests. in these animals no clinical abnormalities were observed and all the tested parameters (haematology, biochemistry and urine analysis) were within the normal ranges. leptospiral antibody titres ranging from 1 : 100 to 1 : 6400, against a serovar (hardjo) belonging to the sejroe serogroup, were detected by the microscopic agglutination test (mat) ...19957564215
leptospira icterohemorrhagiae and leptospire peptidolgycans induce endothelial cell adhesiveness for polymorphonuclear leukocytes.we have examined the effect of the virulent leptospira interrogans strain teramo, serotype icterohemorrhagiae, on the adherence of human neutrophilic polymorphonuclear leukocytes (pmn) to cultured human umbilical vein endothelial cells (hec). selective pretreatment of hec with intact or sonicated leptospires caused a dose- and time-dependent increase of hec-pmn adhesion (13.2% +/- 2.5% adherence to untreated hec versus 46.3% +/- 5.6% adherence to hec pretreated for 4 h with 10(8) intact leptospi ...19957542637
[transcript expression of the cpl 5x, bmd-3a, bmd-10 interrogans leptospira].total rna of leptospira interrogans sv lai strain 017 was prepared by the method of licl-urea, and was used in dot hybridization with biotin-labelled dna probes. the probes included bmd-3a, bmd-10, which were the leptospirial protective antigen genes, and cpl 5x, which was the genus specific gene of interrogans leptospira. all of the three probes have shown various degrees of hybridization signs, proving that they all have transcript expression in leptospira. the transcript expression is the mai ...19947538094
[16s rrna reverse transcription-polymerase chain reaction of leptospires].we amplified the leptospiral rnas of leptospira interrogans serovar lai strain lai and l. biflexa serovar patoc strain patoc i, extracted by the method of sio2-high concentration salt solution (8 mol/l guhcl) absorption, with the 16s rrna gene primers of leptospira interrogans by reverse transcription-polymerase chain reaction (rt-pcr). it demonstrated that the detecting sensitivity by naked eye after electrophoresis could be 100 times higher when we amplified dna and rna of leptospires at the s ...19947528714
a neutral sugar is responsible for serovar specificity of the antigenic determinant of leptospira interrogans serovar canicola.to provide information on the chemical structures of antigenic determinants of leptospira, glycolipids of leptospira interrogans serovar canicola strain hond utrecht iv (ut-iv) and its antigenic variant selected in the presence of a serovar-specific monoclonal antibody were compared physicochemically. gas-liquid chromatography-mass spectrometry analysis revealed that the glycolipid of ut-iv contained 6 neutral sugar species; rhamnose, mannose, galactose, glucose, and unknown sugars iii and iv, i ...19947528287
effective treatment with dihydrostreptomycin of naturally infected cows shedding leptospira interrogans serovar hardjo subtype hardjobovis.the efficacy of dihydrostreptomycin in stopping the shedding of leptospira hardjo subtype hardjobovis was studied in naturally infected cows. blood and urine samples were collected from dairy cows kept on a farm where the farmer had contracted l hardjobovis infection. a microscopic agglutination test and an elisa were used to determine specific antibody responses in serum. polymerase chain reaction was used to detect bacterial shedding in urine. on the first sample collection date, 6 cows were s ...19947514850
immunochemical studies of opsonic epitopes of the lipopolysaccharide of leptospira interrogans serovar hardjo.leptospiral lipopolysaccharides (lps) are the main antigens responsible for immunity in leptospirosis. in this investigation we studied the nature of the antigenic determinants of lps extracted from leptospira interrogans serovar hardjo (reference strain hardjoprajitno). the reactions of anti-lps monoclonal antibodies (mabs) mum/f1-4/hardjo (igm) and mum/f1-6/hardjo (igg) with whole cell lysates in western immunoblotting analysis were unaffected by proteinase k treatment. periodate treatment of ...19947513591
[return to estrus following first insemination in sow herds (incidence and association with reproductivity and various blood parameters)].as no systematic study has been done to get an accurate estimate of the incidence of return to oestrus after first insemination in sows in the netherlands, the objectives of this investigation were: 1) to obtain an estimate of the incidence of return to oestrus after insemination at the herd level; 2) to investigate the association between incidence of return to oestrus after first insemination and reproduction characteristics to get an impression of the economic importance. these objectives wer ...19937505958
Displaying items 2101 - 2200 of 2728